Copepoda

The general growth pattern of C. finmarchicus is shown in Fig. 2. The length measure used throughout this paper is the volumetric length, i.e., the cubic root of estimated body volume from the measured N and C content. Even though this measure is rather abstract, it has the advantage that nauplii and copepodites can be compared in the same graphs, that C and N growth can be compared, and that the growth patterns can easily be compared to the von Bertalanffy curve as expected for most animals in a DEB context (Nisbet et al. 2000 (link)). The volumetric length based on N content represents structural biomass plus the egg buffer for the embryo (including the non-feeding naupliar stages). The length based on C content includes all biomass (egg buffer, structure and lipid storage). As long the C/N ratio is 4 ( $d_{\mathrm{C}}/d_{\mathrm{N}}$ in Table 3), volumetric length based on C and N will be the same; a higher value for C-based length in Fig. 2 indicates lipid storage. The conversion from the three state variable (Table 2, all in dry weight) to volumetric length measures is explained in more detail later.Fig. 2

Volumetric body length of C. finmarchicus, calculated from N content (representing structural biomass plus egg buffer) and C content (including lipid storage as well) from egg to adulthood (left panel) at 8 °C (data from Campbell et al. 2001 (link)). Life stages indicated are Embryo, Juvenile, Sub-adult and Adult (Fig. 1). Straight lines drawn by eye to indicate linearity. Right panel shows a standard (solid line) and truncated (broken line) von Bertalanffy curve on length basis for reference

As with the congeneric C. sinicus (Jager et al. 2015 (link)), the embryo only decreases in size over time (Fig. 2). Egg buffer is converted into structural biomass, whereby mass is lost on maturation, maintenance and conversions. In contrast to C. sinicus, however, the post-embryonic growth of C. finmarchicus does not resemble a truncated von Bertalanffy curve (observation 2 in Table 1). Rather, the growth curve for juveniles and sub-adults consists of two more-or-less linear phases (Fig. 2). Such a pattern has also been observed for other calanoid species, such as C. marshallae (Peterson 1986 (link)) and the genus Acartia
(Miller et al. 1977 (link)). Deviations from the von Bertalanffy curve in the early life stages are quite common, especially among animal species sporting larval development, and several modifications in a DEB context have been proposed (Kooijman 2014 (link)). Here we assume that the copepods go through a ‘type A acceleration’, where the specific assimilation rate makes a step-up in one of the late naupliar or early copepodite stages.

We used custom PERL scripts to retrieve the index information and identify and trim the amplification primer sequences. We discarded any DNA sequence shorter than 50 bp, with the exception of sequences amplified with plant and bryophyte primers for which short amplification products were expected (see Supplemental Table 1). We also discarded any trimmed read pair for which the difference in sequence length was greater than 5 bp between the two paired-end reads to eliminate any reads where primers were not found in both reads. We then merged the paired reads into a single consensus DNA sequence using PANDAseq with default parameters26 (link). We used Mothur27 (link) to cluster unique DNA sequences and counted how many reads carried each unique DNA sequence.
While all raw sequences are freely available online (accession number SRP058316), we only describe here the analyses of macroorganism DNA sequences for sake of simplicity (microorganism sequences can be easily analyzed using standard packages such as those implemented in QIIME28 ). For macro-organisms such as mammals, many species have been sequenced for the locus of interest and if not, a closely related species is likely present in the NCBI database (but see also below). Therefore, to analyze DNA sequences from macroorganisms–mammals, amphibians, birds, bryophytes, arthropods, copepods and plants–we used BLAST29 (link) to directly identify the closest DNA sequences in the NCBI database and the likely species of origin. Briefly, we removed from our analyses any DNA sequence observed in less than 10 reads total (summing across all samples), as these likely represent sequencing errors. We then compared each remaining DNA sequence to all sequences deposited in the NCBI nt database using Blastn (excluding uncultured samples) and only considered matches with greater than 90% identity over the entire sequence length. We then retrieved taxonomic data of all best match(es) for each sequence from NCBI. If multiple species matched a single sequence, all species names were assigned to the sequence. We conducted further analyses at the species level for all taxa, using a minimum read count per sample of 10 to determine absence/presence.

