Ciliata

To minimise variation introduced by differing methodologies, such as choice of sampling or DNA extraction method40 (link) and primer-driven gene amplification biases41 (link), we used a standardised pipeline to process samples (unless indicated otherwise in Supplementary Data 1). Briefly, approximately 20 g of whole (i.e., solid and liquid) mid-rumen or camelid foregut contents were collected via stomach tube, cannula, or post mortem as previously described35 (link). Samples were immediately frozen, freeze-dried, and then couriered to AgResearch. Freeze-dried samples were homogenised in a coffee blender and DNA was extracted from a representative 30 mg subsample using the PCQI method40 (link)42 (link). We assessed the structure of microbial communities by sequencing regions of bacterial and archaeal 16S rRNA genes and ciliate protozoal 18S rRNA genes in triplicate as described previously35 (link)37 (link) using primers comprised of (5′ to 3′) a sequencing adapter (A or B), a sample-unique 12-base error-correcting Golay barcode on one of each primer pair, a two-base linker, and a group-specific sequence targeting the marker gene. For bacteria, the primers were Ba515Rmod1 (adapter A-barcode-GT-CCGCGGCKGCTGGCAC) and Ba9F (adapter B-AC-GAGTTTGATCMTGGCTCAG). For archaea, the primers were Ar915aF (adapter A-barcode-GT-AGGAATTGGCGGGGGAGCAC) and Ar1386R (adapter B-CA- GCGGTGTGTGCAAGGAGC). For protozoa, the primers were Reg1320R (adapter A-barcode-TC-AATTGCAAAGATCTATCCC) and RP841F (adapter B-AA-GACTAGGGATTGGARTGG). Linker A was CCATCTCATCCCTGCGTGTCTCCGACTCAG and linker B was CCTATCCCCTGTGTGCCTTGGCAGTCTCAG. Amplicons were sequenced using 454 GS FLX Titanium chemistry at Eurofins MWG Operon (Ebersberg, Germany). Sample processing and pipeline reproducibility controls were performed to identify variation introduced during sample processing (Supplementary Text 1). Sequence data are available from GenBank [accession numbers PRJNA272135, PRJNA272136, and PRJNA273417].

Gene sequence data were obtained for a total of 104 species representing almost all the main ciliate lineages. Genomic DNA extraction, PCR amplifications and sequencing were performed as described in previous studies59 (link)112 (link) for the following genes: completed sequence (~1800 bp) of the SSU rDNA; a partial sequence (~500 bp) of the ITS1-5.8S-ITS2; a partial sequence (~1800 bp) of the LSU rDNA; and, a partial sequence (~1000 bp) of the alpha-tubulin gene.
In total, 232 sequences were submitted to the GenBank database (Additional file 1: Table S1). In order to maximize the taxonomic diversity of ciliates included in our analyses, newly characterized sequences were combined with relevant sequences obtained from GenBank (Additional file 1: Table S2). Six datasets were evaluated: (1) concatenation of the aligned SSU rDNA, 5.8S DNA, LSU rDNA and alpha-tubulin amino acid sequences from datasets 2–5; (2) SSU rDNA sequences including all 152 group representatives; (3) 5.8S rDNA sequences of 113 taxa; (4) LSU rDNA sequences of 118 taxa; (5) alpha-tubulin amino acid sequences of 116 taxa; (6) alpha-tubulin nucleotide sequences, including the first two codon positions, of 116 taxa. Orthologs of alpha-tubulin for concatenations were selected according to Gao and Katz15 (link).
Sequences were aligned using the GUIDANCE algorithm with default parameters in GUIDANCE web server113 (link). Regions that could not be unambiguously aligned were excluded from the phylogenetic analyses. Because the ITS regions are too divergent to be aligned, only the 5.8S rDNA of the ITS1-5.8S-ITS2 region was used. The lengths of the final alignments of datasets (1)-(6) were 3794, 1661, 164, 1612, 357, 714 positions, respectively.

HEK293, MEFs and NIH3T3 cells were cultured in Dulbecco’s modified Eagle medium (Glutamax, Gibco) supplemented with 10% fetal calf serum (FCS), 100 U/ml penicillin and 100 µg/ml streptomycin. A549 cells were cultured in DMEM supplemented with 10% FBS, 2 mM L-glutamine, 100 units/ml penicillin and 100 µg/ml streptomycin. The HEK293-t-rex-flpIn stable cell lines with doxycycline-inducible mutant forms of LRRK2 have been described previously (Nichols et al., 2010 (link)). LRRK2 expression in HEK293-t-rex-flpIn was induced by doxycycline (1 μg/ml). NIH3T3 cells were transfected with eGFP-LRRK2-G2019S at 40% confluency and cilia formation induced by serum starvation after 24 hr. At the same time, 200 nM MLI-2 (or DMSO as control) was added and cells incubated for an additional 24 hr before fixation. LRRK2-R1441G MEFs were plated at 40% confluency and serum starved for 24 hr after 1 day. MLi-2 was added at 100 nM or 200 nM over night before fixation of the cells. Transient transfections were performed 24–48 hr prior to cell lysis using either FuGene 6, Fugene HD (Promega) or polyethylenimine PEI (Polysciences). hTERT-RPE cells were cultured in DMEM + F12 medium with 10% FBS. GFP-Rab8 (wt, T72A and T72E) were expressed using lentivirus vector pSLQ1371. After 48 hr of infection, cells were plated onto collagen coated coverslips and 48 hr later treated with serum-free medium to initiate ciliation. Cells were fixed with PFA and stained using mouse anti-Arl13B (Neuromab, 1:1000). All cells were tested for mycoplasma contamination and overexpressing lines were verified by western blot analysis.

