> Living Beings > Eukaryote > Spodoptera frugiperda

Spodoptera frugiperda

Q: What is Spodoptera frugiperda?

Spodoptera frugiperda, commonly known as the fall armyworm, is a major agricultural pest that affects a wide range of crops worldwide. This noctuid moth species has larvae that can cause significant damage to important food crops like maize, sorghum, and rice.

Q: What are the common challenges in studying Spodoptera frugiperda?

Researchers studying Spodoptera frugiperda often face the challenge of sifting through a large volume of literature to identify the latest and most effective protocols. This can be time-consuming and inefficient, which is where PubCompare.ai can help streamline the process.

Q: What are the different variations or types of Spodoptera frugiperda?

Spodoptera frugiperda, or the fall armyworm, is a single species of moth. However, there are different strains or populations of this pest that can vary in their host plant preferences and geographic distribution. Reserchers may need to consider these varations when selecting protocols for their Spodoptera frugiperda studies.

Spodoptera frugiperda, known as the fall armyworm, is a major agricultural pest that affects a wide range of crops worldwide.
This insect species is a noctuid moth whose larvae can cause significant damage to maize, sorghum, rice, and other important food crops.
Researchers studying Spodoptera frugiperda can streamline their efforts with PubCompare.ai's powerful AI-driven protocol comparison tools.
These tools help locate the latest protocols from literature, preprints, and patents, and provide intelligent comparisons to identify the optimal protocols and products for your research needs.
Improve the effeciency of your Spodoptera frugiperda studies with PubCompare.ai's intuitive platform.

Most cited protocols related to «Spodoptera frugiperda»

Structural Determination of Kappa Opioid Receptor

Cited 45 times

hKOR-T4L was expressed in Spodoptera frugiperda (Sf9) cells. Ligand-binding and functional assays were performed as described in Methods. Sf9 cells were solubilized using 1% (w/v) n-dodecyl-β-D-maltopyranoside (DDM) and 0.2% (w/v) cholesteryl hemisuccinate (CHS), and purified by immobilized metal ion affinity chromatography (IMAC), followed by reverse IMAC after cleaving N-terminal FLAG-10xHis tags by His-tagged Tobacco Etch Virus (TEV) protease. The purified protein was mixed with monoolein and cholesterol in a ratio of 40%:54%:6% (w/w) to form lipidic cubic phase (LCP) from which the receptor was crystallized. Crystals were grown at 20 °C in 45 nl protein-laden LCP boluses overlaid by 800 nl of precipitant solutions as described in Methods. Crystals were harvested from the LCP matrix and flash frozen in liquid nitrogen. X-ray diffraction data were collected on the 23ID-B/D beamline (GM/CA CAT) at the Advanced Photon Source, Argonne, IL using a 10 μm minibeam at wavelength of 1.0330 Å. Data collection, processing, structure solution and refinement are described in Methods. Modeling of JDTic analogues and hKOR-selective morphine derivatives nor-BNI and GNTI was performed using ICM-Pro; SYBYL-X 1.3 and GOLD Suite 5.1 were used to model RB-64 complexes, as described in Methods.
Full Methods and any associated references are available in the online version of the paper at www.nature.com/nature.

Wu H., Wacker D., Katritch V., Mileni M., Han G.W., Vardy E., Liu W., Thompson A.A., Huang X.P., Carroll F.I., Mascarella S.W., Westkaemper R.B., Mosier P.D., Roth B.L., Cherezov V, & Stevens R.C. (2012). Structure of the human kappa opioid receptor in complex with JDTic. Nature, 485(7398), 327-332.

Publication 2012

Biological Assay Cholesterol cholesterol-hemisuccinate Chromatography, Affinity Cuboid Bone Freezing Gold Ligands Lipids Metals monoolein Morphines Nitrogen Protein C Proteins RB-64 Sf9 Cells Spodoptera frugiperda TEV protease X-Ray Diffraction

