Log In Sign up
The largest database of trusted experimental protocols
> Living Beings > Bacterium > Agrobacterium

Agrobacterium

Agrobacterium is a genus of gram-negative bacteria known for its ability to transfer genetic material to plant cells, making it a widely used tool in plant biotechnology.
These soil-dwelling bacteria can infect a variety of plant species and induce the formation of tumors or hairy root growth.
The Agrobacterium genome contains a tumor-inducing (Ti) plasmid that encodes the genes necessary for this genetic transfer process.
Researchers leverage Agrobacterium's unique properties to insert desirable genes into plant cells, enabling the production of transgenic plants for various agricultural and scientific applications.
Understanding the optimal Agrobacterium techniques and products is crucial for enhancing reproducibility and accuracy in plant research and engineering.

Most cited protocols related to «Agrobacterium»

1
Versatile GFP and LacZ Cloning System
A GFP gene was flanked by BsaI restriction sites using PCR amplification of a GFP coding sequence using primers bsgfp3 (ttt ggtctc a aggt atggtgagcaagggcgaggag) and bsgfp2 (ttt ggtctc a aagc ttacttgtacagctcgtcc). The PCR fragment was cloned in pGEM-T (Promega), resulting in construct pE-GFP. The LacZ cassette and the flanking BsaI sites present in pX-lacZ was obtained by PCR amplification from pUC19 DNA using primers laczins3 (tttcgtctctgtcg aggt a gagacc gaattcgcagctggcacgacaggtttc) and laczins6 (tttcgtctcttacc aagc t gagacc acggttgtgggtcacagcttgtctgtaagcg). The plasmid backbone of pX-lacZ contains a kanamycin resistance gene (derived from pBIN19) for selection in E.coli and Agrobacterium and does not contain any BsaI restriction site other than the two sites flanking the LacZ fragment. Other elements of the constructs (attB site, viral sequences) are as described in [2] (link). The GFP sequences in plasmids pE-GFP3 and pE-GFP2 were obtained by PCR amplification using primers pairs calgef3/bsgfp5 (ggtctc a tatggtgagcaagggcgaggag/ggtctc a cttgtacagctcgtccatgccg) and bsgfp3 (ttt ggtctc a aggt atggtgagcaagggcgaggag)/bsgfp5 and cloned in pUC19 digested with SmaI. pE-S was obtained by PCR amplification of a Nicotiana plumbaginifolia apoplast signal peptide from cloned sequences using primers calgef1 (ggtctc a aggtatggctactcaacgaagggc) and calgef2 (ggtctc a catacctgagacgacagcgacgag) and cloned in pUC19 digested with SmaI. pE-H was made by cloning an adapter (ggtct cacaa gggca gcagc cacca ccacc accac cacta agctt tgaga cc) into the SmaI site of pUC19.
Plasmid pECV was made by first amplifying a LacZ fragment by PCR from pUC19 using primers ecv1 (ttt gaagacttgtcgggtctcaaggtgcagctggcacgacaggtttc) and ecv2 (ttt gaagactttaccggtctcaaagccgcgcgtttcggtgatgac). The primers introduce the BsaI restriction site flanking the LacZ gene. This fragment is cloned using BpiI into a vector backbone fragment amplified from pUC19spec (pUC19spec is identical to pUC19 except that the bla gene was replaced by a spectinomycin resistance gene, this backbone was chosen because it does not contain an internal BsaI restriction site) using primers bpi191 (tttt cgacaagtcttcattaatgaatcggccaacgcgc) and bpi192 (tttt ggtaaagtcttccgggagctgcatgtgtcag).
Engler C., Kandzia R, & Marillonnet S. (2008). A One Pot, One Step, Precision Cloning Method with High Throughput Capability. PLoS ONE, 3(11), e3647.
Full text: Click here
Publication 2008
