Log In Sign up
The largest database of trusted experimental protocols
> Living Beings > Bacterium > Spirochetes

Spirochetes

Spirochetes are a diverse group of spiral-shaped bacteria that play significant roles in both human health and the environment.
These unique microorganisms are known for their motility and ability to cause a variety of infectious diseases, including Lyme disease, syphilis, and leptospirosis.
Spirochetes possess a distinctive morphology, featuring long, flexible cells with multiple flagella that enable them to move efficiently through various media.
Understanding the biology and pathogenesis of these fascinating bacteria is crucial for developing effective diagnostic tools, treatment strategies, and prevention measures.
PubCompare.ai's AI-driven protocols can help streamline your Spirochetes research by locating the best protocols from literature, pre-prints, and patents, using advanced comparisons to enhance reproducibility and optimize your research efforts.

Most cited protocols related to «Spirochetes»

1
Phylogenetic Marker Identification in Bacteria and Archaea
Bacterial and archaeal genomes from the IMG database were selected for phylogenetic marker identification. Only genomes that were complete were included. We started our marker identification process at 15 different taxonomic levels: the domain Archaea; the phyla Actinobacteria, Bacteroides, Chlamydiae, Chloroflexi, Cyanobacteria, Firmicutes, Spirochetes, Deinococcus-Thermus and Thermotogae; the classes Alphaproteobacteria, Betaproteobacteria, Gammaproteobacteria, Deltaproteobacteria and Epsilonproteobacteria. Genomes that have undergone major genome reductions, such as those of Mycoplasma [45] (link), [46] (link) and gammaproteobacteria endosymbionts [47] (link), [48] (link), were not included in this study. Only one strain of the same species within Gammaproteobacteria was selected if other strains did not contribute to the phylogenetic diversity (PD) in the phylogenetic tree of bacteria.
A ssu-rRNA phylogenetic tree was built for all the genomes in the selection. Alignments of ssu-rRNAs were extracted from the greengenes database[49] (link). Fasttree was used for ssu-rRNA tree building[50] (link).
Wu D., Jospin G, & Eisen J.A. (2013). Systematic Identification of Gene Families for Use as “Markers” for Phylogenetic and Phylogeny-Driven Ecological Studies of Bacteria and Archaea and Their Major Subgroups. PLoS ONE, 8(10), e77033.
Full text: Click here
Publication 2013
Actinomycetes Alphaproteobacteria Archaea Bacteria Bacteroides Betaproteobacteria Chlamydia Cyanobacteria Deinococcus Deltaproteobacteria Epsilonproteobacteria Firmicutes Gammaproteobacteria Genome Genome, Archaeal Green Non-Sulfur Bacteria Mycoplasma Ribosomal RNA Spirochetes Strains Thermus Trees
2
Construction of Borrelia burgdorferi ospAB Mutant
All recombinant DNA experiments and the use of antibiotic resistance markers in strain 297 were reviewed and approved by the University of Texas Southwestern Medical Center Biological and Chemical Safety Advisory Committee. A 4-kb DNA fragment containing ospAB (genes BBA15 and BBA16) with flanking sequence was obtained by PCR amplification from 297 genomic DNA. PCR was performed by using the Expand High Fidelity PCR System (Roche Diagnostics). The primer design was based on published gene sequences for Bb strain B31 (25 (link)) (primers 1 and 2; Table S1, available at http://www.jem.org/cgi/content/full/jem.20031960/DC1). The PCR fragment was then cloned into the pCR-XL-TOPO cloning vector (Invitrogen). The resulting plasmid was designated as pXT-OspAB. Then, an aadA cassette (which confers streptomycin [Strep] resistance to Bb [26 (link)]) was inserted at the AccI site within the ospA gene, resulting in plasmid pXT-OspAB-Strep (Fig. 1 A). To generate the ospAB mutant, 20 μg of pXT-OspA-Strep plasmid DNA was electroporated into BbAH130. The transformation mixture was then diluted into 100 ml of BSK-H medium. After overnight recovery, Strep was added to the transformation mixture at a final concentration of 50 μg/ml, and the mixtures were aliquotted into multiple 96-well tissue culture plates (200 μl/well). 2–3 wk after plating, the wells that contained positive cultures were identified by color change of the medium; the presence of viable spirochetes subsequently was verified by dark field microscopy. In general, <10% of microtiter plate wells contained positive cultures, suggesting that each well culture was clonal in origin. PCR amplification with various primer pairs (Table S1) was performed on whole cell lysates of these transformants to verify that the streptomycin-resistance (Strepr) transformants contained the appropriate aadA insertion (Fig. 1). Although highly unlikely, the possibility that the suicide plasmid inserted into more than one site would not have influenced our studies because the mutant remained infectious and complementation was successful in restoring OspA/B function (see Results and Discussion). Also, plasmid contents of the OspA/B− mutants were examined by PCR as described previously (19 (link), 27 (link), 28 (link)).