The 1st PCR step was performed to amplify ISSR regions from genomic DNA with MIG-seq primer set-1 (Table 1). Alternatively, MIG-seq primer set-2 was used to create a different library from the same sample set (Supplementary Table 1). The volume of the PCR reaction mixture was 7 μl, containing 1 μl of template DNA, 0.2 μM of each 1st PCR primers, 3.5 μl of 2 × Multiplex PCR Buffer (Multiplex PCR Assay Kit Ver.2, Takara Bio, Kusatsu, Japan), and 0.035 μl of Multiplex PCR Enzyme Mix (Multiplex PCR Assay Kit Ver.2, Takara Bio). PCR was performed under the following conditions: initial activation at 94 °C for 1 min; 25 cycles for normal-concentration DNA (> 10 ng/μl) or 27 cycles for low-concentration DNA samples (< 5 ng/μl) from Calanoida copepod (see Supplementary Table 4) of denaturation at 94 °C for 30 s, annealing at 48 °C for 1 min and extension at 72 °C for 1 min; followed by a final incubation at 72 °C for 10 min, using a GeneAmp PCR System 9700 (Thermo Fisher Scientific). The PCR products were visualized using a Microchip Electrophoresis System (MultiNA; Shimadzu, Kyoto, Japan) with the DNA-2500 Reagent Kit (Shimadzu). Note that the 1st PCR could amplify a variety of ISSR regions, including some mismatched priming sites, depending on the conditions, because we decided to apply a relatively low annealing temperature (48 °C in our recommended system) for the 1st PCR after checking several different temperatures (data not shown). This annealing temperature could be effective to amplify more regions.
The 2nd PCR was performed to add the complementary sequences for the oligonucleotides that coat the Illumina sequencing flow cell, annealing sites of DNA sequencing primers, and indices to the 1st PCR products. The sequences of the common forward and indexed reverse primers were: 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTCTG-3′ and 5′-CAAGCAGAAGACGGCATACGAGATxxxxxxGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGAC-3′, where “xxxxxx” denotes the six-base index (Supplementary Table 5). This PCR step was conducted independently to add individual indices to each sample using the common forward and indexed reverse primers. The six-base index was designed using the Barcode Generator by Luca Comai and Tyson Howell (http://comailab.genomecenter.ucdavis.edu/index.php/Barcode_generator). The 1st PCR product from each sample was diluted 50 times with deionized water and used as the template of the 2nd PCR. The 2nd PCR was performed in a 15-μl reaction mixture containing 3 μl of diluted 1st PCR product, 3 μl of 5 × PrimeSTAR GXL Buffer (Takara Bio), 200 μM of each dNTP, 0.375 U of PrimeSTAR GXL DNA Polymerase (Takara Bio), and 0.2 μM of common forward primer and individual reverse primer. The PCR conditions were as follows: 12 cycles of denaturation at 98 °C for 10 s, annealing at 54 °C for 15 s, and extension at 68 °C for 30 s. The concentrations of each 2nd PCR product (libraries) were measured using a Microchip Electrophoresis System (MultiNA, Shimadzu) with a DNA-2500 Reagent Kit (Shimadzu). The libraries from each sample, each with a different index, were then pooled in equimolar concentrations. To reduce the salt concentration, the mixed libraries were purified and the buffer was replaced with elution buffer using a QIAquick PCR Purification Kit (Qiagen, Venlo, Netherlands). Fragments in the size range of 300–800 bp in the purified library were isolated using Pippin Prep DNA size selection system (Sage Science, Beverly, MA, USA). The final concentration was measured using a SYBR green quantitative PCR assay (Library Quantification Kit; Clontech Laboratories, Mountain View, CA, USA) with primers specific to the Illumina system.

The devised re-infection regime allowed I. ptychoderae to complete its life cycle in the host tissues, enabling us to obtain post-infested copepodids for the morphological examination described below. In the re-infection study, ten individuals of P. flava were cut into 5 fragments (each about 1 cm) as surrogate hosts and infected by 10 copepodids, respectively. After infection, three infected acorn worms were sacrificed and examined every day. The acorn worms were placed in 3–5% ethanol solution for at least 4 hrs and washed with distilled water. Then, the washed water was poured through a fine net (mesh size = 100 μm) and examined under a dissection microscope. The copepods were picked up by forceps and preserved in 70% ethanol.

Acorn worms P. flava were collected from the sandy beach at Chito, Penghu Islands, Taiwan (23°38’54.17"N; 119°36’14.40"E). To isolate the parasitic copepods, acorn worms were anesthetized with 0.2 M magnesium chloride in seawater for 15 minutes and the parasitic copepods were obtained from dissected cysts of hosts. The collection and use of invertebrate deuterostome animals for scientific research in JKY laboratory was reviewed by the Institutional Animal Care & Use Committee, Academia Sinica, and a waiver of ethic approval was granted (Case number: 16-04-956). The experimental procedures for handling the acorn worm P. flava were approved by the Institutional Biosafety Committee, Academia Sinica (Permit number: BSF0418-00003976).

The invasive E. coli strain SVC1 is a K‐12 derivative [F^–endA1 hsdR17 (rK^– mK⁺) glnV44 thi‐1 relA1 rfbD1 spoT1 Δrnc ΔdapA]. The cells are auxotrophic for diaminopimelic acid (DAP) due to a deletion of dapA. E. coli cells were cultured in brain–heart infusion medium supplemented with DAP (100 μg/mL) and appropriate antibiotics at the following concentrations: kanamycin, 25 μg/mL; ampicillin, 100 μg/mL. A549 cells are a human adenocarcinoma alveolar basal epithelial cell line. For the in vitro GFP silencing experiments, an A549 cell line constitutively expressing GFP (Cell Biolabs, San Diego, California, USA, AKR‐209) was used. The identity of the A549/GFP cells was confirmed by GFP expression, morphology, and trypan‐blue dye exclusion, and all cell cultures were routinely monitored for microbial contamination using standard techniques. The construction of pSiVEC‐scramble (non‐specific small RNA sequence), pSiVEC‐PA, and pSiVEC‐NP, which were derived from pmbv43 [8 (link)], is described in a previous publication [9 (link)]. pSiVEC‐GFP was constructed using the DNA template encoding the shRNA specific for GFP [77 (link)] from the copepod Pontellina plumata: sense, GCTACGGCTTCTACCACTTT and antisense, AAAGTGGTAGAAGCCGTAGC. Using standard cloning and transformation methods, resulting SVC1 colonies transformed with the plasmids pSiVEC‐scramble, pSiVEC‐PA, pSiVEC‐NP, and pSiVEC‐GFP were screened by PCR, and a single positive clone was sequence validated and propagated. Stocks were generated and stored at −80°C in 20% glycerol. A single frozen aliquot from each construct stock was thawed to determine colony forming units (CFU)/mL via plate enumeration [9 (link)]. These strains are referred to as SVC1‐scramble, SVC1‐PA, SVC1‐NP, and SVC1‐GFP.