Agrobacterium Cloning Vectors Escherichia coli Genes HMN (Hereditary Motor Neuropathy) Proximal Type I Kanamycin Resistance LacZ Genes Nicotiana Oligonucleotide Primers Open Reading Frames Plasmids Promega prostaglandin M Signal Peptides Spectinomycin Vertebral Column
2
Transient Luciferase Assay in Tobacco
Tobacco leaves were harvested approximately 70 hours after infiltration with Agrobacterium containing the plasmid encoding the respective genes under control of the 35S promoter. Tissue was frozen in liquid nitrogen, protein was extracted as described by [30 ] and assayed as described by [18 (link),17 (link)].
Firefly Luciferase and Renillia luciferase were assayed using the dual luciferase assay reagents (Promega, Madison, USA). After inoculation and a transient incubation of 2–4 days, 2 cm leaf discs were harvested and ground in 500 μl of Passive Lysis Buffer. Five μl of a 1/100 dilution of this crude extract was assayed in 40 μl of Luciferase Assay Buffer, and the chemiluminescence measured. 40 μl of Stop and Glow™ buffer was then added and a second chemiluminescence measurement made. Absolute RLU were measured in a Turner 20/20 luminometer, with a 5 second delay and 15-second measurement. Data was collected as ratio or, for multiple data points (e.g. several leaves of different ages were infiltrated), the regression-gradient and regression-standard-error were used as a measure of relative promoter strength. Ratios are without units as both the light measurement and protein concentrations are identical. Background controls were run with only the promoter-LUC, 35S-REN reporter plasmid (no TF). In some cases, positive controls were run using a TF with known activity.
Hellens R.P., Allan A.C., Friel E.N., Bolitho K., Grafton K., Templeton M.D., Karunairetnam S., Gleave A.P, & Laing W.A. (2005). Transient expression vectors for functional genomics, quantification of promoter activity and RNA silencing in plants. Plant Methods, 1, 13.
Full text: Click here
Publication 2005
Agrobacterium Biological Assay Buffers Chemiluminescence Chemiluminescent Assays Complex Extracts Freezing Gene Expression Regulation Light Luciferases Luciferases, Firefly Nicotiana Nitrogen Plasmids Promega Proteins Technique, Dilution Tissues Transients Vaccination
3
Chemically Competent Cell Preparation
Chemically competent cells were prepared as described earlier [21] . Agrobacterium infiltration of plant tissue has been described in [25] (link). Plasmid DNA minipreps were made using the Nucleospin Plasmid Quick Pure kit from Macherey-Nagel, Düren, Germany.
Engler C., Gruetzner R., Kandzia R, & Marillonnet S. (2009). Golden Gate Shuffling: A One-Pot DNA Shuffling Method Based on Type IIs Restriction Enzymes. PLoS ONE, 4(5), e5553.
Full text: Click here
Publication 2009
Agrobacterium Cells Plants Plasmids Tissues
4
CRISPR Mutation Analysis in Arabidopsis
We transformed the pHEE2A/B/D1/D2/D3/E/F-TRI, pHEN2C-TRI, pHSE2A-TRI, and pHEE2A-CHLI constructs into Agrobacterium strain GV3101, and transformed pHEN2A/B-TRI into GV3101/pSoup [26 (link)]. We transformed Arabidopsis Col-0 wild-type plants via the floral dip method [45 (link)]. We screened the collected seeds from the T0 plants on MS plates containing 25 mg/L hygromycin, and transplanted the resistant seedlings (T1) to soil. We extracted genomic DNA from T1 transgenic plants grown in soil. To analyze mutations of TRY, CPC, and ETC2, we amplified fragments surrounding the target sites of TRY, CPC, or ETC2 by PCR using gene-specific primers TRY-IDF0/R0, CPC-IDF0/R0, or ETC2-IDF0/R0, respectively [26 (link)]. We submitted purified PCR products for direct sequencing