Log In Sign up
The largest database of trusted experimental protocols
> Living Beings > Bacterium > Yersinia pestis

Yersinia pestis

Yersinia pestis, the causative agent of plague, is a Gram-negative bacterium that poses a significant threat to public health worldwide.
This zoonotic pathogen is primarily transmitted through the bite of infected fleas, leading to various clinical manifestations such as bubonic, septicemic, and pneumonic plague.
Comprehensive understaning of Y. pestis biology, virulence factors, and host-pathogen interactions is crucial for developing effective prevention and treatment strategies.
PubCompare.ai, an AI-driven platform, can help researchers optimize their Y. pestis studies by identifying the most reproducible and effective methods from the literature, preprints, and patents.
Its advanced comparison tools save time and effort, empowering scientists to make data-driven decisions and accelerate their Yersinia pestis research.

Most cited protocols related to «Yersinia pestis»

1
Filtering Metagenomic Reads for Phylogenetic Analysis
Cited 103 times
Metagenomic reads from ancient samples may contain a mixture of sequence reads from the species of interest as well as from genetically similar taxa that represent environmental contamination. To deal with this issue and remove such nonspecific reads after extraction with the EToKi prepare module, the EToKi assemble module can be used to align the extracted reads after comparisons with an ingroup of genomes related to the species of interest and with an outgroup of genomes from other species. In the case of Figure 5, the ingroup consisted of Y. pestis genomes CO92 (2001), Pestoides F, KIM10+ and 91001, and the outgroup consisted of Y. pseudotuberculosis genomes IP32953 and IP31758, Y. similis 228, and Y. enterocolitica 8081. Reads were excluded which had higher alignment scores to the outgroup genomes than to the ingroup genomes. Prior to mapping reads to the Y. pestis reference genome (CO92) (2001), a pseudogenome was created in which all nucleotides were masked to ensure that only nucleotides supported by metagenomic reads would be used for phylogenetic analysis. For the 13 ancient genomes whose publications included complete SNP lists, we unmasked the sites in the pseudogenomes that were included in the published SNP lists. For the other 43 genomes, EToKi was used as in Supplemental Figure S6 to map the filtered metagenomic reads onto the pseudogenome with minimap2 (Li 2018 (link)), evaluate them with Pilon (Walker et al. 2014 (link)), and unmask sites in the pseudogenome that were covered by three or more reads and had a consensus base that was supported by ≥80% of the mapped reads. All 56 pseudogenomes were uploaded to EnteroBase together with their associated metadata.
Zhou Z., Alikhan N.F., Mohamed K., Fan Y, & Achtman M. (2020). The EnteroBase user's guide, with case studies on Salmonella transmissions, Yersinia pestis phylogeny, and Escherichia core genomic diversity. Genome Research, 30(1), 138-152.
Full text: Click here
Publication 2020
Environmental Pollution Genome Metagenome Nucleotides Walkers Yersinia pestis Yersinia pseudotuberculosis Infections
2
Simulated Pathogen DNA in Metagenomes
Cited 17 times
Depending on the database structure and sequence similarity between reference sequences, the naïve LCA [36 (link)] algorithm will assign reads to different taxonomic units. To inquire how reads are assigned to the taxonomic tree for 33 bacterial pathogens (Additional file 1: Table S2), we simulated ancient pathogen DNA reads using gargammel [50 ] and spiked them into five ancient metagenomic background datasets obtained from bone, dentine, dental calculus, and soil (Table 1). The simulated reads carry a unique identifier in their header in order to differentiate them from metagenomic background sequences, which exhibit either full damage patterns or attenuated damage patterns following UDG-half treatment [51 (link)]. To simulate aDNA damage in the pathogen sequences, we applied damage profiles obtained from previously published ancient Yersinia pestis genomes with [13 (link)] and without UDG-half [18 (link)] treatment. Simulated reads were processed with the NGS data processing pipeline EAGER [52 (link)] and spiked into the metagenomic backgrounds in different amounts (50, 500, or 5000 reads). For each metagenomic background, a typical screening sequencing depth of five million reads was used.
