> Living Beings > Bacterium > Pasteurella multocida

← Pannus

Pasteurella multocida

Pasteurella multocida is a Gram-negative bacterium that can cause a variety of diseases in both humans and animals.
It is commonly associated with respiratory infections, septicemia, and other conditions in a wide range of host species, including poultry, livestock, and companion animals.
Researching this pathogen is crucial for understanding its epidemiology, pathogenesis, and potential treatments.
PubCompare.ai offers an AI-driven protocol comparison tool to help optimize your Pasteurella multocida research, allowing you to easily identify the most reproducible and accurate experimental procedures from literature, preprints, and patents.
This can streamlaine your work and help you achieve greater accuracy in your studies.

Most cited protocols related to «Pasteurella multocida»

Comparative Genomic Analysis of γ-Proteobacteria

The genomes chosen for this study correspond to 13 γ-Proteobacterial taxa that show different degrees of relatedness based on divergence of SSU rRNA and that include two symbionts having undergone large-scale genomic reduction (Shigenobu et al. 2000 (link); Akman et al. 2002 (link)). The protein sequences of the 13 complete genomes were retrieved from the GenBank database (Benson et al. 2002 (link)). The species used were Escherichia coli K12 (accession number NC_000913; Blattner et al. 1997 (link)), Buchnera aphidicola APS (NC_002528; Shigenobu et al. 2000 (link)), Haemophilus influenzae Rd (NC_000907; Fleischmann et al. 1995 (link)), Pasteurella multocida Pm70 (NC_002663; May et al. 2001 (link)), Salmonella typhimurium LT2 (NC_003197; McClelland et al. 2001 (link)), Yersinia pestis CO_92 (NC_003143; Parkhill et al. 2000 (link)), Yersinia pestis KIM5 P12 (NC_004088; Deng et al. 2002 (link)), Vibrio cholerae (NC_002505 for chromosome 1 and NC_002506 for chromosome 2; Heidelberg et al. 2000 (link)), Xanthomonas axonopodis pv. citri 306 (NC_003919; da Silva et al. 2002 (link)), Xanthomonas campestris (NC_003902; da Silva et al. 2002 (link)), Xylella fastidiosa 9a5c (NC_002488; Simpson et al. 2000 (link)), Pseudomonas aeruginosa PA01 (NC_002516; Stover et al. 2000 (link)), and Wigglesworthia glossinidia brevipalpis (NC_004344; Akman et al. 2002 (link)).
To identify genes likely to have been transmitted vertically through the history of the γ-Proteobacteria, we first eliminated proteins annotated as elements of insertion sequences or as bacteriophage sequences, since they are likely to be subject to lateral transfer. Such sequences were present in most genomes but lacking in a few (B. aphidicola, W. brevipalpis, and P. multocida). Table 1 shows the number of proteins that remain in each genome after such elimination.

Lerat E., Daubin V, & Moran N.A. (2003). From Gene Trees to Organismal Phylogeny in Prokaryotes:The Case of the γ-Proteobacteria. PLoS Biology, 1(1), e19.

Full text: Click here

Publication 2003

Amino Acid Sequence Bacteriophages Buchnera aphidicola Chromosomes, Human, Pair 1 Chromosomes, Human, Pair 2 Escherichia coli K12 Genes Genome Haemophilus influenzae Insertion Sequence Elements Pasteurella multocida Proteins Proteobacteria Pseudomonas aeruginosa Ribosomal RNA Salmonella typhimurium LT2 Vibrio cholerae Wigglesworthia glossinidia Xanthomonas campestris Xanthomonas citri Xylella fastidiosa Yersinia pestis

Bovine Respiratory Disease Case Definition

Clinical signs and diagnostic test results were both used to classify calves as BRD cases or controls. Histophilus somni, Pasteurella multocida, Bibersteinia trehalosi and Mannheimia haemolytica were considered as aerobic pathogens when categorizing cases and controls (Griffin et al., 2010 (link)). Calves that met any of the following three criteria were classified as cases: (1) positive for BRSV, BHV-1, or BVDV on PCR; (2) any aerobic pathogen detected on culture and WI Score ≥5; or (3) any Mycoplasma spp. detected on culture and WI Score ≥5. All other calves were classified as controls. Figure 1 depicts the algorithm for the classification of BRD cases and controls. Bovine coronavirus was not included as a criterion for case definition because current PCR assays could not differentiate between enteric and respiratory BCoV subtypes (Saif, 2010 (link)).