with primers TRY/CPC/ETC2-seqF [26 (link)] located within the PCR fragments. To analyze possible mutations of potential off-target sites of TRY, CPC, and AT5G50230 of the sgRNA targeting ETC2, we amplified fragments surrounding the off-target sites by PCR using gene-specific primers TRY-off-IDF/R, CPC-off-IDF2/R, or 5G50230-off-IDF/R, respectively. We submitted purified PCR products for direct sequencing (as opposed to sequencing of individual clones of PCR products) with primers TRY/CPC/5G50230-off-seqF located within the PCR fragments. To analyze mutations of CHLI1 and CHLI2, we amplified fragments surrounding the target sites of CHLI1 or CHLI2 by PCR using gene-specific primers CHLI1-IDF/R or CHLI2-IDF/R, respectively. We submitted purified PCR products for direct sequencing with primers CHLI1/2-seqF located within the PCR fragments. We then cloned poorly sequenced PCR products, and submitted individual positive clones for sequencing using the T7 primer. To screen the segregated non-transgenic T2 plants, we first screened nine primer combinations, with three forward primers including zCas9-IDF3-2/-IDF5/-IDF6 (located at zCas9) and three reverse primers including rbcS_E9t-IDR/-IDR2 (located at rbcS-E9 terminator) and lacp-IDF (located at the lac promoter of the vector backbone), for more specific primers (Additional file 2: Table S3). We obtained three more specific primer pairs, including zCas9-IDF3-2/rbcS_E9t-IDR2, zCas9-IDF5/lacp-IDF, and zCas9-IDF6/lacp-IDF, with wild-type genomic DNA serving as a negative control and genomic DNA from T1 transgenic plants serving as a positive control (Additional file 2: Table S3). We then performed counterselection PCR with the three primer pairs for screening of non-transgenic T2 plants.
Wang Z.P., Xing H.L., Dong L., Zhang H.Y., Han C.Y., Wang X.C, & Chen Q.J. (2015). Egg cell-specific promoter-controlled CRISPR/Cas9 efficiently generates homozygous mutants for multiple target genes in Arabidopsis in a single generation. Genome Biology, 16(1), 144.
Full text: Click here
Publication 2015
Agrobacterium Arabidopsis Clone Cells Cloning Vectors DNA Fingerprinting Erythrocytes Genes Genome hygromycin A Mutation Oligonucleotide Primers Plant Embryos Plants Plants, Transgenic Seedlings Strains Vertebral Column
5
CRISPR/Cas9 Transformation of Maize
The CRISPR/Cas9 binary vector pBUE-2gRNA-ZH was transformed into Agrobacterium strain EHA105, and Agrobacterium-mediated method was used to transform immature embryos of B73 maize at China Agricultural University Transgenic Facility Center. The genomic DNA was extracted from 20 transgenic seedlings and the PCR fragment, primers and reactions were the same as those described above. For restriction enzyme digestion analysis, about 500 ng purified PCR products from each reaction was digested overnight with XcmI or SphI in a 20-μL reaction volume. For sequencing analysis, the PCR products from two representative transgenic seedlings were cloned into the cloning vector pCBC and positive clones were sequenced using the T7 primer.
Xing H.L., Dong L., Wang Z.P., Zhang H.Y., Han C.Y., Liu B., Wang X.C, & Chen Q.J. (2014). A CRISPR/Cas9 toolkit for multiplex genome editing in plants. BMC Plant Biology, 14, 327.
Full text: Click here
Publication 2014
Agrobacterium Animals, Transgenic Clone Cells Cloning Vectors Clustered Regularly Interspaced Short Palindromic Repeats Digestion Embryo Genome Maize Oligonucleotide Primers Restriction Mapping S-pentachlorobuta-1,3-dien-yl-cysteine Seedlings Sequence Analysis Strains