Hübler R., Key F.M., Warinner C., Bos K.I., Krause J, & Herbig A. (2019). HOPS: automated detection and authentication of pathogen DNA in archaeological remains. Genome Biology, 20, 280.
Full text: Click here
Publication 2019
Bacteria Bones Dentin DNA, Ancient Genome Metagenome Pathogenicity Trees Yersinia pestis
3
Robust Bacterial Genome Reference Database
Cited 15 times
Central to our approach is a robust database against which to map the query sequencing reads. For the purposes of this demonstration, we gathered a database of 170 complete bacterial chromosomes obtained from 131 distinct strains (610 Mbp) (see the Supplemental Material for accession numbers for the genomes included in this reference database). The database was intended to aid in the identification of eight bacterial agents of bioterrorism identified by the CDC: Bacillus anthracis, Burkholderia mallei, Burkholderia pseudomallei, Brucella sp., Clostridium botulinum, Escherichia coli O157:H7, Francisella tularensis, and Yersinia pestis.
In order to differentiate closely related strains and species (often nonpathogenic) from target strains of interest, we wanted to include in our reference database genomes from any closely related strains/species. Therefore, closely related species/strains were identified by phylogenetic analysis of the 16S ribosomal RNA genes. 16S sequences for all eight pathogens of interest were obtained from GenBank and used to query the nr database utilizing BLASTN (Altschul et al. 1997 (link)) using default parameters (Word Size: 28, Expect Value: 10, Match/Mismatch Scores: 1, −2, Gap Costs: Linear). We identified 3206 sequences corresponding to 1050 named species or subspecies with multiple sequences represented within a number of these taxonomic groups using a partial or full match with BLASTN. We then estimated phylogenetic relationships amongst these sequences and our target species. From this phylogeny, we selected 131 completed genome sequences, 332 fully sequenced plasmids, and 207 whole-genome shotgun sequencing projects to serve as our reference database (see the Supplemental Material for details). Although this study uses the entire genome database, any subset of these sequence types could be used for reference material. The genetic distances for Figure 1 were calculated by performing an all-against-all BLAST as implemented previously (Agren et al. 2012 (link)). Strains of the same species that were >98% similar using this metric were considered “closely related” strains for Figure 1.
Francis O.E., Bendall M., Manimaran S., Hong C., Clement N.L., Castro-Nallar E., Snell Q., Schaalje G.B., Clement M.J., Crandall K.A, & Johnson W.E. (2013). Pathoscope: Species identification and strain attribution with unassembled sequencing data. Genome Research, 23(10), 1721-1729.
Publication 2013
Bacillus anthracis Bacteria Biological Warfare Agents Brucella Burkholderia mallei Burkholderia pseudomallei Chromosomes, Bacterial Clostridium botulinum Escherichia coli O157 Francisella tularensis Genome Pathogenicity Plasmids Reproduction Ribosomal RNA Genes Strains Yersinia pestis
4
Comprehensive Characterization of CdiA-CT/CdiI Interactions
Cited 15 times
The complete methods are presented in the Supplementary Information. Strains, plasmids, and oligonucleotides used in this study are shown in Supplementary Table 2. E. coli competition assays were carried out as previously described 2 (link). D. dadantii competition assays on chicory were carried out as described in Supplementary Methods. EC93 and D. dadantii 3937 cdiA-CT-cdiI deletions and CdiA chimeras were constructed using allelic exchange as previously described 13 (link). For chimera construction, the 3′ end of cdiA and all of cdiI from UPEC 536 ΔkpsK15 ΔaraCBA specRExBAD-cdiBAI (DL5646) were replaced with cdiA-CT (sequence immediately following VENNX) and cdiI from E. coli EC93, Y. pestis CO92 (accession number Q7CGD9), or D. dadantii 3937 region 2 (see Supplementary Methods). The ΔkpsK15 capsule mutation was used to increase the efficacy of CDI, based on our previous results showing that capsule production