Log In Sign up
The largest database of trusted experimental protocols
> Living Beings > Eukaryote > Culex

Culex

Culex is a genus of mosquitoes that includes some of the most common and widespread species known to transmit diseases to humans and animals.
These mosquitoes are primarily found in tropical and temperate regions around the world.
Culex mosquitoes are vectors for numerous pathogens, including the causative agents of filariasis, Japanese encephalitis, West Nile virus, and other arboviral infections.
Resarchers studying Culex mosquitoes can leverage PubCompare.ai's AI-driven platform to optimize their research protocols, easily locate relevant literature, and identify the best protocols and produtcs to enhance reproducibility and efficiency.

Most cited protocols related to «Culex»

1
Malaria Epidemiology in Tanzanian Floodplains
Cited 47 times
The study was conducted in three villages in the Kilombero floodplains in Ulanga district, south-eastern Tanzania (Fig 1). This area is perennially meso-endemic for malaria and has high mosquito densities throughout the year, peaking between January and May. Annual rainfall and temperatures range from 1200 to 1800 mm and 20°C to 32.6°C respectively. Malaria vector species in the area comprise primarily of the An. gambiae s.l (almost exclusively consisting of An. arabiensis), and An. funestus group. Several other Anopheles mosquitoes such as An. coustani, An. pharoensis, An. squamosus, An. ziemanni and An. wellcomei are also found, as well as several culicine species, mainly Mansonia mosquitoes, Aedes mosquitoes and Culex species. The major vector control intervention in this area is LLINs [19 (link)], and the last mass-distribution of nets, prior to this study had been conducted between 2010 and 2011 [19 (link)].
Kaindoa E.W., Matowo N.S., Ngowo H.S., Mkandawile G., Mmbando A., Finda M, & Okumu F.O. (2017). Interventions that effectively target Anopheles funestus mosquitoes could significantly improve control of persistent malaria transmission in south–eastern Tanzania. PLoS ONE, 12(5), e0177807.
Full text: Click here
Publication 2017
Aedes Anopheles Cloning Vectors Culex Culicidae Malaria Mansonia SLC6A2 protein, human
2
Community-Based Malaria Vector Control in Dar es Salaam
Cited 18 times
The study was conducted in Dar es Salaam, Tanzania's biggest and economically most important city with 2.7 million inhabitants and a total area of 1400 km2 [22 (link),27 ]. The city is divided into three municipalities, namely Ilala, Kinondoni and Temeke. Each of these municipalities is further divided into wards and then neighbourhoods known as mitaa (singular mtaa) in Kiswahili, literally meaning street [28 (link)].
A recently-initiated Urban Malaria Control Programme (UMCP) in Dar es Salaam delegates responsibility for routine mosquito control and surveillance to modestly paid community members, known as Community-Owned Resource Persons (CORPs) in a decentralized manner [29 (link)]. However, baseline evaluation revealed that at the early stage of the UMCP the levels of coverage achieved by the CORPs were insufficient to enable effective suppression of malaria transmission through larval control, and that training, support and supervision of the CORPs was poor [24 (link)]. The authors concluded that novel surveillance systems were required to enable community-based integrated vector management [24 (link)].
Early experience also indicated that control of culicine species, responsible for the bulk of biting nuisance [30 (link)-32 (link)], would be essential to achieve community acceptance and support for the programme. It was therefore decided to prioritize intensive control of malaria vector species in habitats which are open to sunlight (referred to as "open habitats") but to also implement less intensive control of sanitation structures, such as pit latrines, soakage pits, and container type habitats which are closed to the sun (referred to as "closed habitats") and produce huge numbers of Culex and Aedes, but no Anopheles [33 (link),34 (link)]. Thus, the bulk of the programme description below prioritizes and focuses on the system for controlling open habitats suitable for Anopheles, with a brief section describing mosquito control in closed habitats, for which no detailed routine larval surveillance was undertaken.
Fillinger U., Kannady K., William G., Vanek M.J., Dongus S., Nyika D., Geissbühler Y., Chaki P.P., Govella N.J., Mathenge E.M., Singer B.H., Mshinda H., Lindsay S.W., Tanner M., Mtasiwa D., de Castro M.C, & Killeen G.F. (2008). A tool box for operational mosquito larval control: preliminary results and early lessons from the Urban Malaria Control Programme in Dar es Salaam, Tanzania. Malaria Journal, 7, 20.
Full text: Click here
Publication 2008
Aedes Anopheles Cloning Vectors Culex Dietary Fiber Larva Malaria Maritally Unattached Sunlight Supervision Transmission, Communicable Disease Van der Woude syndrome
3