Love W.J., Lehenbauer T.W., Kass P.H., Van Eenennaam A.L, & Aly S.S. (2014). Development of a novel clinical scoring system for on-farm diagnosis of bovine respiratory disease in pre-weaned dairy calves. PeerJ, 2, e238.

Full text: Click here

Publication 2014

Bacteria, Aerobic Bibersteinia trehalosi Biological Assay Coronavirus, Bovine Haemophilus somnus Mannheimia haemolytica Mycoplasma Pasteurella multocida pathogenesis Respiratory Rate Scheuermann's Disease Tests, Diagnostic

Bacterial Species Specificity Testing for PCR Assays

The PCR assays were also conducted on a panel of reference isolates of common respiratory bacterial species to determine their broader specificity. The following species were included: H. influenzae, H. haemolyticus, H. parahaemolyticus, H. parainfluenzae, H. aphrophilus, P. multocida, N. meningitidis, P. aeruginosa, Streptococcus pneumoniae, Moraxella catarrhalis, Streptococcus pyogenes, Klebsiella pneumonia and Staphylococcus aureus. Reference strains were sourced from either Microbiologics (Minnesota, USA) or locally from the culture collection at the Menzies School of Health Research (Northern Territory, Australia) as shown in Table 3.

Binks M.J., Temple B., Kirkham L.A., Wiertsema S.P., Dunne E.M., Richmond P.C., Marsh R.L., Leach A.J, & Smith-Vaughan H.C. (2012). Molecular Surveillance of True Nontypeable Haemophilus influenzae: An Evaluation of PCR Screening Assays. PLoS ONE, 7(3), e34083.

Full text: Click here

Publication 2012

Bacteria Biological Assay Haemophilus influenzae Haemophilus parainfluenzae Klebsiella Moraxella catarrhalis Neisseria meningitidis Pasteurella multocida Pneumonia Pseudomonas aeruginosa Respiratory Rate Staphylococcus aureus Strains Streptococcus pneumoniae Streptococcus pyogenes

Inhibition of Microbial Biofilm by Date Palm Extracts

The potential of ethanolic extracts of Date palm to inhibit microbial biofilm formation was assayed following the method of O’Toole.²⁹ Varying concentrations of Date palm extracts were used to assess the microbial biofilm inhibition. The microtiter plate assay was used to quantify the biofilm inhibition potential by measuring the absorbance of the solubilized crystal violet at 550 nm in microtiter plate reader using 30% acetic acid in water as the blank. All the tests were carried out in triplicates.
The biofilm inhibition potential of Date palm ethanolic extracts was also observed through Phase contrast microscopy. For this, few drops of the overnight culture of Bacillus subtilis and Pasteurella multocida was added on separate glass slides and incubated at 37°C for 14 h. Using phosphate buffer saline, the slides were washed and supplemented with Date palm extracts. Then the slides were rinsed, stained and the biofilms were dissolved using 30% glacial acetic acid. Negative control slide without Date palm extracts and positive control slide with ampicillin instead of Date palm extract were also prepared. All the prepared smears on glass slides were examined microscopically.³⁰

Qasim N., Shahid M., Yousaf F., Riaz M., Anjum F., Faryad M.A, & Shabbir R. (2020). Therapeutic Potential of Selected Varieties of Phoenix Dactylifera L. Against Microbial Biofilm and Free Radical Damage to DNA. Dose-Response, 18(4), 1559325820962609.

Publication 2020

Acetic Acid Ampicillin Bacillus subtilis Biofilms Biological Assay Buffers Cardiac Arrest Ethanol Microscopy, Phase-Contrast Pasteurella multocida Phoenix dactylifera Phosphates Psychological Inhibition Saline Solution Violet, Gentian

Evaluating vtaA leader sequence PCR

The PCRs based on the leader sequence of the vtaA genes were tested with H. parasuis strains previously described [9 (link)], together with H. parasuis clinical isolates from the diagnostic laboratory services of the Faculty of Veterinary Medicine of the University of Montreal (Canada), the Innovative Veterinary Diagnostics (IVD) Laboratory in Seelze-Letter (Germany) and the laboratory Exopol in Zaragoza (Spain). Nasal isolates were obtained from the nasal cavities of healthy piglets, while the rest of strains were obtained from clinical cases of disease, including systemic, pulmonary and clinical isolates of unknown origin. Association between the PCR results and the clinical origin of the strains was assessed using Pearson’s Chi-square test for categorical data.
Specificity of the leader sequence PCR was confirmed with strains of Actinobacillus pleuropneumoniae, Actinobacillus porcinus, Actinobacillus indolicus, Actinobacillus minor, Actinobacillus suis, Pasteurella multocida, Streptococcus suis and Escherichia coli isolated from swine.