Structural Determination of BRIL-NOP Receptor

Cited 15 times

BRIL-NOP was expressed in Spodoptera frugiperda (Sf9) insect cells. Ligand binding asays were performed as described in Methods online. Sf9 membranes were solubilized using 0.5% n-dodecyl-β-D-maltopyranoside (w/v) and 0.1% cholesteryl hemisuccinate (w/v), and purified by immobilized metal ion affinity chromatography (IMAC). Receptor crystallization was performed by the lipidic cubic phase (LCP) method. The protein-LCP mixture contained 40% (w/w) concentrated receptor solution, 54% (w/w) monoolein, and 6% (w/w) cholesterol. Crystals were grown in 40 nL protein-laden LCP bolus overlaid by 0.8 μL of precipitant solution (25–30% (v/v) PEG 400, 100–200 mM potassium sodium tartrate tetrahydrate, 100 mM BIS-TRIS propane [pH 6.4]) at 20 °C. Crystals were harvested directly from LCP matrix and flash frozen in liquid nitrogen. X-ray diffraction data were collected at 100 K on the 23ID-B/D beamline (GM/CA CAT) of the Advanced Photon Source at the Argonne National Laboratory using a 10 μm collimated minibeam. Diffraction data from 23 crystals were merged for the final dataset. Data collection, processing, structure solution and refinement are described in Methods online.
Full Methods and any associated references are available in the online version of the paper at (web).

Thompson A.A., Liu W., Chun E., Katritch V., Wu H., Vardy E., Huang X.P., Trapella C., Guerrini R., Calo G., Roth B.L., Cherezov V, & Stevens R.C. (2012). Structure of the Nociceptin/Orphanin FQ Receptor in Complex with a Peptide Mimetic. Nature, 485(7398), 395-399.

Publication 2012

1,3-bis(tris(hydroxymethyl)methylamino)propane Cells Cholesterol cholesterol-hemisuccinate Chromatography, Affinity Crystallization Cuboid Bone Freezing Insecta Ligands Lipids Metals monoolein Nitrogen polyethylene glycol 400 Proteins sodium potassium tartrate Spodoptera frugiperda Tissue, Membrane X-Ray Diffraction

Culturing Insect Cell Lines for VLP Production

Cited 9 times

Spodoptera frugiperda Sf9 cells (ATCC# CRL-1711) were maintained as adherent cultures in Roux flasks in modified IPL-41 media (supplemented with lipid mixture (Sigma, St. Louis, USA) and Yeast Extract (Sigma)) containing 3% FCS at 27°C [21 (link)]. Sf9 cells dedicated to VLP production were cultivated in the same media in suspension in 500-ml shaker flasks at 100 rpm. Trichoplusia ni BTI-TN5B1-4 cells (ATCC# CRL-10859) were maintained in shaker flasks in serum-free modified IPL-41 medium at 27°C shaking at 100 rpm [21 (link)]. Influenza strains A/Puerto Rico/8/1934 (H1N1) and A/Hiroshima/52/2005 (H3N2) were grown on Vero cells (ATCC# CCL-81) in Dulbecco’s modified Eagles medium/Hams F12 medium.

Krammer F., Schinko T., Palmberger D., Tauer C., Messner P, & Grabherr R. (2010). Trichoplusia ni cells (High Five™) are highly efficient for the production of influenza A virus-like particles: a comparison of two insect cell lines as production platforms for influenza vaccines. Molecular biotechnology, 45(3), 226-234.

Publication 2010

ATF7IP protein, human Cells Eagle Lipids Serum Sf9 Cells Spodoptera frugiperda Strains Vero Cells Virus Vaccine, Influenza Yeast, Dried

Crystallization of Thermostabilized 5-HT2A Receptor

Cited 8 times

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2020

Chromatography Chromatography, Affinity Cloning Vectors Cryoelectron Microscopy Crystallization Hemagglutinin Histidine Homo sapiens HTR2A protein, human Metals Peptide Hydrolases Point Mutation Protoplasm Sf9 Cells Signal Peptides Spodoptera frugiperda TEV protease

Spodoptera frugiperda Genomic Resources

Cited 8 times

The SfruDB Information system is available through the web portal: http://bipaa.genouest.org/is/lepidodb/spodoptera_frugiperda/. The WGS reads, the two corn and rice reference genome assemblies and their gene annotation have been submitted to the EBI under the number PRJEB13110 and PRJEB13834.