Multiplex Real-Time PCR for Culex Mosquito Identification
Cited 16 times
Mosquitoes collected at the various study sites were frozen at −70°C and transported to the laboratory where they were first identified morphologically at the genus level [13] . Subsequently, Culex ssp. from individual collections were pooled to up to 25 specimens per pool. All pooled samples were placed in sterile 2-mL cryovials, and subsequently maintained at −70°C until being assayed. Each mosquito pool was triturated in 500 µL of cell culture medium (high glucose Dulbecco's modified Eagle's medium (Sigma-Aldrich) with 10% heat-inactivated fetal bovine serum, 100 U/mL penicillin, 100 µg/mL streptomycin, and 2.5 µg/mL amphotericin B using two stainless steel beads (5 mm; Qiagen) in a TissueLyser (Qiagen) for 2 min at 50 oscillation/s. The suspensions were clarified by centrifugation (5,000× g for 1 min), and the supernatant was used for DNA extraction with AquaGenomic™-Solution (protocol for Drosophila samples, MultiTarget Pharmaceuticals) or QIAamp viral RNA mini kit according to the manufacturer's instructions.
The extracted DNA was analyzed by a newly designed multiplex real-time PCR using the primers for Culex pipiens F (5′- GCGGCCAAATATTGAGACTT -3′; nucleotide [nt] position 3 to 22 [the nt positions are given according to the numbering in the Culex reference strain 258c, GenBank accession number gb/DQ470148.1) and Cx. pipiens R (5′- CGTCCTCAAACATCCAGACA -3′; nt position 146 to 165) and probes Cx. pipiens all (5′- Cy55- GGAACATGTTGAGCTTCGGK -BBQ-1 -3′; nt position 77 to 95), Cx. pipiens pipiens biotype pipiens (5′- JOE GCTTCGGTGAAGGTTTGTGT-BHQ1 –3′) nt position 89 to 108 and Cx. pipiens pipiens biotype molestus (5′- Rox- TGAACCCTCCAGTAAGGTATCAACTAC- BHQ2 -3′; nt position 41 to 67; Reference strain 284b, GenBank accession number gb/470150.1) of the microsatelite locus CQ11. Cx. torrentium DNA was detected using the primers Cx. torrentium F (5′ -GACACAGGACGACAGAAA -3′; nt position 86 to 103), Cx. torrentium R (5′- GCCTACGCAACTACTAAA -3′; nt position 363 to 380) and the probe Cx. torrentium (5′- FAM- CGATGATGCCTGTGCTACCA-BHQ1 -3′; nt position 112 to 131) of the ace2 gene (Cx. torrentium reference strain, GenBank accession number gb/AY497525.1). Multiplex real-time PCR was performed in a 20 µL reaction volume using HotStarTaq® Master Mix Kit according to the manufacturer's protocol (Qiagen). The specific primer molarities and sequence alignments of the loci used for primer design are shown in Figure S1.
Rudolf M., Czajka C., Börstler J., Melaun C., Jöst H., von Thien H., Badusche M., Becker N., Schmidt-Chanasit J., Krüger A., Tannich E, & Becker S. (2013). First Nationwide Surveillance of Culex pipiens Complex and Culex torrentium Mosquitoes Demonstrated the Presence of Culex pipiens Biotype pipiens/molestus Hybrids in Germany. PLoS ONE, 8(9), e71832.
Full text: Click here
Publication 2013
ACE2 protein, human Amphotericin B Cell Culture Techniques Cells Centrifugation Culex Culicidae Drosophila Fetal Bovine Serum Freezing Genes Glucose Nucleotides Oligonucleotide Primers Penicillins Pharmaceutical Preparations Real-Time Polymerase Chain Reaction RNA, Viral Sequence Alignment Stainless Steel Sterility, Reproductive Strains Streptomycin
4
Comparative Genomics: Curated Genome Sequence Database
Cited 16 times
The following genome sequence files were curated from the Genome Bioinformatics Group of University of California, Santa Cruz [25 ]: Human, March 2006 (hg18); Chimpanzee, March 2006 (panTro2); Rhesus, January 2006 (rheMac2); Rat, November 2004 (rn4); Mouse, February 2006 (mm8); Cat, March 2006 (felCat3); Dog, May 2005 (canFam2); Horse, January 2007 (equCab1); Cow, March 2005 (bosTau2); Opossum, January 2006 (monDom4); Chicken, May 2006 (galGal3); Xenopus tropicalis, August 2005 (xenTro2); Zebrafish, March 2006 (danRer4); Tetraodon, February 2004 (tetNig1); Fugu, October 2004 (fr2); Stickleback, February 2006 (gasAcu1); Medaka, April 2006 (oryLat1); D. melanogaster, April 2006 (dm3); D. simulans, April 2005 (droSim1); D. sechellia, October 2005 (droSec1); D. yakuba, November 2005 (droYak2); D. erecta, August 2005 (droEre1); D. ananassae, August 2005 (droAna2); D. pseudoobscura, November 2005 (dp3); D. persimilis, October 2005 (droPer1); D. virilis, August 2005 (droVir2); D. mojavensis, August 2005 (droMoj2); D. grimshawi, August 2005 (droGri1); C. elegans, January 2007 (ce4); C. brenneri, January 2007 (caePb1); C. briggsae, January 2007 (cb3); C. remanei, March 2006 (caeRem2); and P. pacificus, February 2007 (priPac1); The genome sequence files for the Elephant, June 2005; Hedgehog, June 2006 and Armadillo, June 2005 were downloaded from the Broad Institute [26 ].