Galofré-Milà N., Correa-Fiz F., Lacouture S., Gottschalk M., Strutzberg-Minder K., Bensaid A., Pina-Pedrero S, & Aragon V. (2017). A robust PCR for the differentiation of potential virulent strains of Haemophilus parasuis. BMC Veterinary Research, 13, 124.

Full text: Click here

Publication 2017

Actinobacillus indolicus Actinobacillus minor Actinobacillus pleuropneumoniae Actinobacillus porcinus Actinobacillus suis Clinical Laboratory Services Diagnosis Escherichia coli Faculty Genes Lung Nasal Cavity Nose Pasteurella multocida Reproduction Signal Peptides Streptococcus suis Sus scrofa

Most recents protocols related to «Pasteurella multocida»

Identifying SLAM-Dependent Surface Lipoproteins

Not available on PMC !

Example 8

In selecting genomes for a given bacterial species where a SLAM homolog was identified, preference was given to reference genomes that contained fully sequenced genomes. SLAM homologs were identified using iterative Blast searches into closely related species to Neisseria to more distantly related species. For each of the SLAM homologs identified in these species, the corresponding genomic record (NCBI genome) was used to identify genes upstream and downstream along with their corresponding functional annotations (NCBI protein database, Ensembl bacteria). In a few cases, no genes were predicted upstream or downstream of the SLAM gene as they were too close to the beginning or end of the contig, respectively, and thus these sequences were ignored.

Neighbouring genes were analyzed for 1) an N-terminal lipobox motif (predicted using LipoP, SignalP), and 2) a solute binding protein, Tbp-like (InterPro signature: IPR or IPR011250), or pagP-beta barrel (InterPro signature: IPR011250) fold. If they contained these elements, we identified the adjacent genes as potential SLAM-dependent surface lipoproteins.

A putative SLAM (PM1515, SEQ ID NO: 1087) was identified in Pasteurella multocida using the Neisseria SLAM as a search. The putative SLAM (PM1515, SEQ ID NO: 1087) was adjacent to a newly predicted lipoprotein gene with unknown function (PM1514, SEQ ID NO: 1083) (FIG. 11A). The putative SLAM displayed 32% identity to N. meningitidis SLAM1 while the SLP showed no sequence similarity to known SLAM-dependent neisserial SLPs.

The putative SLAM (PM1515, SEQ ID NO: 1087) and its adjacent lipoprotein (PM1514, SEQ ID NO: 1083) were cloned into pET26b and pET52b, respectively, as previously described and transformed into E. coli C43 and grown overnight on LB agar supplemented with kanamycin (50 ug/ml) and ampicillin (100 ug/ml).

Cells were grown in auto-induction media for 18 hours at 37 C and then harvested, washed twice in PBS containing 1 mM MgCl2, and labeled with α-Flag (1:200, Sigma) for 1 hr at 4 C. The cells were then washed twice with PBS containing 1 mM MgCl2 and then labeled with R-PE conjugated α-mouse IgG (25 ug/mL, Thermo Fisher Scientific) for 1 hr at 4 C. following straining, cells were fixed in 2% formaldehyde for 20 minutes and further washed with PBS containing 1 mM MgCl2. Flow Cytometry was performed with a Becton Dickinson FACSCalibur and the results were analyzed using FLOWJO software. Mean fluorescence intensity (MFI) was calculated using at least three replicates was used to compare surface exposure the lipoprotein in strains either containing or lacking the putative SLAM (PM1515) and are shown in FIG. 11C and FIG. 11D. PM1514 could be detected on the surface of E. coli illustrating i) that SLAM can be used to identify SLPs and ii) that SLAM is required to translocate these SLPs to the surface of the cell—thus identifying a class of proteins call “SLAM-dependent surface lipoproteins”. Antibodies were raised against purified PmSLP (PM1514) and the protein was shown to be on the surface of Pasteurella multocida via PK shaving assays.