Yang X.F., Pal U., Alani S.M., Fikrig E, & Norgard M.V. (2004). Essential Role for OspA/B in the Life Cycle of the Lyme Disease Spirochete. The Journal of Experimental Medicine, 199(5), 641-648.
Publication 2004
Antibiotic Resistance, Microbial Base Sequence Biopharmaceuticals Cells Clone Cells Cloning Vectors Diagnosis Genes Genome Infection Microscopy Oligonucleotide Primers Plasmids Recombinant DNA Spirochetes Strains Streptomycin Tissues Topotecan
3
Quantitative Multiplex PCR for Borrelia Detection
From blood and skin biopsies from the Connecticut site, DNA was extracted using the Qiagen DNeasy Tissue Kit (Qiagen, Valencia, CA) as described. 27 (link) For ticks collected at the Connecticut site, DNA was extracted from individual nymphal I. scapularis following Beati and Keirans for the 2002 collection. 28 (link) For ticks collected at several locations in 2004–2007 collections, total DNA was extracted using ammonium hydroxide (NH4OH). For this procedure, ticks were incubated for 2 h in 5 μL of 1.4 mol/L NH4OH at 22°C and crushed with a plastic pipette tip. To this was added 95 μL distilled H2O before a second incubation at 95°C for 30 minutes. Material was centrifuged to separate tick debris from DNA solution, and the supernatant was transferred to clean vials containing 1 μL of 100 mmol/L EDTA and stored at −20°C.
In addition to the DNA extracts from blood, tissue, and ticks described above, two other sets of DNA samples, which were extracted from ticks by the method of Beati and Keirans, 28 (link) were available for examination: (1) flat nymphs that were derived from engorged larvae removed from captured mammals at the Connecticut field site, as described by Hanincova and others, 29 (link) and (2) flat larvae and nymphs of laboratory-reared P. leucopus, which were infected with B. miyamotoi, as described. 12 (link)
DNA extracts were subjected to quantitative multiplex real-time PCR (qPCR), as described, 15 (link),16 (link),30 (link) with two probes hybridizing to a region of the 16S rDNA that differed between B. burgdorferi and B. miyamotoi. Results were expressed as the number of spirochete cells per tick or volume of blood or tissue. Forward and reverse primers were, respectively, 5′GCTGTAAACGATGCACACTTGGT and 5′GGCGGCACACTTAACACGTTAG. The corresponding dye-labeled probes were 6FAM-TTCGGTACTA ACTTTTAGTTAA and VIC-CGGTACTAACCTTTCGAT TA with 3′ ends modified with a minor groove binding protein (Applied Biosystems, Foster City, CA). The reaction was performed in 25-μL volume in single tubes or wells at a final concentration of 900 nmol/L for each primer and 200 nmol/L for each probe. 15 (link) The final concentration of EDTA was < 0.1 mmol/L. The PCR conditions were 50°C for 2 minutes and 95°C for 10 minutes, followed by 45 cycles of 95°C for 15 seconds and 63°C for 60 seconds on an Applied Biosystems 7300 Real-Time PCR apparatus for the 2002 and 2004 samples and a Rotor-Gene RG-3000 apparatus (Corbett Research, San Francisco, CA) for the 2005–2007 samples. The DNA extractions, PCR reaction preparations, and analysis of the products were carried out in three separated laboratory rooms. To monitor for contamination, negative controls were included with all DNA extraction and PCR procedures.