The following bacteria genome sequence files were curated from the BacMap database of University of Alberta [27 ]: Staphylococcus aureus COL; Staphylococcus aureus MRSA252; Staphylococcus aureus MSSA476, Staphylococcus aureus Mu50; Staphylococcus aureus MW2; Staphylococcus aureus N315; Staphylococcus aureus subsp. aureus NCTC 8325; Staphylococcus aureus RF122; Staphylococcus aureus subsp. aureus USA300; Staphylococcus epidermidis ATCC 12228; Staphylococcus epidermidis RP62; Staphylococcus haemolyticus JCSC1435; Escherichia coli 536; Escherichia coli APEC O1; Escherichia coli CFT073; Escherichia coli O157:H7 EDL933; Escherichia coli K12 MG1655; Escherichia coli W3110; Escherichia coli O157:H7 Sakai; Klebsiella pneumoniae MGH 78578; Salmonella enterica Choleraesuis SC-B67; Salmonella enterica Paratypi A ATCC 9150; Salmonella typhimurium LT2; Salmonella enterica CT18; Salmonella enterica Ty2; Shigella boydii Sb227; Shigella dysenteriae Sd197; Shigella flexneri 2a 2457T; and Shigella flexneri 301. The genome sequence files for Staphylococcus aureus subsp. aureus JH1, Staphylococcus aureus subsp. aureus JH9, Staphylococcus aureus Mu3, and Staphylococcus aureus subsp. aureus str. Newman were curated from the European Bioinformatics Institute of the European Molecular Biology Laboratory [28 ]. The genome sequence file for Escherichia coli UT189 was taken from Enteropathogen Resource Integration Center [29 ], and genome sequence data for Salmonella bongori was downloaded from the Sanger Institute Sequencing Centre [30 (link)].
The mosquito genome sequence files for Aedes aegypti, Anopheles gambiae and Culex pipiens were curated from the VectorBase database [31].
Yavatkar A.S., Lin Y., Ross J., Fann Y., Brody T, & Odenwald W.F. (2008). Rapid detection and curation of conserved DNA via enhanced-BLAT and EvoPrinterHD analysis. BMC Genomics, 9, 106.
Full text: Click here
Publication 2008
Aedes Anopheles gambiae Armadillos Caenorhabditis elegans Chickens Culex Culicidae Didelphidae Drosophila melanogaster Drosophila simulans Elephants Equus caballus Erinaceidae Escherichia coli Escherichia coli K12 Escherichia coli O157 Europeans Genome Genome, Bacterial Homo sapiens Klebsiella pneumoniae Macaca mulatta Mice, House Oryziinae Pan troglodytes Salmonella bongori Salmonella enterica Salmonella typhimurium LT2 Shigella boydii Shigella dysenteriae Shigella flexneri Staphylococcus aureus Staphylococcus aureus subsp. aureus Staphylococcus epidermidis Staphylococcus haemolyticus Sticklebacks Takifugu Xenopus Zebrafish
5
Phylogenetic Analysis of Pea Aphid Proteome
Cited 15 times
We reconstructed the complete collection of phylogenetic trees, also known as the Phylome, for all A. pisum protein-coding genes with homologs in other sequenced insect genomes. For this we used a similar automated pipeline to that described earlier for the human genome [43] (link). A database was created containing the pea aphid proteome and that of 16 other species. These include 12 other insects (Tribolium castaneum, Nasonia vitripennis, Apis mellifera [from NCBI database], Drosophila pseudoobscura, Drosophila melanogaster, Drosophila mojavensis, Drosophila yakuba [from FlyBase], Pediculus humanus, Culex pipiens [from VectorBase], Anopheles gambiae, Aedes aegypti [from Ensembl], and Bombyx mori [from SILKDB]) and four outgroups (the crustacean Daphnia pulex [the GNOMON predicted set provided by the JGI], the nematode Caenorhabditis elegans, and two chordates, Ciona intestinalis and Homo sapiens [from Ensembl]). For each protein encoded in the pea aphid genome, a Smith-Waterman [106] (link) search (e-val 10−3) was performed against the above mentioned proteomes. Sequences that aligned with a continuous region longer than 50% of the query sequence were selected and aligned using MUSCLE 3.6 [107] with default parameters. Gappy positions were removed using trimAl v1.0 (http://trimal.cgenomics.org), using a gap threshold of 25% and a conservation threshold of 50%. Phylogenetic trees were estimated with Neighbor Joining (NJ) trees using scoredist distances as implemented in BioNJ [108] (link) and by ML as implemented in PhyML v2.4.4 [105] (link), using JTT as an evolutionary model and assuming a discrete gamma-distribution model with four rate categories and invariant sites, where the gamma shape parameter and the fraction of invariant sites were estimated from the data. Support for the different partitions was computed by approximate likelihood ratio test as implemented in PhymL (aLRT) [109] (link). All trees and alignments have been deposited in PhylomeDB [110] (link) (http://phylomedb.org). Additional details for this analysis can be found in [110] (link).
Genome Sequence of the Pea Aphid Acyrthosiphon pisum. (2010). PLoS Biology, 8(2), e1000313.
Full text: Click here
Publication 2010
Aedes Anopheles gambiae Aphids Apis Biological Evolution Bombyx mori Caenorhabditis elegans Chordata Ciona intestinalis Crustacea Culex Daphnia Drosophila Drosophila melanogaster Gamma Rays Genes Genes, vif Genome Genome, Human Genome, Insect Homo sapiens Insecta Lice, Body Muscle Tissue Nematoda Pisum Proteins Proteome Staphylococcal Protein A Trees Tribolium, monocots