US11872275B2. SLAM polynucleotides and polypeptides and uses thereof (2024-01-16). ENGINEERED ANTIGENS INC. [CA]. Inventors: Trevor F. Moraes [CA], Christine Chieh-Lin Lai [CA], Yogesh Hooda [CA], Andrew Judd [CA], Anthony B. Schryvers [CA], Scott D. Gray-Owen [CA].

Full text: Click here

Patent 2024

Agar Ampicillin Antibodies Bacteria Binding Proteins Biological Assay Cells Escherichia coli Flow Cytometry Fluorescence Formaldehyde Genes Genome Kanamycin Lipoprotein (a-) Lipoproteins Magnesium Chloride Mus Neisseria Neisseria meningitidis Pasteurella multocida Proteins Staphylococcal Protein A Strains

Swine Cytokine mRNA Expression Analysis

Cytokine mRNA expression was analysed. Freshly isolated PBMCs were added to 24-well plates (10⁷ cells/well) with or without 1.25 μg/well P. multocida and incubated at 37 °C and 5% CO₂ for 3 h. Total RNA was extracted from the stimulated or control PBMCs using TRIzol reagent (Invitrogen, CA, USA) according to the manufacturer’s instructions. Then, reverse transcription (RT) was carried out using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, CA, USA). Real-time PCR was carried out in the SmartCycler I system (Cepheid, Caribbean Sunnyvale, CA, USA) as described previously [13 (link)]. The primers and reaction program for swine cytokine genes and the housekeeping gene GAPDH (glyceraldehyde-3-phosphate dehydrogenase) are listed in Table 2. The expression of each gene was analysed using the relative quantification method described by Pfaffl [17 (link)]. A slope was determined from the exponential phase, under the optimized real-time PCR amplification condition, of the target gene or the reference gene (GAPDH). The amplification efficiency (E) was calculated based on the slope, where E = 10 [− 1/slope]. The mRNA expression of each target gene was calibrated by that of GAPDH at each time point and converted to the relative expression ratio (fold of induction), where fold of induction = [(E _target) × (control CP _target − treatment CP _target)]/[(E_ref) × (control CP_ref − treatment CP _ref)].Table 2

Sequences of primers for swine cytokines and GAPDH for real-time PCR

Gene	Primer	Sequence (5′ → 3′)	Length (bp)	Accession No.^a	Denaturation	Amplification conditions^bAnnealing temperature
GADPH	F	TGAATTTGGCTACAGCAACAGG	186	XM_039874164.1	95 °C (5 min)	53.2 ℃ (20 s),
GADPH	R	GGTCTGGGATGGAAACTGGA	186	XM_039874164.1		53.2 ℃ (20 s),
IFN-γ	F	ACTTGGTGTTATGGTGACTG	197	X53085		57 ℃ (20 s)
IFN-γ	R	TAGGATGTCTAGTAGTGAG	197	X53085		57 ℃ (20 s)
IL-4	F	TGACGGACGTCTTTGCTGC	178	X68330		50.8 ℃ (20 s)
IL-4	R	TCTGTGCATGAAGCCAAGAA	178	X68330		50.8 ℃ (20 s)

F: forwards, R: reverse.

^aGenBank accession number of cDNA and corresponding gene, available at National Center for Biotechnology Information.

^bDenaturation at 95 ℃ for 45 s and extension at 72 ℃ for 30 s, for a total of 44 cycles.

Wu M.C., Wu H.C., Lee J.W., Chang W.C, & Chu C.Y. (2023). A protein-based subunit vaccine with biological adjuvants provides effective protection against Pasteurella multocida in pigs. Veterinary Research, 54, 17.

Full text: Click here

Publication 2023

Caribbean People Cells Cytokine DNA, Complementary GAPDH protein, human Gene Expression Genes Genes, Housekeeping Glyceraldehyde-3-Phosphate Dehydrogenases Oligonucleotide Primers Pasteurella multocida Pigs Real-Time Polymerase Chain Reaction Reverse Transcription RNA, Messenger trizol

Multiplex PCR Detection of Pasteurella Serotype A

Pasteurella multocida was isolated from infected piglets in Taiwan. Primers for multiplex PCR to detect P. multocida serotype A were designed in our previous study [15 (link)]. P. multocida was cultivated in BHI (Brain Heart Infusion, BD, MD, USA) medium containing 3% chicken serum. Shaking for 6 h culture at 37 °C was used for challenge.