DNA standards were the same for each experiment: strain B31 (ATCC 35210) for B. burgdorferi and strain HS1 (ATCC 35209) of B. hermsii for the uncultivable B. miyamotoi.15 (link) B. hermsii and B. miyamotoi have identical sequences for the regions of the primers and probe. Borrelia species cells were grown in BSK II medium at 34°C and harvested as described. 31 (link) With DNA standards, the qPCR assays with each probe set was linear with a R2 ≥ 0.99 over a range of 1–106 spirochetes per reaction. The linear regression coefficients (95% confidence intervals [CIs]) for Ct values on log-transformed cell counts were −3.31 (−3.40 to −3.28) for B. burgdorferi and −3.40 (−3.52 to −3.28) for the B. hermsii surrogate (P > 0.05). Samples with estimated spirochete counts of less than one per tick or biopsy specimen were considered negative.
The identities of the Borrelia species in 100 random samples scored by qPCR as B. burgdorferi were confirmed by PCR of the 16S–23S intergenic spacer region (IGR) with species-specific primers. 8 (link),15 (link),32 (link) Random samples scored as B. miyamotoi or B. burgdorferi by qPCR were confirmed by direct sequencing of the IGR on a CEQ 8000 capillary sequencer (Beckman Coulter, Fullerton, CA).
Barbour A.G., Bunikis J., Travinsky B., Hoen A.G., Diuk-Wasser M.A., Fish D, & Tsao J.I. (2009). Niche Partitioning of Borrelia burgdorferi and Borrelia miyamotoi in the Same Tick Vector and Mammalian Reservoir Species. The American journal of tropical medicine and hygiene, 81(6), 1120-1131.
Publication 2009
Ammonium Hydroxide Binding Proteins Biological Assay Biopsy BLOOD Blood Volume Borrelia Capillaries Cells DNA, Ribosomal Edetic Acid Genes Intergenic Region Larva Mammals Neoplasm Metastasis Nymph Oligonucleotide Primers Real-Time Polymerase Chain Reaction Skin Spirochaeta Spirochetes Staphylococcal Protein A Strains Ticks Tissues
4
Culturing B. burgdorferi for Experiments
For each experiment, infectious or non-infectious strains expressing GFP were freshly inoculated from glycerol stocks into 15 ml BSK-II medium containing 6% rabbit serum and 100 µg/ml gentamycin. B. burgdorferi were grown to 5×107/ml, then diluted to 1–2×106/ml in BSK-II medium containing 6% rabbit serum, 100 µg/ml gentamycin, 1× Borrelia antibiotic mixture (20 µg/ml phosphomycin, 50 µg/ml rifampicin and 2.5 µg/ml amphotericin B, prepared from individual antibiotics obtained from Sigma) and 1% C57 BL/6 mouse blood. Spirochetes were grown in the mouse blood for 48 hours at 35°C to a final density of ∼5×107/ml. B. burgdorferi were pelleted (6,000×g for 15 min at 4°C), washed twice in PBS (Invitrogen Canada, Burlington, ON), and resuspended to 2×109B. burgdorferi/ml in PBS. All experiments were performed at a final density of ∼1×107 spirochetes/ml of blood to facilitate quantitative analysis of interactions.
Moriarty T.J., Norman M.U., Colarusso P., Bankhead T., Kubes P, & Chaconas G. (2008). Real-Time High Resolution 3D Imaging of the Lyme Disease Spirochete Adhering to and Escaping from the Vasculature of a Living Host. PLoS Pathogens, 4(6), e1000090.