blocks CDI 3 (link). Immunity plasmids were constructed by ligating PCR-amplified cdiI genes into plasmid pBR322 under tet promoter control (Fig. 1a, c). For D.dadantii 3937 the immunity plasmids were constructed by ligating PCR-amplified cdiI genes into the miniTn7 delivery plasmid pUC18R6KT-miniTn7T under tet promoter control (see Supplementary methods). Deletion mapping of E. coli EC93 cdiA-CT (Fig. 2b) was carried out by cloning specific sequences amplified by PCR into plasmid pLAC1114 (link) under lac promoter control. All plasmids were propagated in EPI100 acrB mutant strain DL5154 to mitigate toxic effects. In vivo interactions between CdiA-CT and CdiI were determined using a modified BACTH bacterial two-hybrid system (Euromedex) 8 (link). β-galactosidase14 (link) and fluorescence3 (link) analyses were carried out as previously described. In vitro affinity pull-downs with His6-tagged CdiI/CdiA-CT were carried out using Ni2+-NTA resin (Qiagen) (Fig. 3a). CdiA-CT was released by denaturation in buffer containing 6 M guanidine-HCl, and His6-tagged CdiI was released in native buffer supplemented with 250 mM imidazole. CdiA-CT activities were analyzed as described in supplementary methods.
Aoki S.K., Diner E.J., de Roodenbeke C.T., Burgess B.R., Poole S.J., Braaten B.A., Jones A.M., Webb J.S., Hayes C.S., Cotter P.A, & Low D.A. (2010). A widespread family of polymorphic contact-dependent toxin delivery systems in bacteria. Nature, 468(7322), 439-442.
Publication 2010
Alleles Bacteria Biological Assay Buffers Capsule Chimera Cichorium intybus Deletion Mutation Escherichia coli Gene Deletion Genes Guanidine Hybrids imidazole Mutation Obstetric Delivery Oligonucleotides Plasmids Resins, Plant Response, Immune Strains Yersinia pestis
5
Ancient DNA Sequencing of Yersinia pestis
Cited 13 times
DNA from dental pulp was extracted and converted into sequencing libraries as previously described3 (link). Potential sequencing artefacts resulting from deaminated nucleotides were eliminated by treatment of the DNA extracts with uracil-DNA-glycosylase and endonuclease VIII. DNA extracts were subsequently converted into sequencing libraries and amplified to incorporate unique sequence tags on both ends of the molecule. Two Agilent DNA capture arrays were designed for capture of the full Y. pestis chromosome (4.6 megabases), and the pCD1 (70 kb) and pMT1 (100 kb) plasmids using the modern Y. pestis strain CO92 (accession numbers NC_003143, NC_003131, NC_003134) for bait design with 3 bp tiling density. Serial array capture was performed over two copies of each array using the enriched fraction from the first round of capture as a template for a second round. The resulting products were amplified and pooled in equimolar amounts. All templates were sequenced for 76 cycles from both ends on the Illumina GAII platform, and reads merged into single fragments were included in subsequent analyses only if forward and reverse sequences overlapped by a minimum of 11 bp. Reads were mapped against the CO92 genome using the software BWA, and molecules with the same start and end coordinates were removed with the rmdup program in the samtools suite. Reference-guided sequence assembly was performed using Velvet version 1.1.03, with mapped and unmapped reads supplied in separate channels. Single-nucleotide differences were determined at a minimum of fivefold coverage and base frequency of at least 95% for both a pooled data set for all individuals and one in which all individuals were treated separately. A median network was constructed on these base calls using SplitsTree4. Phylogenetic trees were constructed using parsimony, neighbour-joining (MEGA 4.1) and Bayesian methods, and coalescence dates were determined in BEAST using both a strict and a relaxed molecular clock (Supplementary Fig. 9).
Bos K.I., Schuenemann V.J., Golding G.B., Burbano H.A., Waglechner N., Coombes B.K., McPhee J.B., DeWitte S.N., Meyer M., Schmedes S., Wood J., Earn D.J., Herring D.A., Bauer P., Poinar H.N, & Krause J. (2011). A draft genome of Yersinia pestis from victims of the Black Death. Nature, 478(7370), 506-510.
Publication 2011
Dental Pulp DNA Chips NEIL1 protein, human Nucleotides Plasmids Strains Uracil-DNA Glycosylase Y Chromosome Yersinia pestis

