G-Quadruplexes

A DNA hairpin labelled with sCy3 on a 3′ dT (Figure 4B) exhibited increased fluorescence intensity that was associated with hairpin closing [93 (link)]. By examining a series of DNA hairpins and duplexes, it was shown that sCy3 undergoes site-specific stacking in a nick, gap or overhang region of duplex DNA. The sCy3 showed changes in fluorescence intensity at both the ensemble and single-molecule levels, and corresponding changes in fluorescence lifetimes were also observed at the ensemble level. The increase in fluorescence intensity or lifetime was attributed to a reduction in the rate of photoisomerisation upon stacking and hence was termed stacking-induced fluorescence increase (SIFI) [93 (link),94 ]. This specific stacking interaction, and the previously reported stacking of cyanine dyes on the blunt end of duplex DNA [95 (link),96 ], and on G-quadruplexes [97 (link)] should be considered as a subset of NAIFE (section 3.1).
Double labelling of a DNA hairpin with sCy3 and sCy5 as a FRET donor and acceptor, respectively, allowed a direct comparison of FRET and SIFI [94 ]. With both dyes fluorescently active, a FRET increase was observed upon hairpin closing, with sCy3 transitioning from high (open hairpin) to lower fluorescence intensity (closed hairpin). Following acceptor photobleaching, the sCy3 continued to exhibit intensity fluctuations but now transitioning from the same high fluorescence intensity as the FRET-active hairpin to an even higher intensity, which was due to the closing of the hairpin, stacking of the sCy3 on DNA and subsequently a reduction in photoisomerisation. Analysis of the two-state dynamics using hidden Markov modelling reported that the same opening and closing rates could be recovered via both FRET and SIFI. The ability to probe such global structural changes using only a single dye could be advantageous since it requires less synthetic modification, less chemical perturbation to the native behaviour and frees up a spectral window, which can be used for combining other fluorescence measurements.
It was also shown that fluorescence intensities and lifetimes of sCy3 are extremely sensitive to local changes at the site of stacking [93 (link)]. This was exploited by designing a DNA structure containing an abasic site in duplex DNA at distances of ≤20 nucleotides away from the sCy3 stacking site. The average fluorescence lifetime of the sCy3 was found to oscillate as a function of the distance from the abasic site; this was attributed to long-range, through-backbone allosteric interactions, which modulate the local sCy3 stacking interaction. This agreed with earlier studies of allostery in protein-DNA interactions, whereby the binding of one protein on one site in DNA affected the binding of a second protein on another site further along the duplex [98 (link),99 ].

Initially, a duplex-G4-duplex system was created that lacked the poly dT loop region. Duplex regions were built as B-form DNA using the structure editor function of UCSF Chimera v1.12. The G-quadruplex portion was built using atomic coordinates from parallel G4 structure 1XAV from the PDB. The three DNA regions were pieced together in Schrodinger's Maestro (Schrodinger Inc., https://www.schrodinger.com/) with potassium ions added and minimized between the G-tetrad stacks of the G4 using Maestro's minimization function with OPLS3e (33 (link),34 (link)) force field and VSGB (35 (link)) (Generalized Born continuum solvent) model. Minimization was performed with 2 iterations, 65 steps per iteration, and an RMS gradient for convergence of 0.01 kcal/mol/Å. This loop-less model was simulated for 100 ns using the OL15 (36 (link)) DNA force field with TIP3P (37 ) waters (‘OL15-TIP3P’) which has worked well in the past for modeling the solution structures of higher-order DNA G4s (11 (link),38 (link)). The resulting lowest energy model was chosen from the trajectory and used as starting coordinates for building in the poly dT loop region by systematically ‘growing’ each dT residue from 5’ to 3’ using Maestro's place fragment function. As each fragment was placed, slight manual adjustments to sugar-phosphate backbone were made to generate a reasonable loop topology to attached to the 5’ of the opposite duplex handle region. The dT loop was subsequently minimized twice using Prime (as above) while holding the duplex and G4 regions rigid. This model was subsequently used to generate two ‘bent’ models, one in which the 5’ duplex region was unstacked (‘5’ unstacked model’) and one with the 3’ duplex unstacked (‘3’ unstacked model’). In both cases the poly dT loop region was minimized using Prime (as above), prior to 100 ns simulations using the OL15-TIP3P and Joung and Cheatham (39 (link)) potassium ion parameters.

DNA oligonucleotides were purchased from IDT (Coralville, IA). The DGD construct was prepared in the following way. First, the 46 nt G-quadruplex strand (5’- CTATGTATACAAAGAGGGTGGGTAGGGTGGGTTTAATGCGGCACGC) was diluted to 10 μM in 100 mL of BPEK buffer (8 mM sodium phosphate buffer supplemented with 185 mM KCl, pH 7.2, with 1 mM sodium EDTA to inhibit DNase). The sample was then heated to 99.9°C for 20 min before slow cooling overnight in a 2 L water bath. The sample was then concentrated to approximately 1 mM and mixed with the 46 nt surrogate-complement strand (5’- GCGTGCCGCATTAATTTTTTTTTTTTTTTTTTTTTTGTATACATAG) at a 1:1 ratio. The sample was then incubated overnight at 4°C to allow for annealing of the duplex regions. The sample was subsequently filtered through 0.2 μm filters and purified by size-exclusion chromatography (SEC) using a Superdex 75 16/600 SEC column (GE Healthcare 28-9893-33) running at 0.5 ml/min with fractions collected every 2 min. The purified aliquots were then concentrated with Pierce protein concentrators (ThermoFisher, #88515) and stored at 4°C until use.