Full text: Click here
Publication 2008
Amphotericin B Antibiotics Antibiotics, Antitubercular BLOOD Borrelia Fosfomycin Gentamicin Glycerin Infection Mice, House Mice, Inbred C57BL mutalipocin II Rabbits Rifampin Serum Spirochetes Strains
5
Evaluating Borrelia burgdorferi Infectivity in Mice and Ticks
The Rocky Mountain Laboratories (RML) is accredited by the International Association for Assessment and Accreditation of Laboratory Animal Care. Protocols for all animal experiments were prepared according to the guidelines of the National Institutes of Health and approved by the RML's Animal Care and Use Committee. Two different strains of mice were used in these experiments. Mice from an outbred colony of Swiss-Webster mice maintained at RML represent a genetically heterogeneous rodent population (called RML mice) and C3H/HeN mice (Harlan Sprague-Dawley, Indianapolis, IN) represent a uniform, inbred rodent population. Needle inoculations of mice were performed by 80% intraperitoneal and 20% subcutaneous inoculation with a target dose of 5 × 103 spirochetes per mouse, using three to nine mice per B. burgdorferi strain, and were performed at least twice. The number of spirochetes inoculated into mice was determined using a Petroff-Hausser counting chamber and verified by colony-forming unit (cfu) counts in solid BSK medium; 10–20 colonies per inoculum were screened by PCR for the presence of the virulence plasmids lp25 and lp28-1. Actual doses were calculated by adjusting the target doses for the observed spirochete densities determined from the colony counts and percentages of spirochetes carrying lp25 and lp28-1. Total plasmid contents of all in vivo inoculum cultures were verified using a panel of primers that amplify specific DNA targets on all B. burgdorferi plasmids (Elias et al., 2002 (link)). Mouse infection was assessed 3–7 weeks post inoculation by immunoblot analysis of mouse sera and reisolation of spirochetes from ear, bladder and joint tissues, as previously described (Simpson et al., 1991 (link); Elias et al., 2002 (link); Grimm et al., 2003 (link); 2004 (link)). Fischer's exact test was used to generate a P-value for the test of no difference between the numbers of mice infected with different B. burgdorferi clones. The analysis was implemented using R software, version 2.2.1 (R Development Core Team, 2005 ).
Cohorts of 100–200 4-month-old I. scapularis tick larvae (from a colony maintained at RML, Hamilton, MT) were experimentally infected with equal density, exponential phase cultures of various B. burgdorferi clones as previously described (Policastro and Schwan, 2003 (link); Grimm et al., 2005 (link)). Each immersion was performed in duplicate and the entire experiment performed at least twice. Infection of larvae and nymphs (following the molt) were assessed 7–14 days post feeding to repletion (100–200 larvae or 15–25 nymphs were applied per mouse) by IFA (Schwan and Piesman, 2000 ) and spirochete density per tick quantified by plating of dilutions of triturated whole ticks in solid BSK medium, as previously described (Grimm et al., 2005 (link)). Infection of RML mice fed on by infected ticks was assessed 3–9 weeks post tick feeding by seroconversion to B. burgdorferi antigens (Simpson et al., 1991 (link); Elias et al., 2002 (link); Grimm et al., 2003 (link); 2004 (link)), reisolation of spirochetes from mouse tissues (Elias et al., 2002 (link); Grimm et al., 2004 (link)) and xenodiagnosis using uninfected I. scapularis (RML) (Schwan and Piesman, 2000 ). Fischer's exact test was used to generate a P-value for the test of no difference between the numbers of mice infected with different B. burgdorferi clones. The analysis was implemented using R software, version 2.2.1 (R Development Core Team, 2005 ).
Jewett M.W., Lawrence K., Bestor A.C., Tilly K., Grimm D., Shaw P., VanRaden M., Gherardini F, & Rosa P.A. (2007). The critical role of the linear plasmid lp36 in the infectious cycle of Borrelia burgdorferi. Molecular Microbiology, 64(5), 1358-1374.