Gouin A., Bretaudeau A., Nam K., Gimenez S., Aury J.M., Duvic B., Hilliou F., Durand N., Montagné N., Darboux I., Kuwar S., Chertemps T., Siaussat D., Bretschneider A., Moné Y., Ahn S.J., Hänniger S., Grenet A.S., Neunemann D., Maumus F., Luyten I., Labadie K., Xu W., Koutroumpa F., Escoubas J.M., Llopis A., Maïbèche-Coisne M., Salasc F., Tomar A., Anderson A.R., Khan S.A., Dumas P., Orsucci M., Guy J., Belser C., Alberti A., Noel B., Couloux A., Mercier J., Nidelet S., Dubois E., Liu N.Y., Boulogne I., Mirabeau O., Le Goff G., Gordon K., Oakeshott J., Consoli F.L., Volkoff A.N., Fescemyer H.W., Marden J.H., Luthe D.S., Herrero S., Heckel D.G., Wincker P., Kergoat G.J., Amselem J., Quesneville H., Groot A.T., Jacquin-Joly E., Nègre N., Lemaitre C., Legeai F., d’Alençon E, & Fournier P. (2017). Two genomes of highly polyphagous lepidopteran pests (Spodoptera frugiperda, Noctuidae) with different host-plant ranges. Scientific Reports, 7, 11816.

Full text: Click here

Publication 2017

Gene Annotation Genome Maize Oryza sativa Spodoptera frugiperda

Most recents protocols related to «Spodoptera frugiperda»

Baculovirus-Mediated Expression of IgT

The full-length IgT gene of ASB was amplified with primers IgT NotI F and IgT XhoI R (Table S1) and inserted into pFastBac HT A transfer vector. The construct was integrated into the baculovirus genome with DH10BAC™ and the Bac-To-Bac system (Invitrogen). The bacmid DNA with IgT gene was purified for transfection into Spodoptera frugiperda (Sf9 III) cells (ATCC) for producing recombinant baculovirus (Bac-IgT). The Sf9 III cells were grown at 27°C in serum-free medium SF-900 III (Invitrogen). Procedures for the generation of recombinant baculovirus were carried out according to the manufacturer’s instructions (Invitrogen). Briefly, 1.2 X 10⁶ Sf9 III cells were plated onto 6-well plates for 1 h. After attachment, 4 µg of recombinant bacmid DNA Bac-IgT and 10 µl Cellfectin II (Invitrogen) were diluted with culture medium and used for transfection of Sf9 III cells. Transfection was performed for 5 h at 27°C with the replacement of fresh SF-900 III medium after incubation. Transfected cells were kept at 27°C for 72 h. Following incubation, the supernatant containing recombinant viruses (Bac-IgT) was utilized for infection of fresh Sf9 III cells. For large scale viral production, Sf9 III cells were infected in suspension cultures of 2×10⁶ cells/ml with the collection of supernatant four days post-infection.

Chan J., Carmen L.C., Lee S.Q, & Prabakaran M. (2023). Identification and characterization of immunoglobulin tau (IgT) in Asian Seabass (Lates calcarifer) and mucosal immune response to nervous necrosis virus. Frontiers in Immunology, 14, 1146387.

Full text: Click here

Publication 2023

Baculoviridae Cell Culture Techniques Cells Cloning Vectors Genes Genome Infection Oligonucleotide Primers Recombinant DNA Serum Sf9 Cells Spodoptera frugiperda Transfection Virus

Recombinant IL-2 Protein Expression and Purification

The human wild-type IL-2 (IL-2: APTSSSTKKTQLQLEHLLLDLQMILNGINNYKNPKLTRMLTFKFYMPKKATELKHLQCLEEELKPLEEVLNLAQSKNFHLRPRDLISNINVIVLELKGSETTFMCEYADETATIVEFLNRWITFCQSIISTLTGGGGSDSLEFIASKLAGSLPETGGSHHHHHHHHHH) and IL-2 variant (sum IL-2: APTSSSTKKTQLQLEHLLLDLQMILNGINNYKNPKLTRMLTAKFYMPKKATELKHLQCLEEELKPLEEVLNLAQSKNFHFDPRDVVSNINVFVLELKGSETTFMCEYADETATIVEFLNRWITFCQSIISTLTGGGGSDSLEFIASKLAGSLPETGGSHHHHHHHHHH) with LPETG-tag and histidine tag (His-tag) were expressed and purified from Spodoptera frugiperda (Sf9) cells (insect cells), as previously described.18 (link) Briefly, Sf9 cells were used to generate high-titer recombinant virus expressing the recombinant protein and were cultured at 28°C using SF900 II SFM medium (Invitrogen). Full-length IL-2 (residues 1–133) with a C-terminal histidine tag was cloned into the pFastbac1 vector. After expression, the proteins were purified by Ni column (Cytiva), concentrated using Centricon (Millipore) spin concentrators and purified with an HPLC Superdex-75 sizing column (Increase 10/300 GL, GE Healthcare Life Science).
The detail information of bioassay of sum IL-2 was shown in online supplemental material.

