Codon, Nonsense

ARPE19 (ATCC, Manassas, USA, Cat. No. CRL‐2302) cells were referred to CRISPR/Cas9‐mediated knock‐out of the SUMF1 gene to generate the ARPE19 SUMF1^−/− cell line. The gRNA sequence was determined by using the CRISPOR online tool (http://crispor.tefor.net/crispor.py; Concordet & Haeussler, 2018 (link)) and selected based on the lowest off‐target score. The gRNA with the 5′‐3′ sequence CCCTTGCGGGTTCTTGCGGCTGC was used in an “all‐in‐one” vector additionally encoding Cas9 linked to green‐fluorescent protein (Cas9‐GFP) (Sigma‐Aldrich, St. Louis, USA). Plasmid‐DNA was electroporated into ARPE19 cells using the Amaxa system and a nucleofection kit (Lonza, Basel, Switzerland, Cat. No. VCA‐1003) following the manufacturers' instructions. GFP‐positive cells were sorted by fluorescent‐activated‐cell‐sorting (FACS) into 96‐well plates. Single‐cell derived colonies were screened for deletion mutations in the SUMF1 gene after extraction of genomic DNA, amplification of the target region by PCR (forward primer hSUMF1KOup, 5′‐3′‐sequence: cagcgccaaagaagtacctg, reverse primer hSUMF1KOlow, 5′‐3′‐sequence: tcggaggaatcgatggagc), followed by Sanger sequencing using the same primers. A cell clone carrying a homozygous deletion in the SUMF1 gene (c.139delCG, p.Ala47GlyfsTer74) leading to a premature stop codon was selected and expanded. Cells of the respective clone were subjected to cell lysis, protein estimation, and Western Blot analysis as described above using a SUMF1 antibody (R&D Systems, Minneapolis, USA, Cat No AF3680) to verify absent FGE protein expression (Appendix Fig S12).

The plastomes were initially annotated by using GeSeq [68 (link)] with two reference genomes (Carnegiea gigantea, GenBank: NC_027618.1 and Lophocereus schottii, GenBank: NC_041727.1). Subsequently, annotations with problems were manually edited by using Apollo [69 ]. To further confirm the presence or absence of genes, we used the 80 unique protein-coding genes (PCGs) and the 30 unique tRNA genes annotated in Portulaca oleracea as query sequences to search for homologous sequences using the BLASTn program [70 (link)]. The parameters were as follows: -evalue 1e-5, -word_size 9, -gapopen 5, - gapextend 2, -reward 2, -penalty − 3, and -dust no. If only a partial sequence of the gene was identified in each genome, this gene was considered a pseudogene. However, for genes whose conserved functional domains still exist, such as accD, further experiments are still needed for confirmation. If a premature termination codon was encountered in the coding sequence, we also considered it to be a pseudogene, although we cannot rule out the possibility of an RNA editing event for correction.