Most recents protocols related to «Yersinia pestis»

1
Evaluating mRNA-LNP Vaccines against Pneumonic Plague
The fully virulent Y. pestis strain Kim53 was grown on brain-heart infused (BHI) agar plates at 28°C. Several isolated and typical colonies were suspended in saline to generate a bacterial suspension at an OD660 of 0.1 [equals to 1 × 108 colony-forming units (CFU)/ml]. This bacterial suspension was serially diluted, and a dose of 100 CFU (100 LD50) was injected subcutaneously into the lower right backs of the mice. The infectious dose was verified by plating diluted bacterial suspensions onto BHI agar plates. Immunization groups were as follows: for three-dose vaccination study: SP-cp-caf1 mRNA-LNPs (GC) (n = 8), ΔSP-cp-caf1 mRNA-LNPs (n = 8), SP-cp-caf1-hFc mRNA-LNPs (n = 8), rF1 + alum (n = 6), luciferase mRNA-LNPs (n = 4), and alum only (n = 4); for single-dose vaccination study: ΔSP-cp-caf1 mRNA-LNPs (n = 8), SP-cp-caf1-hFc mRNA-LNPs (n = 8), and luciferase mRNA-LNPs (n = 4). Survival of infected mice was daily monitored for 21 days. Sterility of surviving mice was verified by plating spleen homogenates onto BHI agar plates supplemented with streptomycin (50 μg/ml) and by incubation at 28°C for 48 hours.
Kon E., Levy Y., Elia U., Cohen H., Hazan-Halevy I., Aftalion M., Ezra A., Bar-Haim E., Naidu G.S., Diesendruck Y., Rotem S., Ad-El N., Goldsmith M., Mamroud E., Peer D, & Cohen O. (2023). A single-dose F1-based mRNA-LNP vaccine provides protection against the lethal plague bacterium. Science Advances, 9(10), eadg1036.
Full text: Click here
Publication 2023
Agar alum, potassium Bacteria Brain Heart Infection Luciferases Mus RNA, Messenger Saline Solution Spleen Sterility, Reproductive Strains Streptomycin Vaccination Yersinia pestis
2
Molecular Replacement Method for Protein Structure Determination
Protein structure was determined through the molecular replacement (MR) phasing method using the Phaser program (McCoy, 2007 ▸ ) of the PHENIX package (Adams et al., 2010 ▸ ). The previously elucidated Yersinia pestis Trx (Protein Data Bank, PDB entry 3p2a; Kim et al., unpublished work), which has 36% amino acid sequence identity with abTrx2, was used as the search model for MR. Model building and refinement were performed using Coot (Emsley & Cowtan, 2004 ▸ ) and phenix.refine tools from the PHENIX package (Adams et al., 2010 ▸ ). The quality of the model was validated using MolProbity (Chen et al., 2010 ▸ ). Structural representations were generated using PyMOL (DeLano & Lam, 2005 ▸ ).
Chang Y.J., Sung J.H., Lee C.S., Lee J.H, & Park H.H. (2023). Comparison of the structure and activity of thio­redoxin 2 and thio­redoxin 1 from Acinetobacter baumannii. IUCrJ, 10(Pt 2), 147-155.
Full text: Click here
Publication 2023
Amino Acid Sequence Proteins Yersinia pestis
3
Amplification and Cloning of Y. pestis ail Variant
Y. pestis Pestoides F genomic DNA was used as a template to amplify the ail variant, ailF100V E108_S109insS. Primers complementary to the upstream (76 bp) and downstream regions (99 bp) were used: 5’GCAGGAGCTCTCATGTCAGATATTTG3’ (forward primer); 5’ATACGAGCTCTAGCCTACCCCTATTA3’ (reverse primer). The generated PCR product (750 bp) was cloned into pCR2.1-TOPO (Invitrogen, Carlsbad, CA).
Kolodziejek A.M., Bearden S.W., Maes S., Montenieri J.M., Gage K.L., Hovde C.J, & Minnich S.A. (2023). Yersinia pestis Δail Mutants Are Not Susceptible to Human Complement Bactericidal Activity in the Flea. Applied and Environmental Microbiology, 89(2), e01244-22.
Full text: Click here
Publication 2023
Genome Oligonucleotide Primers Topotecan Yersinia pestis
4
Comparative Structural Analysis of Yersinia Ail Proteins
Y. pestis and Y. pseudotuberculosis Ail sequences in GenBank (National Health Institute, NIH) as of October 2021 were analyzed with ClustalW for multiple sequence alignment. The deep learning-based modeling method, RoseTTAFold, was used to generate Ail structural models that were superimposed and compared with UCSF Chimera plug-in, MatchMaker (69 (link), 70 (link)).
Kolodziejek A.M., Bearden S.W., Maes S., Montenieri J.M., Gage K.L., Hovde C.J, & Minnich S.A. (2023). Yersinia pestis Δail Mutants Are Not Susceptible to Human Complement Bactericidal Activity in the Flea. Applied and Environmental Microbiology, 89(2), e01244-22.
Full text: Click here
Publication 2023
Chimera Sequence Alignment Yersinia pestis Yersinia pseudotuberculosis Infections
5
Cultivation of Y. pestis Strains
Strains and plasmids used in the study are listed in Table 1. Strains were cultured in Lysogeny low-salt broth (LB) (EMD Millipore, Burlington, MA) or brain heart infusion broth (BHI; Difco, Sparks, MD) at indicated temperatures with or without kanamycin (Kn), 50 μg mL− or chloramphenicol (Cm), 30 μg mL−. Congo red agar (67 (link)) was used to confirm pigmentation phenotype of the Y. pestis KIM6+ strains.
Kolodziejek A.M., Bearden S.W., Maes S., Montenieri J.M., Gage K.L., Hovde C.J, & Minnich S.A. (2023). Yersinia pestis Δail Mutants Are Not Susceptible to Human Complement Bactericidal Activity in the Flea. Applied and Environmental Microbiology, 89(2), e01244-22.
Full text: Click here
Publication 2023
Agar Brain Chloramphenicol Heart Kanamycin Lysogeny Phenotype Pigmentation Plasmids Sodium Chloride Strains Yersinia pestis