Full text: Click here

Publication 2023

Brain Chickens Heart Multiplex Polymerase Chain Reaction Oligonucleotide Primers Pasteurella multocida Serum

Porcine Pasteurella multocida Vaccine Evaluation

Twelve healthy 4-week-old piglets without P. multocida antibodies were randomly divided into three groups (n = 4 each). The vaccinated groups were immunized intramuscularly with 2 mL of (1) rPMT-NC + CpG, (2) rPMT-NC + w/o/w, or (3) PBS (Table 1). Piglets were boosted with the same vaccine at 2 weeks after the primary immunization. All piglets were challenged intranasally with 1 × 10⁸ CFU/mL P. multocida serotype A 4 weeks after primary immunization [16 (link)]. The antibody titre was detected by blood samples taken at 0, 2 and 4 weeks after primary immunization. The piglets were monitored daily for clinical signs, body temperature (fever was defined as rectal temperature > 39.5 °C), and body weight and were sacrificed for necropsy 14 days after challenge. Pathological examination was performed by the Veterinary Pathology Department of NPUST, and the lesion score was calculated based on the area of lesions in an organ, where no lesion = 0, lesion area < 33% = 1, lesion area 33–66% = 2, and lesion area > 66% = 3 [3 (link)].Table 1

The active ingredients of vaccines in this study

Vaccine^a	Adjuvant
Trial 1. Plasmid CpG adjuvant effect test
1. rPMT-NC^b + CpG	CpG (200 μg/mL)
2. rPMT-NC + w/o/w	w/o/w
3. Control (PBS)	–
Trial 2. rSly adjuvant dose-dependent test
4. rPMT-NC + w/o/w + rSly	rSly (100 μg/mL)
5. rPMT-NC + w/o/w + rSly	rSly (150 μg/mL)
6. Control (PBS)	–
Trial 3. Comparison with various adjuvants
7. rPMT-NC + w/o/w + rSly	rSly (100 μg/mL)
8. rPMT-NC + w/o/w + CpG	CpG (200 μg/mL)
9. rPMT-NC	–
10. Commercial vaccine^c	Al-gel
11. Control (PBS)	–

^aPig immunizaction vaccine with 2 mL by I.M.

^brPMT-NC (200 μg/mL).

^cIngredient: B. bronchiseptica (1 × 10⁹ CFU), P. multocida type A (1 × 10⁹ CFU).

P. multocida type D (1 × 10⁹ CFU), rsPMT/tox1 (20 μg), rsPMT/tox2 (20 μg), rsPMT/tox7 (20 μg), Adjuvant: Al-gel.

Full text: Click here

Publication 2023

Antibodies Autopsy BLOOD Body Weight Fever Immunization Immunizations, Active Immunoglobulins Pasteurella multocida Pharmaceutical Adjuvants Plasmids Rectum Vaccines

Evaluating PMT-NC and Sly Vaccine Efficacy

Twelve healthy piglets without P. multocida antibodies were divided into three groups (n = 4 each). The vaccinated groups were immunized intramuscularly with 2 mL of (4) rPMT-NC + w/o/w + rSly (100 μg/mL), (5) rPMT-NC + w/o/w + rSly (150 μg/mL), or (6) PBS as a negative control (Table 1). The antibody titre was determined for blood samples taken at 0, 2 and 4 weeks after primary immunization. CD4⁺ and CD8⁺ T-cell analysis was performed at week 4.

Full text: Click here

Publication 2023

Antibodies BLOOD CD8-Positive T-Lymphocytes Immunization Immunoglobulins Pasteurella multocida

Top products related to «Pasteurella multocida»

Ampicillin by Merck Group

Sourced in United States, Germany, United Kingdom, France, China, Switzerland, Sao Tome and Principe, Spain, Ireland, India, Italy, Japan, Brazil, Australia, Canada, Macao, Czechia, New Zealand, Belgium, Cameroon, Austria, Israel, Norway, Denmark, Netherlands

Ampicillin is a broad-spectrum antibiotic used in laboratory settings. It is a penicillin-based compound effective against a variety of gram-positive and gram-negative bacteria. Ampicillin functions by inhibiting cell wall synthesis, leading to bacterial cell lysis and death.