Gao Y., Luo Q., Sun Z., Gao H., Yu Y., Sun Y., Ma X., Han C., Shi J, & Wang F. (2023). Implication of 99mTc-sum IL-2 SPECT/CT in immunotherapy by imaging of tumor-infiltrating T cells. Journal for Immunotherapy of Cancer, 11(3), e005925.

Publication 2023

Biological Assay Cells Cloning Vectors High-Performance Liquid Chromatographies Histidine Homo sapiens Insecta Proteins Recombinant Proteins Sf9 Cells Spodoptera frugiperda Virus

Hexa-Pro SARS-CoV-2 Spike Protein Expression

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2023

Ala-Trp-Arg-His-Pro-Gln-Phe-Gly-Gly Baculoviridae Buffers Cloning Vectors Cytokinesis Dithiothreitol DNA, Complementary EMP1 protein, human FURIN protein, human Hexosaminidase A imidazole Molecular Sieve Chromatography Mutagenesis, Site-Directed Peptide Hydrolases Sf9 Cells Sodium Chloride spike protein, SARS-CoV-2 Spodoptera frugiperda Tromethamine tyrosyl-alanyl-glycine

Immortalized Mouse Fibroblast Generation

Immortalised mouse fibroblasts were generated from primary C57BL/6 and BALB/c MEF by crisis immortalisation (Rattay et al, 2015 (link)). NIH3T3‐ISREluc:IFNLR cells were described in (Le‐Trilling et al, 2018 (link)). Mouse fibroblasts, REF and HEK293T (ATCC CRL‐11268, female) cells were grown in Dulbecco's minimal essential medium (DMEM) supplemented with 10% (v/v) foetal calf serum (FCS), penicillin, streptomycin and 2 mM glutamine at 37°C in 5% CO₂. Sf9 cells (originally derived from the ovaries of Spodoptera frugiperda) were cultivated in Insect‐XPRESS™ medium at 28°C in a shaker incubator (180 rpm; Table EV3).

Le‐Trilling V.T., Banchenko S., Paydar D., Leipe P.M., Binting L., Lauer S., Graziadei A., Klingen R., Gotthold C., Bürger J., Bracht T., Sitek B., Jan Lebbink R., Malyshkina A., Mielke T., Rappsilber J., Spahn C.M., Voigt S., Trilling M, & Schwefel D. (2023). Structural mechanism of CRL4‐instructed STAT2 degradation via a novel cytomegaloviral DCAF receptor. The EMBO Journal, 42(5), e112351.

Publication 2023

Cells Females Fetal Bovine Serum Fibroblasts Glutamine Insecta Mus NIH 3T3 Cells Ovary Penicillins Sf9 Cells Spodoptera frugiperda Streptomycin

Generation and Validation of Mammalian Cell Lines

Human cancer-derived cell lines: SkBr3 (ATCC HTB-30), HeLa (ECACC 93021013) and U2OS (ECACC 92022711) cells were grown in DMEM-GlutaMAX (Thermo Fisher Scientific 31966021) supplemented with 10% FBS, SkOv3 (ATCC HTB-770) cells were cultured in McCoy’s 5 A modified medium (Thermo Fisher Scientific 16600082) supplemented with 10% FBS, and MCF7 (ATCC HTB-22) cells were grown in MEM (Thermo Fisher Scientific 41090028) containing 1× non-essential amino acids (Thermo Fisher Scientific 11140035) and 10% FBS. Chinese hamster ovary (CHO-K1) cells (ATCC CCL-61) were cultured in DMEM-GlutaMAX (Thermo Fisher Scientific 31966021) supplemented with, 10% FBS, and 0.3 mM proline (Merck 81709). Transduced CHO, HeLa and U2OS cells stably expressing HER2 full-length and HER2_ΔCT were cultured in the presence of 5 μg/ml blasticidin (Thermo Fisher Scientific A1113903). All mammalian cell lines were maintained at 37 °C in a 5% CO₂ environment. SkBr3 and U2OS VAV1-3 knockout (KO) cells were generated by transfection of cells with in vitro assembled ribonucleoprotein complexes (Synthego) using a Neon Electroporation system (Thermo Fisher Scientific MPK5000) according to the manufacturer’s instructions. Guide RNAs were mixed at an equimolar ratio and assembled with Cas9 protein at 3:1 RNA:Cas9 ratio. Synthetic-modified guide RNA targeting sequences were as follows:
VAV1: UUCUAAUGUUCUUAAGGCAC, CUCACAGCAGGUGGACAGGA;
VAV2: AUCGUGGCAGACUUUCAGGA, GCCACGAUAAAUUUGGAUUA;
VAV3: UGUGUUUAUGGGGAAGAUGA, AUCUUCUUCAUCUUCCACAA.
Single-cell clones were obtained by seeding cells onto 96-well plates 72 h post transfection by limiting dilution (one cell per well). Cell growth was monitored using an Incucyte imaging system (Sartorius) and verified single-cell clones propagated. VAV1-3 triple KO clones were identified by sequencing of genomic loci targeted by gRNAs. Sanger sequencing files were analyses using the Inference of CRISPR Edits (ICE) tool from ice.synthego.com. VAV2 KO was further confirmed by immunoblot analysis.
Spodoptera frugiperda (Sf9) cells (Thermo Fisher Scientific 11496015) were grown as suspension cultures in Insect-XPRESS medium (Lonza BE12-730Q) at 28 °C.
All cell lines were routinely screened for mycoplasma contamination.