Ciliate volumes were estimated using appropriate geometric shapes (cone, ball, and cylinder). Tintinnid carbon biomass was estimated using the equation^{89 (link)}: $$C=V_i\times 0.053+444.5,$$ where C (μg C L⁻¹) is the carbon biomass, V_i (μm³) is the lorica volume. We used a conversion factor of carbon biomass for aloricate ciliates of 0.19 pg/μm^{390 (link)}. The average abundance and biomass of the water column were calculated following Yu et al.^{91 (link)} and Wang et al.^{92 (link)}. We used the Margalef index (d_Ma)⁹³ and Shannon index (H′)^{94 (link)} to test tintinnid diversity indices in the day and night variations. Biogeographically, the tintinnid genera are mainly classified into two groups in the oceanic waters based on Dolan and Pierce⁹⁵ : Cosmopolitan, species distributed widespread in the world ocean; Warm Water, species observed in both coastal systems and open waters throughout the world ocean, but absent from sub-polar and polar waters.
The dominance index (Y) of tintinnid species in one assemblage was calculated using formula⁹⁶ : $$Y=\frac{N_i}{(N\times f_i)},$$ where N_i is the number of individuals of species i in all samples, f_i is the occurrence frequency of species i in all samples and N is the total number of species. Species with Y ≥ 0.02 represented the dominant species in an assemblage.
Distributional data of sampling stations, ciliates and environmental parameters (Depth, temperature, salinity, and Chl a) were visualized by ODV (Ocean Data View, Version 5.0), Surfer (Version 13.0), OriginPro 2021 (Version 9.6), and Grapher (Version 12.0). Correlation analysis between environmental and biological variables (nonparametric-test, Independent t-test, Spearman’s rank analysis) were performed using SPSS (Version 16). The significance for grouping in the environment and ciliate community (aloricate ciliate and tintinnid) was tested by PERMANOVA analysis in PERMANOVA C of PRIMER 6^{97 ,98 (link)}. The partial Mantel tests were performed between ciliate community and environmental factors in R4.1.1.

The variation of ciliate vertical distribution was addressed by conducting two time-series sampling in the upper 500 m at two distinct sites, Station (St.) S1 in nSCS and St. P1 in tWP, during two different cruises (Fig. 7). St. S1 was visited from 29 to 31 March 2017 aboard R.V. “Nanfeng”, and St. P1 from 2 to 3 June 2019 aboard R.V. “Kexue”. During 48 h (St. S1) or 24 h (St. P1) sampling periods, seawater samples were collected by using a CTD (Sea-Bird Electronics, Bellevue, WA, USA)—rosette carrying 12 Niskin bottles of 12 L each (Supplementary Table S5). In the nSCS, the sampling depths were 3, 10, 25, 50, DCM (deep Chl a maximum layer), 100, 200 and 500 m; in the tWP, the sampling depths were surface (3), 30, 50, 75, DCM, 150, 200, 300 and 500 m. Casts were approximately launched every 6 h, the CTD determining vertical profiles of temperature, salinity and chlorophyll a in vivo fluorescence (Chl a). A total of 117 seawater samples were collected for planktonic ciliate community structure analysis. For each depth, 1 L seawater sample was fixed with acid Lugol’s (1% final concentration) and stored in darkness at 4 °C during the cruise.Figure 7

Survey stations in the northern South China Sea (nSCS) and tropical West Pacific (tWP).

In the laboratory, water samples were concentrated to approximately 200 mL by siphoning off the supernatant after the sample had settled for 60 h. This settling and siphoning process was repeated until a final concentrated volume of 50 mL was achieved, which was then settled in two Utermöhl counting chambers (25 mL per chamber)⁸² for at least 24 h. Planktonic ciliates were counted using an Olympus IX 73 inverted microscope (100 × or 400 ×) according to the process of Utermöhl⁸² and Lund et al.^{83 (link)}.
For each species, size (length, width, according to shape) of the cell (aloricate ciliate) or lorica (tintinnid, especially length and oral diameter) were determined for at least 10 individuals if possible. Aloricate ciliates were categorized into small (10–20 μm), medium (20–30 μm) and large (> 30 μm) size-fractions for maximum body length of each individual following Wang et al.^{43 (link)}. Tintinnid taxa were identified according to the size and shape of loricae following previous references^{1 ,9 (link),40 ,44 (link),84 –86} . Tintinnid species richness in each station was highlighted by the number of tintinnid species that appeared in that station. Because mechanical and chemical disturbance during collection and fixation can detach the tintinnid protoplasm from the loricae^{87 ,88} , we included empty tintinnid loricae in cell counts.