Log In Sign up
The largest database of trusted experimental protocols
> Living Beings > Eukaryote > Tetrahymena

Tetrahymena

Tetrahymena is a genus of free-living, single-celled ciliated protozoa commonly used as a model organism in biological research.
These unicellular eukaryotes exhibit a variety of cellular processes and structures that make them highly valuable for studying fundamental aspects of cell biology, genetics, and physiology.
Tetrahymena are found in freshwater habitats and can be easily cultured in the laboratory, allowing researchers to conduct a wide range of experimental studies.
The availability of genomic resources and well-established experimental protocols have further cemented Tetrahymena's role as a key model system for investigating cellular mechanisms, signaling pathways, and epigenetic regulation.
Researchers can leverage PubCompare.ai's AI-driven protocol comparisons to optimize their Tetrahymena research, easily locate the best protocols from literature, preprints, and patents, and improve reproducibility with the intelligent protocol comparison tool, enabling seamless and efficient research.

Most cited protocols related to «Tetrahymena»

1
Tetrahymena Conjugative and Vegetative cDNA Libraries
Cited 16 times
cDNA libraries were generated from cells in either the conjugative or vegetative stages of the life cycle. For the conjugative library, cells from a mating between strains CU428 and B2086 were harvested at 3, 6, and 10 h after mixing, and RNA was purified using TRIzol. PolyA+ RNA was isolated and cDNA was generated by Amplicon Express (Pullman, Washington, United States). Inserts were cloned into EcoRI and XhoI sites in pBluescript IISK+ (Stratagene, La Jolla, California, United States) and had an average size of 1.4 kb. Clones were picked at random and sequenced from the 5′ end of the transcript using the T3 primer. For the vegetative library, which was made by DNA Technologies (Gaithersburg, Maryland, United States), CU428 cells were harvested in exponential growth and RNA was purified using TRIzol. PolyA+ mRNA was isolated using oligo(dT) cellulose, cDNA was generated, and inserts were cloned into the EcoRV and NotI sites of the pcDNA3.1(+) vector (Invitrogen). Clones were picked at random and sequenced from the 5′ end using the custom pcDNA(−48) primer. All sequences were submitted to the dbEST division of GenBank, to the Taxonomically Broad EST Database (TBestDB) at http://tbestdb.bcm.umontreal.ca/searches/login.php, and to TIGR's Tetrahymena Gene Index at http://www.tigr.org/tigr-scripts/tgi/T_index.cgi?species=t_thermophila. Subsequent analyses used comparisons of the conjugative sequences with all vegetative sequences including those in GenBank not generated at TIGR.
Eisen J.A., Coyne R.S., Wu M., Wu D., Thiagarajan M., Wortman J.R., Badger J.H., Ren Q., Amedeo P., Jones K.M., Tallon L.J., Delcher A.L., Salzberg S.L., Silva J.C., Haas B.J., Majoros W.H., Farzad M., Carlton J.M., Smith RK J.r., Garg J., Pearlman R.E., Karrer K.M., Sun L., Manning G., Elde N.C., Turkewitz A.P., Asai D.J., Wilkes D.E., Wang Y., Cai H., Collins K., Stewart B.A., Lee S.R., Wilamowska K., Weinberg Z., Ruzzo W.L., Wloga D., Gaertig J., Frankel J., Tsao C.C., Gorovsky M.A., Keeling P.J., Waller R.F., Patron N.J., Cherry J.M., Stover N.A., Krieger C.J., del Toro C., Ryder H.F., Williamson S.C., Barbeau R.A., Hamilton E.P, & Orias E. (2006). Macronuclear Genome Sequence of the Ciliate Tetrahymena thermophila, a Model Eukaryote. PLoS Biology, 4(9), e286.