Most recents protocols related to «Culex»

1
Mosquito Insecticide Efficacy Evaluation
Not available on PMC !

Example 13

Solution 1 (2% of perillaldehyde), Solution 2 (0.008 μg/mosquito of dinotefuran), and Solution 3 (0.008 μg/mosquito of dinotefuran with 2% of perillaldehyde) were tested for efficacy against 3- to 5-day old adult Culex quinquefasciatus. At 1 hour we obtained 33%, 10%, and 100% knockdown for Solutions 1, 2, and 3, respectively. At 24 hours we obtained 13%, 77%, and 100% mortality for Solutions 1, 2, and 3, respectively. The CO2 control and acetone standard both had 0% knockdown at 1 hour, and 0% mortality at 24 hours. Results are shown in Table 5.

TABLE 5
Efficacy of perillaldehyde, dinotefuran, and a combination of both against adult, virgin,
female Culex quinquefasciatus mosquitoes.
ACTIVE INGREDIENTCONCENTRATION% MORTALITY AFTER 24 HRS
PERILLALDEHYDE2%13
DINOTEFURAN0.008 μg77
OBS.*CALC.**
PERILLALDEHYDE + DINOTEFURAN2% + 0.008 μg100‡79.99
*Obs. = observed efficacy
**Calc. = efficacy calculated using Colby (1967) formula
‡Since the actual insecticidal kill rate exceeds the calculated value, then the action of the combination is super-additive or a synergistic effect is present.