Paul D., Stern O., Vallis Y., Dhillon J., Buchanan A, & McMahon H. (2023). Cell surface protein aggregation triggers endocytosis to maintain plasma membrane proteostasis. Nature Communications, 14, 947.

Full text: Click here

Publication 2023

Amino Acids, Essential Cell Lines Cells Chinese Hamster Clone Cells Clustered Regularly Interspaced Short Palindromic Repeats CRISPR-Associated Protein 9 Electroporation ERBB2 protein, human Genome HeLa Cells Homo sapiens Immunoblotting Insecta Malignant Neoplasms Mammals MCF-7 Cells Mycoplasma Neon Ovary Proline Ribonucleoproteins RNA Sequence Sf9 Cells Spodoptera frugiperda Technique, Dilution Transfection VAV1 protein, human VAV3 protein, human

Top products related to «Spodoptera frugiperda»

Fetal bovine serum (fbs) by Thermo Fisher Scientific

Sourced in United States, China, United Kingdom, Germany, Australia, Japan, Canada, Italy, France, Switzerland, New Zealand, Brazil, Belgium, India, Spain, Israel, Austria, Poland, Ireland, Sweden, Macao, Netherlands, Denmark, Cameroon, Singapore, Portugal, Argentina, Holy See (Vatican City State), Morocco, Uruguay, Mexico, Thailand, Sao Tome and Principe, Hungary, Panama, Hong Kong, Norway, United Arab Emirates, Czechia, Russian Federation, Chile, Moldova, Republic of, Gabon, Palestine, State of, Saudi Arabia, Senegal

Fetal Bovine Serum (FBS) is a cell culture supplement derived from the blood of bovine fetuses. FBS provides a source of proteins, growth factors, and other components that support the growth and maintenance of various cell types in in vitro cell culture applications.

Bac to bac baculovirus expression system by Thermo Fisher Scientific

Sourced in United States, Germany

The Bac-to-Bac baculovirus expression system is a tool used for the production of recombinant proteins in insect cells. It enables the cloning of a gene of interest into a transfer vector, which is then used to generate recombinant baculoviruses that can infect insect cells and express the target protein.

Sf900ii medium by Thermo Fisher Scientific

Sourced in United States

The SF900II medium is a serum-free, protein-free insect cell culture medium developed by Thermo Fisher Scientific. It is designed to support the growth and maintenance of insect cells in suspension culture, providing a chemically defined and animal-free environment for cell culture applications.

Sf 900 2 sfm medium by Thermo Fisher Scientific

Sourced in United States, Germany, United Kingdom

Sf-900 II SFM medium is a serum-free medium designed for the growth and maintenance of insect cells in suspension culture. It is a proprietary formulation that provides a chemically defined, protein-free, and low-lipid environment to support the optimal growth and productivity of insect cell lines.

Bac to bac system by Thermo Fisher Scientific

Sourced in United States, United Kingdom, Poland, France

The Bac-to-Bac system is a tool for generating recombinant baculoviruses, which are commonly used to express proteins in insect cell lines. The system provides a efficient way to generate recombinant baculoviruses by using site-specific transposition to insert a gene of interest into a baculovirus shuttle vector, which is then used to transfect insect cells and produce the recombinant virus.