Most recents protocols related to «Agrobacterium»

1
Arabidopsis Floral Dip Transformation Protocol
Not available on PMC !

Example 12

Plant transformation—The Arabidopsis thaliana var Columbia (To plants) were transformed according to the Floral Dip procedure [Clough S J, Bent A F. (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. 16(6): 735-43; and Desfeux C, Clough S J, Bent A F. (2000) Female reproductive tissues were the primary targets of Agrobacterium-mediated transformation by the Arabidopsis floral-dip method. Plant Physiol. 123(3): 895-904] with minor modifications. Briefly, Arabidopsis thaliana Columbia (C010) T0 plants were sown in 250 ml pots filled with wet peat-based growth mix. The pots were covered with aluminum foil and a plastic dome, kept at 4° C. for 3-4 days, then uncovered and incubated in a growth chamber at 18-24° C. under 16/8 hours light/dark cycles. The T0 plants were ready for transformation six days before anthesis.

Single colonies of Agrobacterium carrying the binary vectors harboring the genes of some embodiments of the invention were cultured in YEBS medium (Yeast extract 1 gr/L, Beef extract 5 gr/L, MgSO4*7H2O, Bacto peptone 5 gr/L) supplemented with kanamycin (50 mg/L) and gentamycin (50 mg/L). The cultures were incubated at 28° C. for 48 hours under vigorous shaking to desired optical density at 600 nm of 0.85 to 1.1. Before transformation into plants, 60 μl of Silwet L-77 was added into 300 ml of the Agrobacterium suspension.

Transformation of T0 plants was performed by inverting each plant into an Agrobacterium suspension such that the above ground plant tissue was submerged for 1 minute. Each inoculated T0 plant was immediately placed in a plastic tray, then covered with clear plastic dome to maintain humidity and was kept in the dark at room temperature for 18 hours to facilitate infection and transformation. Transformed (transgenic) plants were then uncovered and transferred to a greenhouse for recovery and maturation. The transgenic T0 plants were grown in the greenhouse for 3-5 weeks until siliques were brown and dry, then seeds were harvested from plants and kept at room temperature until sowing.

For generating T1 and T2 transgenic plants harboring the genes of some embodiments of the invention, seeds collected from transgenic T0 plants were surface-sterilized by exposing to chlorine fumes (6% sodium hypochlorite with 1.3% HCl) for 100 minutes. The surface-sterilized seeds were sown on culture plates containing half-strength Murashig-Skoog (Duchefa); 2% sucrose; 0.5% plant agar; 50 mg/L kanamycin; and 200 mg/L carbenicylin (Duchefa). The culture plates were incubated at 4° C. for 48 hours and then were transferred to a growth room at 25° C. for three weeks. Following incubation, the T1 plants were removed from culture plates and planted in growth mix contained in 250 ml pots. The transgenic plants were allowed to grow in a greenhouse to maturity. Seeds harvested from T1 plants were cultured and grown to maturity as T2 plants under the same conditions as used for culturing and growing the T1 plants.

US11859197B2. Insecticidal polypeptides and use thereof (2024-01-02). EVOGENE LTD. [IL]. Inventors: Or Rotem [IL], Moshe Elbaz [IL], Michal Simovitch Etkes [IL], Lisa N. Meihls [US], Noam Ben Naim [IL], Dhritiman Ghosh [US].
Full text: Click here
Patent 2024
Agar Agrobacterium Aluminum Animals, Transgenic Arabidopsis Arabidopsis thalianas Bacto-peptone Beef Chlorine Cloning Vectors Culture Media Decompression Sickness Females Genes Genes, Plant Gentamicin Humidity Infection Kanamycin Marijuana Abuse Plant Diseases Plant Embryos Plants Plants, Transgenic Reproduction Saccharomyces cerevisiae silwet L-77 Sodium Hypochlorite Sucrose Sulfate, Magnesium Tissues
2
Increasing Oil Content in Forage Crops
Not available on PMC !

Example 6

Oil content in the dicotyledonous plant species Trifolium repens (clover), a legume commonly used as a pasture species, was increased by expressing the combination of WRI1, DGAT and Oleosin genes in vegetative parts. The construct pJP3502 was used to transform T. repens by Agrobacterium-mediated transformation (Larkin et al., 1996). Briefly, the genetic construct pJP3502 was introduced into A. tumefaciens via a standard electroporation procedure. The binary vector also contained a 35S:NptII selectable marker gene within the T-DNA. The transformed Agrobacterium cells were grown on solid LB media supplemented with kanamycin (50 mg/L) and rifampicin (25 mg/L) and incubated at 28° C. for two days. A single colony was used to initiate a fresh culture. Following 48 hours vigorous culture, the Agrobacterium cells was used to treat T. repens (cv. Haifa) cotyledons that had been dissected from imbibed seed as described by Larkin et al. (1996). Following co-cultivation for three days the explants were exposed to 25 mg/L kanamycin to select transformed shoots and then transferred to rooting medium to form roots, before transfer to soil.