US11856957B2. Insecticidal compositions and methods of using the same (2024-01-02). CLARKE MOSQUITO CONTROL PRODUCTS, INC. [US]. Inventors: Michael Dean Willis [US], Marie Elizabeth Saunders [US], Darryl Ramoutar [US], Joanna Maria Tyszko [US], Frances Nita Krenick [US], Andrea Rohrbacher [US].
Full text: Click here
Patent 2024
Acetone Adult Culex Culicidae dinotefuran Females Insecticides perillaldehyde
2
Perilla Leaf Oil Efficacy Against Culex
Not available on PMC !

Example 3

Perilla leaf oil at concentrations of 1%, 5%, and 10% was tested for efficacy against 1- to 2-day old adult Culex quinquefasciatus. At 1 hour we obtained 17%, 100%, and 100% knockdown, respectively. At 24 hours we obtained 10%, 100%, and 100% mortality, respectively. The CO2 control had 0% knockdown at 1 hour, and 0% mortality at 24 hours. The acetone standard had 17% knockdown at 1 hour, and 20% mean mortality at 24 hours. These data suggest that perilla leaf oil exposure by contact leads to Culex quinquefasciatus mortality.

US11856957B2. Insecticidal compositions and methods of using the same (2024-01-02). CLARKE MOSQUITO CONTROL PRODUCTS, INC. [US]. Inventors: Michael Dean Willis [US], Marie Elizabeth Saunders [US], Darryl Ramoutar [US], Joanna Maria Tyszko [US], Frances Nita Krenick [US], Andrea Rohrbacher [US].
Full text: Click here
Patent 2024
Acetone Adult Culex Insecticides perilla seed oil Plant Leaves
3
Perilla oil against Aedes and Culex
Not available on PMC !

Example 2

Perilla leaf oil was tested for efficacy against 3- to 5-day old adult Aedes aegypti. Solutions tested included Perilla oil at 1%, 2%, 4%, 6%, 8%, and 10%. At 1 hour we obtained 0%, 37%, 97%, 93%, 100%, and 100% knockdown, respectively. At 24 hours we obtained 0%, 20%, 83%, 93%, 100%, and 100% mortality, respectively. The CO2 control and acetone standard both had 0% knockdown at 1 hour, and 0% mortality at 24 hours. These data suggest that perilla leaf oil exposure by contact leads to Aedes aegypti mortality.

Example 14

In support of example 2, Solution 1 (0.008 μg/mosquito of dinotefuran) and Solution 2 (0.008 μg/mosquito of dinotefuran with 2% of perillaldehyde) were tested for efficacy against 3- to 5-day old adult Culex quinquefasciatus. At 1 hour we obtained 10% and 90% knockdown for Solution 1 and 2, respectively. At 24 hours we obtained 73% and 90% mortality for Solution 1 and 2, respectively. The CO2 control and acetone standard both had 0% knockdown at 1 hour, and 0% mortality at 24 hours.

US11856957B2. Insecticidal compositions and methods of using the same (2024-01-02). CLARKE MOSQUITO CONTROL PRODUCTS, INC. [US]. Inventors: Michael Dean Willis [US], Marie Elizabeth Saunders [US], Darryl Ramoutar [US], Joanna Maria Tyszko [US], Frances Nita Krenick [US], Andrea Rohrbacher [US].
Full text: Click here
Patent 2024
Acetone Adult Aedes Culex Culicidae dinotefuran Insecticides perillaldehyde perilla seed oil Plant Leaves
4
Synergistic Mosquito Control with Perillaldehyde and Pyrethrin
Not available on PMC !

Example 28

We tested pyrethrin+perillaldehyde for efficacy against 3- to 5-day old adult Culex quinquefasciatus. For the concentration, 2% of perillaldehyde, and 0.001 μg/mosquito of pyrethrin, and 0.001 μg/mosquito of pyrethrin with 2% of perillaldehyde, at 1 hour we obtained 33%, 10%, and 80% knockdown respectively. At 24 hours we obtained 13%, 7%, and 33% mean mortality respectively. The CO2 control and acetone standard both had 0% knockdown at 1 hour, and 0% mean mortality at 24 hours. Results are shown in Table 18.