Fetal bovine serum (fbs) by Thermo Fisher Scientific

Sourced in United States, China, United Kingdom, Germany, Australia, Japan, Canada, Italy, France, Switzerland, New Zealand, Brazil, Belgium, India, Spain, Israel, Austria, Poland, Ireland, Sweden, Macao, Netherlands, Denmark, Cameroon, Singapore, Portugal, Argentina, Holy See (Vatican City State), Morocco, Uruguay, Mexico, Thailand, Sao Tome and Principe, Hungary, Panama, Hong Kong, Norway, United Arab Emirates, Czechia, Russian Federation, Chile, Moldova, Republic of, Gabon, Palestine, State of, Saudi Arabia, Senegal

Fetal Bovine Serum (FBS) is a cell culture supplement derived from the blood of bovine fetuses. FBS provides a source of proteins, growth factors, and other components that support the growth and maintenance of various cell types in in vitro cell culture applications.

Maldi tof ms by Bruker

Sourced in Germany, United States, France, United Kingdom, Japan, Italy, Switzerland, Canada, Poland

MALDI-TOF MS is a type of mass spectrometry instrument that uses Matrix-Assisted Laser Desorption/Ionization (MALDI) as the ionization technique and Time-of-Flight (TOF) as the mass analyzer. It is designed to analyze and identify a wide range of compounds, including proteins, peptides, lipids, and small molecules.

Qiaamp dna mini kit by Qiagen

Sourced in Germany, United States, France, United Kingdom, Netherlands, Spain, Japan, China, Italy, Canada, Switzerland, Australia, Sweden, India, Belgium, Brazil, Denmark

The QIAamp DNA Mini Kit is a laboratory equipment product designed for the purification of genomic DNA from a variety of sample types. It utilizes a silica-membrane-based technology to efficiently capture and purify DNA, which can then be used for various downstream applications.

Dneasy blood and tissue kit by Qiagen

Sourced in Germany, United States, United Kingdom, Spain, Canada, Netherlands, Japan, China, France, Australia, Denmark, Switzerland, Italy, Sweden, Belgium, Austria, Hungary

The DNeasy Blood and Tissue Kit is a DNA extraction and purification product designed for the isolation of genomic DNA from a variety of sample types, including blood, tissues, and cultured cells. The kit utilizes a silica-based membrane technology to efficiently capture and purify DNA, providing high-quality samples suitable for use in various downstream applications.

Kanamycin by Merck Group

Sourced in United States, Germany, United Kingdom, France, Spain, China, Israel, India, Canada, Macao, Australia, Sao Tome and Principe, Belgium, Sweden, Poland, Japan, Switzerland, Brazil, Italy, Ireland

Kanamycin is a broad-spectrum antibiotic derived from the bacterium Streptomyces kanamyceticus. It is commonly used as a selective agent in molecular biology and microbiology laboratories for the growth and selection of bacteria that have been genetically modified to express a gene of interest.

Hiseq 2000 by Illumina

Sourced in United States, China, Germany, United Kingdom, Hong Kong, Canada, Switzerland, Australia, France, Japan, Italy, Sweden, Denmark, Cameroon, Spain, India, Netherlands, Belgium, Norway, Singapore, Brazil

The HiSeq 2000 is a high-throughput DNA sequencing system designed by Illumina. It utilizes sequencing-by-synthesis technology to generate large volumes of sequence data. The HiSeq 2000 is capable of producing up to 600 gigabases of sequence data per run.

Ripa buffer by Beyotime

Sourced in China, United States, Switzerland, Germany, United Kingdom

RIPA buffer is a detergent-based cell lysis and extraction reagent. It is used to extract and solubilize proteins from cells and tissues for analysis. The buffer contains a combination of ionic and non-ionic detergents, as well as other components that aid in the solubilization and stabilization of proteins.

Tryptic soy broth (tsb) by BD

Sourced in United States, Germany, Canada, France, United Kingdom, China, Poland, Japan, Denmark, Cameroon, Switzerland, Italy

Tryptic soy broth is a general-purpose microbiological culture medium used for the cultivation and growth of a wide range of bacteria. It provides the necessary nutrients, including peptones, glucose, and salts, to support the growth of a variety of bacterial species.