Six transformed plants containing the T-DNA from pJP3502 were obtained and transferred to soil in the glasshouse. Increased oil content was observed in the non-seed tissue of some of the plants, with one plant showing greater than 4-fold increase in TAG levels in the leaves. Such plants are useful as animal feed, for example by growing the plants in pastures, providing feed with an increased energy content per unit weight (energy density) and resulting in increased growth rates in the animals.

The construct pJP3502 is also used to transform other leguminous plants such as alfalfa (Medicago sativa) and barrel medic (Medicago truncatula) by the method of Wright et al. (2006) to obtain transgenic plants which have increased TAG content in vegetative parts. The transgenic plants are useful as pasture species or as hay or silage as a source of feed for animals such as, for example, cattle, sheep and horses, providing an increased energy density in the feed.

US11859193B2. Plants with modified traits (2024-01-02). Commonwealth Scientific and Industrial Research Organisation [AU]. Inventors: XueRong Zhou [AU], Qing Liu [AU], Anna El Tahchy [AU], Srinivas Belide [AU], Madeline Claire Mitchell [AU], Uday Kumar Divi [AU], Thomas Vanhercke [AU], James Robertson Petrie [AU], Surinder Pal Singh [AU], Allan Graham Green [AU].
Full text: Click here
Patent 2024
Agrobacterium Alfalfa Animals Cattle Cells Cloning Vectors Cotyledon Domestic Sheep Electroporation Equus caballus Fabaceae Genes Kanamycin Magnoliopsida Markers, DNA Medicago truncatula Plant Embryos Plant Oils Plant Roots Plants Plants, Transgenic Reproduction Rifampin Silage Tissues Trifolium Trifolium repens
3
CRISPR/Cas9-Mediated Genome Editing in Rice
For the complementation test, a 5.5-kb genomic fragment of NB was amplified by PCR with the “RBG1-genomic” primer pair listed in Supplementary Table S3 and then cloned and inserted into a pPZP2H-lac binary vector. The sequence of the clone was confirmed. For genome editing, the CRISPR/Cas9 cleavage site of RBG1res was prepared using CRISPR-P 2.0 (https://cbi.hzau.edu.cn/CRISPR2/), and the vectors were constructed according to a previously published method57 (link). We cloned the guide RNA (gRNA) expression cassettes and inserted them into a pZDgRNA binary vector by cleavage with AscI and PacI. The primers used for this experiment are shown in Supplementary Table S3.
The resulting constructs were introduced into Agrobacterium tumefaciens strain EHA101 by electroporation. Agrobacterium-mediated rice transformation was then performed as described previously58 (link),59 (link). A single copy was selected using the hygromycin phosphotransferase gene by segregation among the progeny. Control plants were generated by introducing an empty vector.