Full text: Click here
Publication 2006
cDNA Library Cells Cellulose Clone Cells Cloning Vectors Deoxyribonuclease EcoRI DNA, Complementary Genes mRNA, Polyadenylated Oligonucleotide Primers Oligonucleotides RNA, Polyadenylated Strains Tetrahymena trizol
2
Tetrahymena Telomerase Purification and Activity
Cited 13 times
Tetrahymena strain constructions and steps of tag-based affinity purification were done as described6 (link) and in Methods. To label the tagged subunit for EM, telomerase particles were first purified using anti-FLAG M2 antibody resin then bound to rabbit-IgG resin. The telomerase-bound IgG resin was then incubated with Fab derived from anti-FLAG M2 IgG, and elution was effected by protease cleavage. Negatively stained EM specimens were prepared with fresh telomerase samples, stained with 0.8% uranyl formate, and examined with an FEI Tecnai F20 electron microscope operated at 200 kV. Frozen hydrated specimens were prepared using Quantifoil grids and imaged with an FEI Titan Krios electron microscope operated at 120 kV. The image processing tasks, including image classification and RCT reconstruction, were performed as described in Methods.
Telomerase activity assays were performed at room temperature using purified telomerase complexes on FLAG antibody resin with standard Tetrahymena holoenzyme reaction conditions using 0.3 μM 32 (link)P-labeled dGTP. Holoenzyme reconstitution used synthetic genes encoding TERT-f, p75, p65, p50, p45, and p19 for expression in RRL; TER purified following in vitro transcription by T7 RNA polymerase; and N-terminally His6-tagged Teb1BC purified following bacterial expression21 (link).
Full Methods and any associated references are available in the online version of the paper.
Jiang J., Miracco E.J., Hong K., Eckert B., Chan H., Cash D.D., Min B., Zhou Z.H., Collins K, & Feigon J. (2013). The architecture of Tetrahymena telomerase holoenzyme. Nature, 496(7444), 187-192.
Publication 2013
Adjustment Disorders anti-IgG Antibodies, Anti-Idiotypic Bacteria bacteriophage T7 RNA polymerase Biological Assay Chromatography, Affinity Cytokinesis deoxyguanosine triphosphate Electron Microscopy Freezing Holoenzymes Immunoglobulins Peptide Hydrolases Protein Subunits Rabbits Reconstructive Surgical Procedures Resins, Plant Strains Synthetic Genes Telomerase TERT protein, human Tetrahymena Transcription, Genetic uranyl formate
3
Identifying Structural RNA Variants
Cited 11 times
RNAs with known secondary structures were doped into the initial RNA pool as positive controls to estimate the baseline changes in RNA structure in PARS. We calculated the PARS scores for all the bases in the transcripts and performed data normalization in order to directly compare secondary structures between different individuals. To normalize the data, we calculated the standard deviation (SD) for each transcript and divided the PARS score per base by the SD of that transcript. This resulted in a normal distribution of PARS scores for each transcript in each individual and enabled us to calculate the change in PARS scores due to SNVs by subtraction of PARS scores between the individuals. Since a true structure change is likely to extend beyond a single base, we define a structure difference of the i-th base of transcript j between conditions m and n in this formula, where PARS represents the normalized PARS score:
StrucDiffi,j,m,n=∑k=i−2k=i+2abs(PARSk,j,m−PARSk,j,n)5
We calculated the StrucDiff for all the bases in all the transcripts between each pair of individuals: GM12891 and GM12892, GM12891 and GM12878, GM12892 and GM12878. To identify RiboSNitches, we downloaded SNV annotations from HapMap project22 , and then converted SNV annotations from hg18 assembly to hg19 assembly using UCSC executable LiftOver. We then overlaid the hg19 SNV coordinates with our transcriptome annotation, a non-redundant combination of RefSeq and Gencode v12 transcriptome assembly, to identify the positions in the transcriptome that have SNVs. For highly confident detection of structural changes, we require that the sequencing coverage around SNV is dense, such that (1) the SNV is located on a transcript whose average coverage is greater than 1 (on average one read per base); and (2) the average coverage in a 5-base window centered around the SNV is greater than 10 (average S1+V1≥5). We exclude bases that fall within 100 nucleotides from the 3’end of all the transcripts due to the blind tail of 100 nucleotides.