Full text: Click here
Publication 2007
Animals Animals, Laboratory Antigens Clone Cells Genetic Heterogeneity Immersion Immunoblotting Infection Joints Laboratory Infection Larva Mice, House Mice, Inbred C3H Mice, Laboratory Molting Needles Nymph Oligonucleotide Primers Plasmids Rodent Serum Spirochaeta Spirochetes Strains Technique, Dilution Ticks Tissues Urinary Bladder Vaccination Virulence Xenodiagnosis

Most recents protocols related to «Spirochetes»

1
Murine Model of Borrelia burgdorferi Infection
Six-week-old male C57BL/6 J mice were obtained from Jackson Laboratories and housed at the Tufts University Animal Facility for at least 1 week prior to infection. B. burgdorferi were grown for 3 days at 32 °C and counted by darkfield microscopy. Spirochetes were resuspended in BSK-II at a density of 1×107 ml−1 and 200 µl of this suspension (~2×106 total spirochetes) was injected subcutaneously in the posterior dorsal region of the mouse. After 2 weeks, ears, bladders, and ankles were harvested and transferred to 1 ml BSK-II containing 50 µg ml−1 rifampicin, 100 µg ml−1 phosphomycin, and 5 µg ml−1 amphotericin B. Cultures were monitored weekly for 2 weeks for spirochete growth by darkfield microscopy.
Phelan J.P., Bourgeois J.S., McCarthy J.E, & Hu L.T. (2023). A putative xanthine dehydrogenase is critical for Borrelia burgdorferi survival in ticks and mice. Microbiology, 169(1), 001286.
Publication 2023
Amphotericin B Animals Ankle Ear Fosfomycin Infection Males Mice, House Mice, Inbred C57BL Microscopy Rifampin Spirochaeta Spirochetes Urinary Bladder
2
Sensitivity of B. burgdorferi to H2O2
The sensitivity of individual B. burgdorferi strains including the WT 5A18NP1, Tn:0556 mutant, the entire operon deletion as well as its complement to H2O2 was determined using an outgrowth assay similar to one previously described [23 (link)]. Cells were grown for 3 days in BSK-II. The cell density of the cultures was determined using dark-field microscopy, and the cultures were diluted to a concentration of 2×107 ml−1 and grown overnight. Spirochetes were again counted under darkfield microscopy and 8.75×107 cells were exposed to 125 µM or 185 µM H2O2 for 4 h at 32 °C. The concentration of H2O2 for each experiment was chosen to result in approximately 50 % survival of the parental strain, which varied between bottles of H2O2. At the end of the stress exposure, the cells were diluted fivefold in BSK-II. Cell density was quantified after 3 days, when the cell density of the untreated control reached ~1×108 ml−1. A percent outgrowth was determined for each strain by enumerating cell numbers using dark-field microscopy and then comparing the treated samples to the untreated controls. For experiments using allopurinol or uric acid, strains were exposed to the treatment (1 mM allopurinol, 300 nM uric acid) or DMSO control for 2 h and washed twice prior to counting and exposure to H2O2.
Phelan J.P., Bourgeois J.S., McCarthy J.E, & Hu L.T. (2023). A putative xanthine dehydrogenase is critical for Borrelia burgdorferi survival in ticks and mice. Microbiology, 169(1), 001286.
Publication 2023
Allopurinol Biological Assay Cell Culture Techniques Deletion Mutation Hypersensitivity Microscopy Operon Parent Peroxide, Hydrogen Spirochetes Strains Sulfoxide, Dimethyl Uric Acid
3
Titration and Inoculation of Borrelia burgdorferi
B. burgdorferi strain B31-A3 organisms were kindly provided by Dr. Jenifer Coburn (Medical College of Wisconsin). Low-passage (<10) spirochetes were grown in modified Barbour-Stoenner-Kelly (BSK)-H complete medium (Sigma-Aldrich, Inc., St. Louis, MO, USA) at 32 °C until they reached a concentration of 106 microbes/mL before being stored at −80 °C in 1.5 mL screw-top tubes. Aliquots were incubated in BSK medium for approximately 5 days, washed of the media, and, as described previously [11 (link)], resuspended in phosphate-buffered saline (PBS) supplemented with heat-inactivated normal mouse serum (NMS) at a concentration of 0.2%. Groups of wild-type and DEREG BALB/c mice were anesthetized with isoflurane and then injected subcutaneously between the scapulae with B. burgdorferi at doses ranging from 1 × 102 to 1 × 105 organisms in a volume of 50 µL of PBS supplemented with NMS. Uninfected mice were injected with PBS supplemented with NMS alone. The motility of B. burgdorferi was confirmed using dark-field microscopy. Organisms were enumerated using a Petroff-Hausser counting chamber.