Avance 800 nmr spectrometer by Bruker

The Avance-800 NMR spectrometer is a high-performance nuclear magnetic resonance (NMR) instrument designed for advanced analytical applications. It operates at a magnetic field strength of 18.8 Tesla, providing high-resolution and sensitivity for the study of complex molecular structures and chemical processes.

What are the different types or variants of Pasteurella multocida?

Pasteurella multocida is a diverse species with several recognized subspecies and biotypes. The main variants include: - P. multocida subsp. multocida - The most common and widely studied subspecies, associated with a variety of host species and disease manifestations. - P. multocida subsp. septica - Linked to septicemic infections, particularly in humans and some animal hosts. - P. multocida subsp. gallicida - Primarily associated with fowl cholera in poultry. - P. multocida subsp. tigris - A newly described subspecies isolated from tigers. Differentiating between these variants is important for accurate diagnosis, epidemiology studies, and targeted treatment approaches.

What are some of the common clinical manifestations of Pasteurella multocida infections?

Pasteurella multocida can cause a wide range of clinical conditions, including: - Respiratory infections (e.g. pneumonia, bronchitis, rhinitis) in both humans and animals - Septicemia and bacteremia, especially in immunocompromised individuals - Soft tissue infections (e.g. abscesses, cellulitis) following animal bites or scratches - Otitis media (ear infections) - Meningitis - Osteomyelitis - Endocarditis The specific disease presentation often depends on the host species, immune status, and route of infection. Recognizing the diverse clinical spectrum is crucial for timely diagnosis and appropriate treatment.

How can PubCompare.ai help optimize Pasteurella multocida research?

PubCompare.ai's AI-driven protocol comparison tool can greatly streamline and enhance Pasteurella multocida research in several ways: 1. Efficienct protocol screening: The platform allows you to rapidly sift through a large volume of literature, preprints, and patents to identify the most relevant and effective protocols for studying Pasteurella multocida. 2. Identification of critical insights: PubCompare.ai's AI-analysis can pinpoint key differences in protocol effectiveness, helping you choose the most reproducible and accurate procedures for your specific research goals. 3. Improved experimental design: By leveraging the insights from PubCompare.ai, you can design more robust and reliable experiments related to Pasteurella multocida, leading to greater accuracy in your studies. 4. Time and cost savings: The platform's ability to quickly identify the optimal protocols can save you significant time and resources compared to manual literature reviews and trial-and-error experimentation.

More about "Pasteurella multocida"

Pasteurella multocida is a Gram-negative bacterium that can cause a variety of zoonotic diseases in both humans and animals.
It is commonly associated with respiratory infections, septicemia, and other conditions in a wide range of host species, including poultry, livestock, and companion animals.
This pathogen is a significant concern in the field of veterinary and public health, and researching its epidemiology, pathogenesis, and potential treatments is crucial.
One key aspect of Pasteurella multocida research is the use of various laboratory techniques and tools.
For example, MALDI-TOF MS (Matrix-Assisted Laser Desorption/Ionization Time-of-Flight Mass Spectrometry) is a powerful method for rapid and accurate identification of this bacterium.
Additionally, molecular biology techniques such as PCR (Polymerase Chain Reaction) and DNA sequencing, using kits like the QIAamp DNA Mini Kit or DNeasy Blood and Tissue Kit, can provide valuable insights into the genetic characteristics of Pasteurella multocida.
In terms of culture media, Tryptic Soy Broth (TSB) is a common growth medium used for the cultivation of this pathogen.
Antimicrobial agents like Ampicillin and Kanamycin may also be employed in research studies to selectively isolate and study Pasteurella multocida.
To further understand the biology and metabolism of this bacterium, NMR (Nuclear Magnetic Resonance) spectroscopy, such as the Avance-800 NMR spectrometer, can be utilized to analyze the chemical composition and structure of various biomolecules.
When conducting experiments with Pasteurella multocida, the use of Fetal Bovine Serum (FBS) as a cell culture supplement, and RIPA buffer for protein extraction and purification, are common practices.
PubCompare.ai offers an AI-driven protocol comparison tool that can help optimize your Pasteurella multocida research.
This tool allows you to easily identify the most reproducible and accurate experimental procedures from literature, preprints, and patents, streamlining your work and helping you achieve greater accuracy in your studies.