To identify SNVs with statistically significant changes in structure, we estimated a global baseline of structural change by calculating the fold differences between the doping control and SNV cumulative frequencies. We calculated a z-score for each detected SNV: z= (StrucDiffs-mean)/(SD of doped in controls). We used the Tetrahymena ribozyme as the doped in control. We noticed that a StrucDiff ≥1 is equivalent to a z-score≥4.5 and a 100 fold difference between the SNV and doping control cumulative frequencies. To calculate the p-value for the structural change at each detected SNV, we performed 1000 permutations on the absolute values of the non-zero delta PARS scores within each transcript that contains SNV. This p-value is an estimate of the likelihood that a 5-base average of the permutated PARS structural change is greater than the 5-base average of the SNV base’s structural change. The false discovery rate (FDR) of the significance of the structural change at the SNV site is estimated by a multi-hypothesis testing performed using the p.adjust function in R. A SNV is defined as a RiboSNitch if (1) its StrucDiff is greater than 1 (equivalent to z-score ≥ 4.5 and 100 fold cumulative frequency difference); (2) its p-value less than 0.05 and FDR less than 0.1; and (3) local read coverage greater than 10 and at least 3 out of 11 bases contain S1 or V1 signals in a 11-base sliding window centered by the SNV site. We also permutated the structural changes between the Trio by shuffling the StrucDiffs within every transcript. After structural PARS scores were permutated, we identified only 16 RiboSNitches based on the exact same aforementioned methods and thresholds. This number is less than 1% of the original number of RiboSNitches found, indicating that most of the discovered RiboSNitches are not random noise.
Wan Y., Qu K., Zhang Q.C., Flynn R.A., Manor O., Ouyang Z., Zhang J., Spitale R.C., Snyder M.P., Segal E, & Chang H.Y. (2014). Landscape and variation of RNA secondary structure across the human transcriptome. Nature, 505(7485), 706-709.
Publication 2014
5-((glucopyranosyloxy)methyl)uracil Catalytic RNA HapMap Nucleotides Poly(ADP-ribose) Polymerases Self Confidence Tail Tetrahymena Transcriptome TRIO protein, human Visually Impaired Persons
4
Tetrahymena thermophila Cell Culture and Sampling
Cited 9 times
Wild-type cell lines B2086 and CU428 of Tetrahymena thermophila were provided by Dr. P.J. Bruns, Cornell University, Ithaca, NY, (now available through the National Tetrahymena Stock Center, http://tetrahymena.vet.cornell.edu/index.html). Both of these cell lines have inbred strain B genetic background, as does cell line SB210, the source of the MAC genome sequence used to design the microarray probes. Cells were grown in SPP medium [76] (link) at 30°C. For microarray analyses of growing cells, we studied CU428 cells at three different densities that, for convenience are referred to as low (L-l), medium (L-m) and high (L-h). These correspond respectively to ∼1×105 cells/ml, in which, under our culture conditions cells are in true logarithmic growth; ∼3.5×105 cells/ml which corresponds to cells in the decelleratory stage of culture growth and ∼1×106 cells/ml, which corresponds to cells nearly in stationary phase, before appreciable cell death has occurred. For starvation, CU428 cells at ∼2×105 cells/ml were collected, washed and starved at 2×105 cells/ml in 10 mM Tris (pH 7.5); samples were collected at0, 3, 6, 9, 12, 15 and 24 hours(referred to as S-0, S-3, S-6, S-9, S-12, S-15 and S-24). For conjugation, equal volumes of B2086 and CU428 cells that had been starved for 18 hours in 10 mM Tris (pH 7.5) at 2×105 cells/ml, were mixed, and samples were collected at 0, 2, 4, 6, 8, 10, 12, 14, 16 and 18 hours after mixing (referred to as C-0, C-2, C-4, C-6, C-8, C-10, C-12, C-14, C-16 and C-18). The overall similarities in gene expression (see Results and Discussion), and the levels of H1 phosphorylation [77] (link) and the cytological stages [17] (link) were used to assay the repeatability of independent preparations of starvation and conjugation samples, respectively.