Mizobuchi R., Sugimoto K., Tsushima S., Fukuoka S., Tsuiki C., Endo M., Mikami M., Saika H, & Sato H. (2023). A MAPKKK gene from rice, RBG1res, confers resistance to Burkholderia glumae through negative regulation of ABA. Scientific Reports, 13, 3947.
Full text: Click here
Publication 2023
Agrobacterium Agrobacterium tumefaciens Cloning Vectors Clustered Regularly Interspaced Short Palindromic Repeats Cytokinesis Electroporation Genes Genetic Complementation Test Genome hygromycin-B kinase Oligonucleotide Primers Oryza sativa Plants Strains Transcription, Genetic
4
Genetic Transformation of Arabidopsis
Agrobacterium tumefaciens GV3101 transformed the pRI101-AN vector with the open reading frame (ORF) after it had been cloned and inserted. Transformation of Agrobacterium into Arabidopsis by flower dip method. On MS media containing 50 mg L−1 kanamycin, T1 VcSnRK2.3 transgenic plants were selected. Until seed set, kanamycin-resistant T1 seedlings were cultivated in a growth chamber at 22°C and a 16 h day length. Seeds of T1 plants were planted and germinated to obtain T2 seedlings. T2 seedlings were also selected on MS medium containing 50 mg L−1 kanamycin.
Wang X., Tang Q., Chi F., Liu H., Zhang H, & Song Y. (2023). Sucrose non-fermenting1-related protein kinase VcSnRK2.3 promotes anthocyanin biosynthesis in association with VcMYB1 in blueberry. Frontiers in Plant Science, 14, 1018874.
Full text: Click here
Publication 2023
Agrobacterium Agrobacterium tumefaciens Arabidopsis Cloning Vectors Kanamycin Plant Embryos Plants, Transgenic Seedlings
5
Transient Expression of VcSnRK2.3 and VcMYB1
Effector constructs were generated from Agrobacterium GV3101 strains containing the pRI101-VcSnRK2.3 and pRI101-VcMYB1 genes. The reporter constructs were generated using the promoter sequences of VcDFR cloned upstream of the β-glucuronidase (GUS) reporter gene in the pCAMBIA1301 vector. Agrobacterium GV3101 strains carrying pRI101-VcSnRK2.3 and pRI101-VcMYB1 were co-injected into the abaxial surface of tobacco leaves. Infected leaves were grown in growth chambers for 3-4 days and then analyzed for GUS activity. Proteins were extracted from infected leaves and fluorescence was measured with a fluorometer (VersaFluor Fluorometer, Bio-Rad) (http://www.bio-rad.com) with reference to Jefferson et al., 1987 (link) and Bowling et al., 1994 (link).
Wang X., Tang Q., Chi F., Liu H., Zhang H, & Song Y. (2023). Sucrose non-fermenting1-related protein kinase VcSnRK2.3 promotes anthocyanin biosynthesis in association with VcMYB1 in blueberry. Frontiers in Plant Science, 14, 1018874.
Full text: Click here
Publication 2023
Agrobacterium beta-Glucuronidase Cloning Vectors Fluorescence Genes Genes, Reporter Nicotiana Proteins Strains