In a preliminary study, we infected wild-type mice with 1 × 103, 1 × 104, or 1 × 105 B. burgdorferi organisms in PBS supplemented with NMS, or with PBS supplemented with NMS alone, to determine the dose of infection to be used in our Treg cell depletion studies. We measured tibiotarsal joint swelling (described below) over the course of 5 weeks as an indication of pathology. Based on this, we used a range of doses of infection (1 × 102–5 × 103 organisms) that would lead to edematous changes of the joint such that any anticipated increases in swelling due to Treg cell depletion would still be apparent.
Santiago K.N., Kozlik T., Liedhegner E.S., Slick R.A., Lawlor M.W, & Nardelli D.T. (2023). Effects of Regulatory T Cell Depletion in BALB/c Mice Infected with Low Doses of Borrelia burgdorferi. Pathogens, 12(2), 189.
Full text: Click here
Publication 2023
Infection Isoflurane Joints Mice, Inbred BALB C Microscopy Motility, Cell Mus Phosphates Regulatory T-Lymphocytes Saline Solution Scapula Serum Spirochetes Strains
4
Isolating Tickborne Spirochetes in Guinea Pigs
Attempts to isolate viable spirochetes were performed using field-collected ticks, which were separated in groups according to locations and species. Seven guinea pigs were infested, each one with ticks of one species from a single location. For this purpose, unengorged ticks were released inside a plastic feeding chamber (6 cm diameter) previously glued with a skin compatible-adhesive (Kamar Products, Zionsville, IN, USA) on the shaved dorsum of the guinea pig. Two hours after being released in the feeding chambers, engorged ticks were recovered and placed in the incubator for further studies. A drop of blood (≈2.5µL) was daily obtained from each of the seven guinea pigs by ear vein-puncture, expressed onto glass slides, and observed by dark-field microscopy to detect the presence of motile spirochetes. The mean number of spirochetes per field was calculated by counting the total number of motile spirochetes in 50 microscope fields at 200x magnification, dividing it by 50; results as decimal numbers were always rounded up. Experimental animals not presenting motile spirochetes during the first 21 days were considered negative and were not bled anymore. If a guinea pig showed motile spirochetes during the first 21 days, daily examinations were extended until 52 days after tick infestations.
Spirochetemic guinea pigs were anesthetized (xylazine 5 mg/kg + ketamine 35 mg/kg) and 2 mL of blood was collected by intracardiac puncture at the 18th day after tick infestation. Part of the blood was submitted to DNA extraction (see below) and the other part was intraperitoneally inoculated into five new experimental animals (three newborn guinea pigs, one mouse and one hamster, each one receiving ≈0.300 mL of blood) to perform the first passage of spirochetes into experimental animals in the laboratory. These inoculated animals were also evaluated daily through dark-field microscopy of blood samples, as described above. Two (newborn guinea pigs) of the five new rodents, when showing >10 spirochetes/field, were anesthetized (xylazine + ketamine) and euthanized by exsanguination via the intracardiac route. In this case, the collected blood was immediately put in heparin tubes, centrifuged, and the plasma was aliquoted into 2 mL-cryotubes, which were stored at −80 °C, and then at liquid nitrogen for cryopreservation of the isolated spirochetes. Rectal temperature of all animals was measured daily throughout the study with a digital clinical thermometer.
de Oliveira G.M., Muñoz-Leal S., Santodomingo A., Weck B.C., Faccini-Martínez Á.A., Horta M.C, & Labruna M.B. (2023). A Novel Relapsing Fever Group Borrelia Isolated from Ornithodoros Ticks of the Brazilian Caatinga. Microorganisms, 11(2), 370.