Miao W., Xiong J., Bowen J., Wang W., Liu Y., Braguinets O., Grigull J., Pearlman R.E., Orias E, & Gorovsky M.A. (2009). Microarray Analyses of Gene Expression during the Tetrahymena thermophila Life Cycle. PLoS ONE, 4(2), e4429.
Full text: Click here
Publication 2009
Biological Assay Cell Death Cell Lines Cell Microarray Analysis Cells Gene Expression Genetic Background Genome Microarray Analysis Phosphorylation Strains Tetrahymena Tetrahymena thermophila Tromethamine
5
Genetic Manipulation of MEC-17 Across Species
Cited 8 times
To disrupt the MEC-17 gene in Tetrahymena, we used homologous DNA recombination with a fragment carrying the neo4 marker that replaced the coding region. MEC-17 was overexpressed in Tetrahymena using the MTT1 cadmium-dependent promoter. In C. elegans, MEC-12-K40, MEC-12-Q40, and MEC-12-R40 transgenes were introduced into a single site on chromosome II in the EG4322 strain. Animals homozygous for a MEC-12 transgene and homozygous for the mec-12(e1607) allele were obtained by standard crosses. All touch sensation assays in C. elegans were done using blind scoring. To deplete human MEC-17 (C6Orf134) mRNA in Hela cells, we introduced MEC-17-specific siRNAs (ON-TARGETplus pool, Dharmacon) using Oligofectamine (Invitrogen). To knockdown mec17 expression in zebrafish, MOs designed to target the MEC-17 mRNA (Open Biosystems) were injected into early embryos. ATG-MEC17 MO targets the translation initiation site of mec17 mRNA. SP-MEC17 MO targets the exon3/intron3–4 splice junction, and is expected to result in an aberrant splicing isoform of exon2 to exon 4, producing a frameshift mutation and associated protein truncation. As a negative control, we injected MO with a random sequence (oligo-25N, Gene Tools) or a 5bp mismatch to the ATG-MEC17 MO.Live embryos were scored for phenotypes at 48 hpf. To produce a recombinant MEC-17 protein, the cDNA sequence of the murine MEC-17 (BF135007, Open Biosystems) was subcloned into pGEX-3X plasmid (GE Healthcare), expressed in BL21 E. coli cells as a GST fusion and purified using GST-Bind kit (Novagen). The in vitro acetylation assays were performed in 50 mM Tris-HCl pH 8.0, 10 mM glycerol, 0.1 mM EDTA, with purified Tetrahymena MEC-17-KO axonemes or tubulin (purified using DEAE chromatography), recombinant GST-MmMEC-17 enzyme and 10 µM acetyl-CoA. The reaction was detected by western blotting using anti-acetyl–K antibodies.
Akella J.S., Wloga D., Kim J., Starostina N.G., Lyons-Abbott S., Morrissette N.S., Dougan S.T., Kipreos E.T, & Gaertig J. (2010). MEC-17 is an α-tubulin acetyltransferase. Nature, 467(7312), 218-222.
Publication 2010
2-diethylaminoethanol Acetylation Alleles Animals Anti-Antibodies Axoneme Biological Assay Cadmium Caenorhabditis elegans Cells Chromatography Chromosomes Coenzyme A, Acetyl DNA, Complementary Edetic Acid Embryo Enzymes Escherichia coli Exons Frameshift Mutation Genes Glycerin HeLa Cells Homologous Recombination Homo sapiens Homozygote Mus oligofectamine Oligonucleotides Peptide Chain Initiation, Translational Phenotype Plasmids Protein Isoforms Proteins Recombinant Proteins RNA, Messenger RNA, Small Interfering Strains Tetrahymena Touch Transgenes Tromethamine Tubulin Visually Impaired Persons Zebrafish

Most recents protocols related to «Tetrahymena»

1
DNA Fiber Analysis in Tetrahymena
DNA fiber analysis was performed as previously described [19 (link)]. Tetrahymena cells were pulse-labeled with 400 μM IdU (Sigma) at 30 °C for 10 min. Then, cells were washed once with 1×PBS. Cells were resuspended in pre-warmed fresh media (for vegetative cells) or 10 mM Tris-HCl (pH 7.4) (for mating cells) with 100 μM CldU (MP Biomedicals) and labeled for 10 min. After two washes with PBS, the cell density was adjusted to 1 × 106 cells/mL. Preparation and immunostaining of DNA fibers were performed as previously described [23 (link),24 (link),25 (link)] with the following modifications. Briefly, after fixation and HCl treatment, slides were washed three times with 1×PBS, and 5% BSA in PBS was used to block slides for 30 min. Mouse α-BrdU (1:50, Becton Dickson), which recognizes IdU, and rat α-BrdU (1:100, Accurate Chemical), which recognizes CldU, in 5% BSA were then added onto slides. After 1 h of incubation, the slides were washed three times with 1×PBS and incubated for 30 min with secondary antibodies: Alexa Fluor 568 goat anti-mouse IgG (1:100, Invitrogen/Molecular probes) and Alexa Fluor 488 goat anti-rat IgG (1:100, Invitrogen/Molecular probes). Next, slides were washed three times with 1×PBS, dehydrated with an ethanol series, and mounted with SlowFade Gold antifade (Invitrogen). During immunostaining, all antibodies were diluted in 5% BSA in 1×PBS, all incubations were performed at 37 °C, and all wash steps were performed at RT.