Top products related to «Agrobacterium»

1
Dual luciferase reporter assay system by Promega
Sourced in United States, China, Germany, United Kingdom, Switzerland, Japan, France, Italy, Spain, Austria, Australia, Hong Kong, Finland
The Dual-Luciferase Reporter Assay System is a laboratory tool designed to measure and compare the activity of two different luciferase reporter genes simultaneously. The system provides a quantitative method for analyzing gene expression and regulation in transfected or transduced cells.
2
Tcs sp8 by Leica camera
Sourced in Germany, United States, Japan, United Kingdom, China, Canada, Italy
The Leica TCS SP8 is a high-performance confocal laser scanning microscope. It features a modular design, allowing for customization to meet specific research needs. The TCS SP8 provides advanced imaging capabilities, including multi-channel fluorescence detection and high-resolution image acquisition.
3
Clonexpress 2 one step cloning kit by Vazyme
Sourced in China, United States
The ClonExpress II One Step Cloning Kit is a molecular biology tool designed for rapid and efficient DNA cloning. It facilitates the seamless assembly of DNA fragments without the need for restriction enzymes or ligase. The kit provides a simple and streamlined cloning process, enabling researchers to quickly generate recombinant DNA constructs.
4
Pentr d topo by Thermo Fisher Scientific
Sourced in United States, Germany, United Kingdom
The PENTR/D-TOPO is a vector system designed for the efficient cloning of Polymerase Chain Reaction (PCR) products. It facilitates the direct insertion of PCR amplicons into a plasmid vector without the need for restriction enzyme digestion or ligase. The vector is pre-linearized and contains complementary 3' single-stranded overhangs, allowing for the seamless ligation of PCR products.
5
Lsm 880 by Zeiss
Sourced in Germany, United States, United Kingdom, Japan, China, Switzerland, France, Austria, Canada, Australia
The LSM 880 is a laser scanning confocal microscope designed by Zeiss. It is a versatile instrument that provides high-resolution imaging capabilities for a wide range of applications in life science research.
6
Lsm 710 by Zeiss
Sourced in Germany, United States, United Kingdom, Japan, Switzerland, France, China, Canada, Italy, Spain, Singapore, Austria, Hungary, Australia
The LSM 710 is a laser scanning microscope developed by Zeiss. It is designed for high-resolution imaging and analysis of biological and materials samples. The LSM 710 utilizes a laser excitation source and a scanning system to capture detailed images of specimens at the microscopic level. The specific capabilities and technical details of the LSM 710 are not provided in this response to maintain an unbiased and factual approach.
7
Pentr d topo vector by Thermo Fisher Scientific
Sourced in United States, Germany, United Kingdom, Australia, Japan
The PENTR/D-TOPO vector is a plasmid designed for direct cloning of PCR products. It features a pUC origin of replication and a kanamycin resistance gene for selection in E. coli. The vector includes TOPO cloning sites that facilitate the direct insertion of PCR products without the need for restriction enzyme digestion or ligation.
8
Lsm 780 by Zeiss
Sourced in Germany, United States, Japan, France, China, Canada, United Kingdom, Switzerland, Singapore, Italy, Panama, India
The LSM 780 is a laser scanning microscope developed by Zeiss. It is designed for high-resolution imaging and analysis of biological samples. The instrument utilizes advanced confocal technology to provide detailed, three-dimensional images of specimens.
9
Tcs sp5 by Leica camera
Sourced in Germany, United States, Japan, United Kingdom, China, Spain, Switzerland
The Leica TCS SP5 is a confocal laser scanning microscope system. It is designed for high-resolution imaging and analysis of biological samples. The system features a flexible and modular design, allowing for customization to meet the specific requirements of various applications.
10
Lsm 700 by Zeiss
Sourced in Germany, United States, Japan, Canada, United Kingdom, Switzerland, France, Italy, China, Denmark, Australia, Austria, Slovakia, Morocco
The LSM 700 is a versatile laser scanning microscope designed for high-resolution imaging of samples. It provides precise control over the illumination and detection of fluorescent signals, enabling detailed analysis of biological specimens.

More about "Agrobacterium"

Agrobacterium is a genus of Gram-negative, soil-dwelling bacteria renowned for their ability to transfer genetic material into plant cells.
This unique property has made Agrobacterium a widely used tool in plant biotechnology and genetic engineering.
The Agrobacterium genome contains a tumor-inducing (Ti) plasmid that encodes the genes necessary for this genetic transfer process, allowing researchers to leverage this bacterial species to insert desirable genes into plant cells and produce transgenic plants.
The Dual-Luciferase Reporter Assay System is a common technique used in conjunction with Agrobacterium-mediated transformation to quantify gene expression levels in plant cells.
The TCS SP8, LSM 880, LSM 710, LSM 780, and TCS SP5 are confocal microscopy systems that can be used to visualize and analyze the effects of Agrobacterium-mediated gene transfer in plant tissues.
The ClonExpress II One Step Cloning Kit and the PENTR/D-TOPO vector are tools that facilitate the cloning and integration of genes of interest into the Agrobacterium genome, enabling efficient and accurate genetic modifications.
Understanding the optimal Agrobacterium techniques and products is crucial for enhancing reproducibility and accuracy in plant research and engineering.
PubCompare.ai, an AI-driven platform, can help scientists locate the best protocols from literature, pre-prints, and patents, optimizing Agrobacterium research and enabling researchers to identify the most effective techniques and products.
By leveraging these tools and resources, researchers can advance their plant biotechnology studies and achieve greater breakthroughs in agricultural and scientific applications.