TABLE 18
Efficacy of perillaldehyde, pyrethrin, and a combination of both
against adult, virgin, female Culex quinquefasciatus mosquitoes.
% MORTALITY
ACTIVE INGREDIENTCONCENTRATIONAFTER 24 HRS
PERILLALDEHYDE3%13
PYRETHRIN0.001 μg7
OBS.*CALC.**
PERILLALDEHYDE + 3% + 0.001 μg33‡19.09
PYRETHRIN
*Obs. = observed efficacy
**Calc. = efficacy calculated using Colby (1967) formula
‡Since the actual insecticidal kill rate exceeds the calculated value, then the action of the combination is super-additive or a synergistic effect is present.

US11856957B2. Insecticidal compositions and methods of using the same (2024-01-02). CLARKE MOSQUITO CONTROL PRODUCTS, INC. [US]. Inventors: Michael Dean Willis [US], Marie Elizabeth Saunders [US], Darryl Ramoutar [US], Joanna Maria Tyszko [US], Frances Nita Krenick [US], Andrea Rohrbacher [US].
Full text: Click here
Patent 2024
Acetone Adult Culex Culicidae Females Insecticides perillaldehyde Pyrethrins
5
Rapid Mosquito Control with Dinotefuran and Perillaldehyde
Not available on PMC !

Example 15

In support of examples 2 and 3, Solution 1 (0.008 μg/mosquito of dinotefuran with 3% of perillaldehyde) was tested for efficacy against 4- to 6-day old adult Culex quinquefasciatus. At 1 hour we obtained 100% knockdown; and at 24 hours we obtained 100% mortality. The CO2 control and acetone standard both had 0% knockdown at 1 hour, and 0% mortality at 24 hours.

US11856957B2. Insecticidal compositions and methods of using the same (2024-01-02). CLARKE MOSQUITO CONTROL PRODUCTS, INC. [US]. Inventors: Michael Dean Willis [US], Marie Elizabeth Saunders [US], Darryl Ramoutar [US], Joanna Maria Tyszko [US], Frances Nita Krenick [US], Andrea Rohrbacher [US].
Full text: Click here
Patent 2024
Acetone Adult Culex Culicidae dinotefuran Insecticides perillaldehyde

Top products related to «Culex»