Spodoptera frugiperda sf9 cells by Thermo Fisher Scientific

Sourced in United States

Spodoptera frugiperda (Sf9) cells are a commonly used insect cell line derived from the ovarian cells of the fall armyworm, Spodoptera frugiperda. These cells are primarily used as a host for the expression of recombinant proteins in baculovirus expression systems.

Cellfectin 2 reagent by Thermo Fisher Scientific

Sourced in United States, Canada, China

Cellfectin II reagent is a cationic lipid-based transfection reagent designed for efficient delivery of nucleic acids into a variety of mammalian cell types. It is used for the introduction of DNA, RNA, or other macromolecules into cells in culture.

Dulbecco modified eagle medium (dmem) by Thermo Fisher Scientific

Sourced in United States, China, United Kingdom, Germany, France, Australia, Canada, Japan, Italy, Switzerland, Belgium, Austria, Spain, Israel, New Zealand, Ireland, Denmark, India, Poland, Sweden, Argentina, Netherlands, Brazil, Macao, Singapore, Sao Tome and Principe, Cameroon, Hong Kong, Portugal, Morocco, Hungary, Finland, Puerto Rico, Holy See (Vatican City State), Gabon, Bulgaria, Norway, Jamaica

DMEM (Dulbecco's Modified Eagle's Medium) is a cell culture medium formulated to support the growth and maintenance of a variety of cell types, including mammalian cells. It provides essential nutrients, amino acids, vitamins, and other components necessary for cell proliferation and survival in an in vitro environment.

Grace s insect medium by Thermo Fisher Scientific

Sourced in United States, Japan, Canada

Grace's insect medium is a cell culture medium designed for the growth and maintenance of insect cell lines. It is a complex mixture of amino acids, vitamins, salts, and other nutrients required for the optimal growth of insect cells in vitro. The medium is formulated to support the specific nutritional requirements of insect cell cultures.

Sf 900 2 sfm by Thermo Fisher Scientific

Sourced in United States

The Sf-900 II SFM is a serum-free medium designed for the efficient growth and maintenance of insect cell lines. It provides a defined, chemically-based formulation that supports the cultivation of a variety of insect cell types. The Sf-900 II SFM is a complete medium that does not require the addition of any other supplements.

What is Spodoptera frugiperda?

What are the common challenges in studying Spodoptera frugiperda?

How can PubCompare.ai assist with Spodoptera frugiperda research?

PubCompare.ai's powerful AI-driven protocol comparison tools can help researchers studying Spodoptera frugiperda in several ways. The platform allows you to efficiently screen protocol literature, leveraging AI to pinpoint critical insights. This enables you to identify the most effective protocols related to Spodoptera frugiperda for your specific research goals. The platform's analysis can highlight key differences in protocol effectiveness, helping you choose the best option for reproducibility and accuracy.

What are the different variations or types of Spodoptera frugiperda?

What are some specific applications of Spodoptera frugiperda research?

Spodoptera frugiperda research is crucial for developing effective pest management strategies to protect important food crops like maize, sorghum, and rice. Findings from Spodoptera frugiperda studies can lead to the development of new insecticides, biopesticides, or other control measures to mitigate the damage caused by this invasive pest. PubCompare.ai can help researchers identify the most relevant and impactful protocols for their Spodoptera frugiperda applications.

More about "Spodoptera frugiperda"

Spodoptera frugiperda, also known as the fall armyworm, is a major agricultural pest that affects a wide range of important food crops worldwide, including maize, sorghum, rice, and others.
This noctuid moth species has larvae that can cause significant damage to these vital crops.
Researchers studying this pest can streamline their efforts by utilizing powerful AI-driven protocol comparison tools, such as those offered by PubCompare.ai.
These advanced tools help researchers easily locate the latest protocols from literature, preprints, and patents, and provide intelligent comparisons to identify the optimal protocols and products for their specific research needs.
This can greatly improve the efficiency and efficacy of Spodoptera frugiperda studies.
Releated terms and technologies that can enhance Spodoptera frugiperda research include the Bac-to-Bac baculovirus expression system, which uses Spodoptera frugiperda (Sf9) cells grown in SF900II or Sf-900 II SFM medium, as well as the Cellfectin II reagent for transfection.
Researchers may also utilize DMEM or Grace's insect medium for culturing and maintaining Sf9 cell lines.
By leveraging these tools and technologies, scientists can maximize the impact of their Spodoptera frugiperda studies and drive advancements in this critical area of agricultural research.