DNA fiber images were taken by a Nikon A1R+ confocal microscope at 600× magnification. Measurements of track length were performed with Nikon NIS-Elements software. Inter-origin distance was defined as the distance between the centers of two red segments in either green-red-green-red-green or green-red-gap-red-green tracks. Fork velocity was determined by measuring the length of the green segment in a red-green track or red segments in a green-red-gap-red-green track. GraphPad Prism software was used to analyze the statistical significance, and p-values were determined by the Mann–Whitney test for single comparisons or the Kruskal–Wallis test for multiple comparisons.
Meng X., Dang H.Q, & Kapler G.M. (2023). Developmentally Programmed Switches in DNA Replication: Gene Amplification and Genome-Wide Endoreplication in Tetrahymena. Microorganisms, 11(2), 491.
Full text: Click here
Publication 2023
alexa 568 alexa fluor 488 anti-IgG Antibodies Bromodeoxyuridine Cardiac Arrest Cells Ethanol Fibrosis Goat Gold Microscopy, Confocal Molecular Probes Mus prisma Pulse Rate Tetrahymena Tromethamine
2
Tetrahymena Culturing and Mating Protocol
Tetrahymena strains were cultured in 2% PPYS media (2% proteose peptone, 0.2% yeast extract, 0.003% sequestrine) at 30 °C, 250 μg/mL of penicillin, 100 μg/mL of streptomycin, and 250 ng/mL of amphotericin B (Antibiotic-Antimycotic, Life Technologies). For starvation, Tetrahymena cells were collected from log phase culture, washed twice with 10 mM Tris-HCl (pH 7.4), and starved in the same buffer supplemented with 250 μg/mL of penicillin, 100 μg/mL of streptomycin, and 250 ng/mL of amphotericin B for 18 h. For mating, Tetrahymena cells were starved for 18 h as described, mixed with an equal number at the final cell density of 2.5 × 105 cells/mL, and then incubated under stationary conditions at 30 °C. All Tetrahymena strains used in this study are listed in Table 1.
Meng X., Dang H.Q, & Kapler G.M. (2023). Developmentally Programmed Switches in DNA Replication: Gene Amplification and Genome-Wide Endoreplication in Tetrahymena. Microorganisms, 11(2), 491.