1
Qiaamp viral rna mini kit by Qiagen
Sourced in Germany, United States, United Kingdom, France, Spain, Japan, China, Netherlands, Italy, Australia, Canada, Switzerland, Belgium
The QIAamp Viral RNA Mini Kit is a laboratory equipment designed for the extraction and purification of viral RNA from various sample types. It utilizes a silica-based membrane technology to efficiently capture and isolate viral RNA, which can then be used for downstream applications such as RT-PCR analysis.
2
Rnalater by Thermo Fisher Scientific
Sourced in United States, United Kingdom, Germany, Japan, Lithuania, Italy, Australia, Canada, Denmark, China, New Zealand, Spain, Belgium, France, Sweden, Switzerland, Brazil, Austria, Ireland, India, Netherlands, Portugal, Jamaica
RNAlater is a RNA stabilization solution developed by Thermo Fisher Scientific. It is designed to protect RNA from degradation during sample collection, storage, and transportation. RNAlater stabilizes the RNA in tissues and cells, allowing for efficient RNA extraction and analysis.
3
Schneider s drosophila medium by Thermo Fisher Scientific
Sourced in United States, United Kingdom, France, China
Schneider's Drosophila medium is a specialized cell culture medium designed for the growth and maintenance of Drosophila cell lines. It provides the essential nutrients and growth factors required for the optimal cultivation of these insect-derived cells.
4
Dneasy blood tissue kit by Qiagen
Sourced in Germany, United States, United Kingdom, Netherlands, Spain, Japan, China, Canada, France, Australia, Switzerland, Italy, Belgium, Denmark, Sweden
The DNeasy Blood & Tissue Kit is a DNA extraction and purification kit designed for the efficient isolation of high-quality genomic DNA from a variety of sample types, including whole blood, tissue, and cultured cells. The kit utilizes a silica-based membrane technology to capture and purify DNA, providing a reliable and consistent method for DNA extraction.
5
Bhk 21 cells by American Type Culture Collection
Sourced in United States, Germany
BHK-21 cells are a continuous cell line derived from baby hamster kidney cells. They are widely used in various research applications, including virus propagation, vaccine production, and cytotoxicity studies.
6
Sz stereomicroscope by Olympus
Sourced in Japan
The SZ stereomicroscope is an optical instrument designed for high-resolution observation and analysis of samples. It provides a three-dimensional, magnified view of the specimen, allowing users to examine fine details and structures. The SZ stereomicroscope is a versatile tool suitable for a wide range of applications, including scientific research, industrial inspection, and educational purposes.
7
Crl 1660 by American Type Culture Collection
Sourced in United States
CRL-1660 is a cell line derived from a human breast adenocarcinoma. It is a commonly used model in cancer research.
8
M165 fc stereomicroscope by Leica
Sourced in Germany, United States
The Leica M165 FC stereomicroscope is a high-performance, versatile imaging instrument. It provides a magnification range of 7.8x to 160x, enabling detailed observation and analysis of a wide variety of specimens. The M165 FC features a fully apochromatic optical system, ensuring accurate color reproduction and high-resolution imaging. Its ergonomic design and intuitive controls make it a reliable tool for various laboratory applications.
9
Rneasy kit by Qiagen
Sourced in Germany, United States, United Kingdom, Spain, Netherlands, Canada, France, Japan, China, Italy, Switzerland, Australia, Sweden, India, Singapore, Denmark, Belgium
The RNeasy kit is a laboratory equipment product that is designed for the extraction and purification of ribonucleic acid (RNA) from various biological samples. It utilizes a silica-membrane-based technology to efficiently capture and isolate RNA molecules.
10
Nanodrop 2000 spectrophotometer by Thermo Fisher Scientific
Sourced in United States, Germany, China, United Kingdom, Japan, Canada, France, Italy, Australia, Spain, Denmark, Switzerland, Singapore, Poland, Ireland, Belgium, Netherlands, Lithuania, Austria, Brazil
The NanoDrop 2000 spectrophotometer is an instrument designed to measure the concentration and purity of a wide range of biomolecular samples, including nucleic acids and proteins. It utilizes a unique sample retention system that requires only 1-2 microliters of sample to perform the analysis.

More about "Culex"

Culex mosquitoes, also known as 'house mosquitoes' or 'common house mosquitoes', belong to a genus of mosquitoes that are widely distributed across tropical and temperate regions worldwide.
These mosquitoes are notorious vectors for transmitting various pathogens to humans and animals, including the causative agents of filariasis, Japanese encephalitis, West Nile virus, and other arboviral infections.
Researchers studying Culex mosquitoes often utilize specialized tools and techniques to optimize their research protocols and enhance reproducibility.
The QIAamp Viral RNA Mini Kit, for example, is a commonly used method for extracting high-quality viral RNA from Culex samples.
RNAlater, a RNA stabilization reagent, can help preserve RNA integrity during sample collection and storage.
Schneider's Drosophila medium is a popular cell culture medium used for maintaining Culex-derived cell lines, such as the BHK-21 cell line.
For DNA-based analyses, the DNeasy Blood & Tissue Kit is a reliable tool for extracting genomic DNA from Culex mosquitoes.
Microscopic examinations of Culex specimens are often carried out using specialized equipment like the SZ stereomicroscope or the M165 FC stereomicroscope.
The CRL-1660 cell line, derived from Culex quinquefasciatus mosquitoes, is a valuable resource for in vitro studies.
To quantify nucleic acid yields and assess purity, researchers may utilize instruments like the NanoDrop 2000 spectrophotometer.
The RNeasy kit is another popular option for isolating high-quality RNA from Culex samples.
By leveraging the AI-driven platform of PubCompare.ai, researchers studying Culex mosquitoes can optimize their research protocols, easily locate relevant literature, and identify the best products and procedures to enhance the reproducibility and efficiency of their work.
This comprehensive approach can contribute to a deeper understanding of these medically important vectors and the diseases they transmit.