Full text: Click here
Publication 2023
Animals Animals, Laboratory BLOOD Cavia Cryopreservation Exsanguination Hamsters Heparin Infant, Newborn Ketamine Mice, House Microscopy Nitrogen Physical Examination Plasma Punctures Rectum Rodent Skin Spirochetes Thermometers Tick Infestations Ticks Venipuncture Xylazine
5
Molecular Detection of Borrelia in Guinea Pig Blood
DNA extraction of guinea pig blood samples was performed using the DNeasy Blood and Tissue Kit (Qiagen, Valencia, CA, USA), and tested by conventional PCR protocols for amplification of fragments of the borrelial genes 16S ribosomal RNA (rrs), flagellin (flaB), glycerophosphodiester phosphodiesterase (glpQ), and DNA gyrase subunit B (gyrB) (Table 1). In addition, we performed a multilocus sequencing typing (MLST) scheme according to Margos et al. [26 (link)] for amplification of the borrelial genes clpA, clpX, pepX, pyrG, recG, rplB, nifS and uvrA (Table S1—Supplementary Materials). DNA of Borrelia anserina strain PB [27 (link)] was used as positive control in all reactions. Obtained amplicons were visualized with UV light through 1.5% agarose gels stained with SYBR Safe (Thermo Fisher Scientifific, Waltham, MA, USA). Products containing a single expected size fragment were treated with ExoSAP-IT (USB Corporation, Cleveland, OH, USA) and prepared for sequencing with the BigDye kit (Applied Biosystems, Foster City, CA, USA). An ABI PRISM 3500 Genetic Analyzer (Applied Biosystems, Foster City, CA, USA) was employed for sequencing using the same primers to perform PCRs. Obtained sequences were assembled, trimmed, and translated to amino acid (if applicable) with Geneious R9 [24 (link)]. Generated DNA sequences were submitted to BLAST analysis (www.ncbi.nlm.nih.gov/blast, accessed on 1 November 2022) to infer closest identities with other spirochetes [25 (link)].
de Oliveira G.M., Muñoz-Leal S., Santodomingo A., Weck B.C., Faccini-Martínez Á.A., Horta M.C, & Labruna M.B. (2023). A Novel Relapsing Fever Group Borrelia Isolated from Ornithodoros Ticks of the Brazilian Caatinga. Microorganisms, 11(2), 370.
Full text: Click here
Publication 2023
Amino Acids BLOOD Borrelia Borrelia anserina Cavia porcellus DNA Gyrase DNA Sequence Flagellin Gels Gene Amplification glycerophosphodiester phosphodiesterase Oligonucleotide Primers Polymerase Chain Reaction Protein Subunits Reproduction RNA, Ribosomal, 16S Sepharose Spirochetes Strains Tissues Ultraviolet Rays

Top products related to «Spirochetes»

1
Rabbit serum by Merck Group
Sourced in United States, Germany, India
Rabbit serum is a biological fluid obtained from the blood of rabbits. It contains a variety of proteins, enzymes, and other components naturally found in the rabbit's blood. Rabbit serum is commonly used in various laboratory applications, such as cell culture studies and immunological assays.
2
Bsk h medium by Merck Group
Sourced in France, United States, Spain
BSK-H medium is a growth medium used for the cultivation of Borrelia burgdorferi, the bacteria that causes Lyme disease. It provides the necessary nutrients and growth factors to support the growth of this fastidious microorganism. The composition of the medium is designed to mimic the natural environment of the bacteria.
3
Petroff hausser counting chamber by Hausser Scientific
Sourced in United States, Panama, Germany
The Petroff-Hausser counting chamber is a laboratory device used for the microscopic counting and analysis of small particles, such as cells or microorganisms, in a liquid sample. It consists of a thick glass slide with a precisely etched grid pattern and a coverglass, creating a defined volume for the sample. This device allows for accurate quantification of the number of particles present in the sample.