Full text: Click here
Publication 2023
Amphotericin B Antibiotics Buffers Cells Culture Media Penicillins PPY protein, human proteose-peptone Strains Streptomycin Tetrahymena Tromethamine Yeast, Dried
3
Quantifying DNA Alleles in Tetrahymena Macronuclei
Genomic DNA was isolated from Tetrahymena cells according to a previously described protocol [21 (link)]. qPCR was performed in 96-well plates on the StepOnePlus Real-Time PCR Systems (Applied Biosystems). qPCR was performed in a 10 μL reaction including 5 μL of Power SYBR® Green PCR Master Mix (Applied Biosystems), with 1–5 ng of genomic DNA as a template, and 200 nM forward and reverse primers. Each DNA sample was assayed in triplicate. Water was used to replace genomic DNA for the negative control. Heterokaryon parental strains contained B rDNA in their macronucleus and C3 rDNA in their micronucleus. The abundance of the C3 rDNA allele in developing progeny macronuclei was determined by qPCR using primers that hybridize to a 42 bp sequence that is present in C3 rDNA and absent in B rDNA [22 (link)]. Similarly, the gfp tag was used to selectively amplify the histone g-H3.2+GFP-3 allele in the developing macronucleus. The rDNA qPCR and histone H3-gfp primers were: macronuclear rDNA: C3-2-For: TTTGCAACTTTTGAGACTTCGTG; C3-2-Rev: TCACACAAAATCTAAGCGCAATC; micronuclear rDNA locus: CBS 5-4-For: CTGACTAAACCAACCTCTTAAAAACG, CBS 5-4-Rev: TGAGTTCTCAGTGTGAAAGTTAAGAG; H3-GFP (non-rDNA): H3-GFP-1-For: GATGGCCCTGTCCTTTTACCA, H3-GFP-1-Rev: TTTTCGTTGGGATCTTTCGAA.
Meng X., Dang H.Q, & Kapler G.M. (2023). Developmentally Programmed Switches in DNA Replication: Gene Amplification and Genome-Wide Endoreplication in Tetrahymena. Microorganisms, 11(2), 491.
Full text: Click here
Publication 2023
Alleles BP 42 Cells DNA, Ribosomal Genome Histone H3 Histone H3.3 Macronucleus Oligonucleotide Primers Parent Strains SYBR Green I Tetrahymena
4
Identification of GPCRs in Diverse Ciliates
To identify the GPCRs of ciliates, we collected the genome data of 24 ciliates, and the dataset was derived from four sources. Of the collected ciliates, the data for Ichthyophthirius multifiliis, Tetrahymena borealis, Tetrahymena empidokyrea, Tetrahymena paravorax, Tetrahymena pyriformis, Tetrahymena shanghaiensis, Tetrahymena thermophila, Euplotes octocarinatus, Euplotes vannus, Stentor coeruleus, Oxytricha trifallax, and Stylonychia lemnae were obtained from Ciliates.org (https://ciliates.org/landing/ (accessed on 12 October 2022)). The data for Entodinium caudatum, Carchesium polypinum, Halteria grandinella, Pseudocohnilembus persalinus, and Spirostomum minus were retrieved from NCBI (www.ncbi.nlm.nih.gov (accessed on 12 October 2022)). The data for Paramecium caudatum, Paramecium sexaurelia, and Parameciium tetraurelia were obtained from ParameciumDB (https://paramecium.i2bc.paris-saclay.fr/ (accessed on 12 October 2022)). Further ciliate data, including data for Epistylis chlorelligerum, Epistylis plicatilis, Vorticella convallara, and Zoothamnium arbuscula can be accessed through the National Genomics Data Center (https://ngdc.cncb.ac.cn/ (accessed on 12 October 2022)). This dataset covers four classes, eight orders, twelve families, and fifteen genera. In addition, we also identified the GPCRs in three non-ciliates species (used as outgroups), including Perkinsus marinus, Symbiodinium microadriaticum, and Plasmodium falciparum. These data were also obtained from NCBI (www.ncbi.nlm.nih.gov (accessed on 17 October 2022)).
Luo S., Zhang P., Miao W, & Xiong J. (2023). Genome-Wide Identification of G Protein-Coupled Receptors in Ciliated Eukaryotes. International Journal of Molecular Sciences, 24(4), 3869.