Top products related to «Yersinia pestis»

1
Qiaamp dna mini kit by Qiagen
Sourced in Germany, United States, France, United Kingdom, Netherlands, Spain, Japan, China, Italy, Canada, Switzerland, Australia, Sweden, India, Belgium, Brazil, Denmark
The QIAamp DNA Mini Kit is a laboratory equipment product designed for the purification of genomic DNA from a variety of sample types. It utilizes a silica-membrane-based technology to efficiently capture and purify DNA, which can then be used for various downstream applications.
2
Bhi agar by BD
Sourced in United States, France, United Kingdom, Switzerland
BHI agar is a general-purpose microbiological culture medium used for the growth and isolation of a wide range of microorganisms, including bacteria and fungi. It provides essential nutrients and growth factors necessary for the cultivation of diverse microbial species.
3
Trizol reagent by Thermo Fisher Scientific
Sourced in United States, China, Japan, Germany, United Kingdom, Canada, France, Italy, Australia, Spain, Switzerland, Netherlands, Belgium, Lithuania, Denmark, Singapore, New Zealand, India, Brazil, Argentina, Sweden, Norway, Austria, Poland, Finland, Israel, Hong Kong, Cameroon, Sao Tome and Principe, Macao, Taiwan, Province of China, Thailand
TRIzol reagent is a monophasic solution of phenol, guanidine isothiocyanate, and other proprietary components designed for the isolation of total RNA, DNA, and proteins from a variety of biological samples. The reagent maintains the integrity of the RNA while disrupting cells and dissolving cell components.
4
Dneasy blood and tissue kit by Qiagen
Sourced in Germany, United States, United Kingdom, Spain, Canada, Netherlands, Japan, China, France, Australia, Denmark, Switzerland, Italy, Sweden, Belgium, Austria, Hungary
The DNeasy Blood and Tissue Kit is a DNA extraction and purification product designed for the isolation of genomic DNA from a variety of sample types, including blood, tissues, and cultured cells. The kit utilizes a silica-based membrane technology to efficiently capture and purify DNA, providing high-quality samples suitable for use in various downstream applications.
5
β galactosidase enzyme assay system by Promega
Sourced in United States, Switzerland
The β-Galactosidase Enzyme Assay System is a laboratory equipment used to measure the activity of the enzyme β-galactosidase. The assay system provides a colorimetric method for quantifying β-galactosidase enzyme levels in samples.
6
Cfx96 real time system by Bio-Rad
Sourced in United States, China, Japan, Germany, Singapore, France, United Kingdom, Switzerland, Italy, Canada, Spain, Belgium, Australia, Netherlands, Sweden, Lithuania, Brazil
The CFX96 Real-Time System is a qPCR (quantitative Polymerase Chain Reaction) instrument designed for accurate and reliable gene expression analysis. It features a 96-well format and supports a range of fluorescent detection chemistries to enable precise quantification of target sequences.
7
Balb c mice by Charles River Laboratories
Sourced in China, United States, Germany, Japan, Canada, United Kingdom, France, Italy, Spain
BALB/c mice are an inbred strain of laboratory mice commonly used in scientific research. They are a widely utilized model organism for various experiments and studies. The BALB/c strain is known for its susceptibility to certain diseases and its ability to produce high levels of antibodies, making it a valuable tool for immunological research.
8
Spectramax m5 by Molecular Devices
Sourced in United States, China, Japan, Switzerland, United Kingdom, Canada, Germany, Brazil, Uruguay
The SpectraMax M5 is a multi-mode microplate reader designed for absorbance, fluorescence, and luminescence measurements. It provides a diverse range of capabilities to support various applications in life science research and drug discovery.
9
Fluoview fv1000 confocal microscope by Zeiss
Sourced in Germany
The FluoView FV1000 is a confocal microscope designed for high-resolution imaging. It features laser-based illumination, multiple detection channels, and advanced software for image acquisition and analysis. The core function of the FluoView FV1000 is to provide researchers with a tool for detailed, high-quality imaging of biological samples.
10
Formalin by Thermo Fisher Scientific
Sourced in United States, United Kingdom, Canada, India
Formalin is a chemical solution commonly used in laboratory settings. It is a mixture of formaldehyde and water, which serves as a fixative agent to preserve biological samples for analysis and study.

More about "Yersinia pestis"

plague, bubonic plague, septicemic plague, pneumonic plague, Yersinia, zoonotic, pathogen, fleas, virulence factors, host-pathogen interactions, DNA extraction, RNA extraction, gene expression, quantitative PCR, animal models, microscopy, fixation