4
Dneasy blood and tissue kit by Qiagen
Sourced in Germany, United States, United Kingdom, Spain, Canada, Netherlands, Japan, China, France, Australia, Denmark, Switzerland, Italy, Sweden, Belgium, Austria, Hungary
The DNeasy Blood and Tissue Kit is a DNA extraction and purification product designed for the isolation of genomic DNA from a variety of sample types, including blood, tissues, and cultured cells. The kit utilizes a silica-based membrane technology to efficiently capture and purify DNA, providing high-quality samples suitable for use in various downstream applications.
5
Phosphomycin by Merck Group
Sourced in United States
Phosphomycin is a broad-spectrum antibiotic compound. It functions by inhibiting the early stage of bacterial cell wall synthesis.
6
Bsk h by Merck Group
Sourced in United States
The BSK-H is a type of laboratory equipment used for the cultivation and isolation of Borrelia burgdorferi, the bacterium that causes Lyme disease. It provides a specialized growth medium to support the growth and propagation of this microorganism.
7
Bsk h media by Merck Group
Sourced in United States
BSK-H media is a specialized growth medium used for the cultivation of Borrelia burgdorferi, the causative agent of Lyme disease. It provides the necessary nutrients and growth factors required for the optimal growth and maintenance of this slow-growing spirochete. The precise formulation of BSK-H media supports the in vitro culture of Borrelia burgdorferi.
8
Bsk 2 medium by Merck Group
Sourced in United States, France
BSK-II medium is a laboratory culture medium used for the growth and maintenance of Borrelia burgdorferi, the bacterium that causes Lyme disease. It is a complex medium designed to provide the necessary nutrients and growth factors required by this fastidious organism. The composition of BSK-II medium includes various amino acids, vitamins, and other essential components to support the in vitro cultivation of Borrelia species.
9
C3h hej mice by Jackson ImmunoResearch
Sourced in Montenegro, United States
C3H/HeJ mice are an inbred mouse strain that are deficient in Toll-like receptor 4 (TLR4), a key component of the innate immune system. This genetic deficiency makes these mice useful for research applications where the role of TLR4 signaling is of interest.
10
Amphotericin b by Merck Group
Sourced in United States, Germany, United Kingdom, Spain, Italy, Brazil, France, Japan, Poland, Austria, Australia, Switzerland, Macao, Canada, Belgium, Ireland, China, Sao Tome and Principe, Hungary, India, Sweden, Israel, Senegal, Argentina, Portugal
Amphotericin B is a laboratory reagent used as an antifungal agent. It is a macrolide antibiotic produced by the bacterium Streptomyces nodosus. Amphotericin B is commonly used in research and biomedical applications to inhibit the growth of fungi.

More about "Spirochetes"

Spirochetes, a diverse group of spiral-shaped bacteria, play a crucial role in both human health and the environment.
These unique microorganisms, known for their remarkable motility and ability to cause a variety of infectious diseases, including Lyme disease, syphilis, and leptospirosis, possess a distinctive morphology featuring long, flexible cells with multiple flagella.
Understanding the biology and pathogenesis of these fascinating bacteria is vital for developing effective diagnostic tools, treatment strategies, and prevention measures.
Researchers can utilize AI-driven protocols from PubCompare.ai to streamline their Spirochetes research, locating the best protocols from literature, pre-prints, and patents, and using advanced comparisons to enhance reproducibility and optimize their efforts.
Rabbit serum, BSK-H medium, and the Petroff-Hausser counting chamber are among the key tools used in Spirochetes research.
The DNeasy Blood and Tissue Kit is commonly employed for DNA extraction, while Phosphomycin and Amphotericin B are antibiotics that may be utilized in Spirochetes cultivation and research.
The BSK-H and BSK-II media are widely used for growing Borrelia, a genus of Spirochetes that includes the causative agent of Lyme disease.
Furthermore, the C3H/HeJ mice are a commonly used animal model in Spirochetes research, particularly for studying Lyme disease.
By leveraging the insights and tools available, researchers can delve deeper into the fascinating world of Spirochetes, advancing our understanding of these unique microorganisms and their impact on human health and the environment.
Typos: reserach