Full text: Click here
Publication 2023
Ciliata Euplotes Genome Oxytricha Paramecium Paramecium caudatum Plasmodium falciparum Tetrahymena Tetrahymena pyriformis Tetrahymena thermophila
5
Computational Protein Annotation Pipeline
All proteins identified from the nuclear mass spectrometry results were used as input for software to analyze and predict features. InterProScan [20 (link)] version 5.45-80.0 was used to predict protein features using all available analyses, as well as GO terms and Pathway annotations. The Pannzer2 web server [21 (link)] was also used to predict GO terms. DeepLoc 2.0 [22 (link)] was used to predict subcellular localizations and sorting signals. The GO-MWU [23 (link)] R package was used to identify GO categories which had significant enrichment of genes predominantly found in either the MAC or MIC. BLASTP [24 (link)] 2.10.0+ was used to identify orthologous proteins from Tetrahymena mitochondria.
Lu M.W., Beh L.Y., Yerlici V.T., Fang W., Kulej K., Garcia B.A, & Landweber L.F. (2023). Exploration of the Nuclear Proteomes in the Ciliate Oxytricha trifallax. Microorganisms, 11(2), 343.
Full text: Click here
Publication 2023
Genes Mass Spectrometry Mitochondrial Proteins Protein Domain Proteins Tetrahymena

Top products related to «Tetrahymena»

1
Yeast extract by BD
Sourced in United States, Japan, Germany, United Kingdom, France, India, Poland, Mexico, Australia, Italy, Canada
Yeast extract is a powder or paste derived from the autolysis of yeast cells. It contains a variety of amino acids, vitamins, and other nutrients that can support the growth and propagation of microorganisms in laboratory settings.
2
Antibiotic antimycotic mix by Merck Group
Sourced in United States, Germany
Antibiotic/antimycotic mix is a sterile solution containing a combination of antibiotics and antifungal agents. It is designed for use in cell culture applications to prevent bacterial and fungal contamination.
3
Vitrobot mark 4 by Thermo Fisher Scientific
Sourced in United States, Germany, Netherlands, United Kingdom, Czechia, Israel
The Vitrobot Mark IV is a cryo-electron microscopy sample preparation instrument designed to produce high-quality vitrified specimens for analysis. It automates the process of blotting and plunge-freezing samples in liquid ethane, ensuring consistent and reproducible sample preparation.
4
Trizol reagent by Thermo Fisher Scientific
Sourced in United States, China, Japan, Germany, United Kingdom, Canada, France, Italy, Australia, Spain, Switzerland, Netherlands, Belgium, Lithuania, Denmark, Singapore, New Zealand, India, Brazil, Argentina, Sweden, Norway, Austria, Poland, Finland, Israel, Hong Kong, Cameroon, Sao Tome and Principe, Macao, Taiwan, Province of China, Thailand
TRIzol reagent is a monophasic solution of phenol, guanidine isothiocyanate, and other proprietary components designed for the isolation of total RNA, DNA, and proteins from a variety of biological samples. The reagent maintains the integrity of the RNA while disrupting cells and dissolving cell components.
5
Proteose peptone by BD
Sourced in United States
Proteose peptone is a complex mixture of peptides and amino acids derived from the enzymatic digestion of proteins. It is commonly used in microbiology and cell culture media as a nutrient source to support the growth of various microorganisms and cell lines.
6
Igepal ca 630 by Merck Group
Sourced in United States, Germany, United Kingdom, Macao, Italy, Switzerland, France
IGEPAL CA-630 is a non-ionic detergent used in various laboratory applications. It is a polyoxyethylene octylphenyl ether that acts as a wetting agent and emulsifier. The product assists in solubilizing and dispersing components in aqueous solutions.
7
Wizard genomic dna purification kit by Promega
Sourced in United States, France, Germany, China, United Kingdom, Japan, Switzerland, Australia, Spain, Italy, Ireland, Canada, Brazil
The Wizard Genomic DNA Purification Kit is a product designed to isolate and purify genomic DNA from a variety of sample types. It utilizes a simple, rapid, and efficient protocol to extract high-quality DNA that can be used in various downstream applications.
8
Penicillin by Thermo Fisher Scientific
Sourced in United States, United Kingdom, Germany, China, France, Canada, Japan, Australia, Switzerland, Italy, Israel, Belgium, Austria, Spain, Brazil, Netherlands, Gabon, Denmark, Poland, Ireland, New Zealand, Sweden, Argentina, India, Macao, Uruguay, Portugal, Holy See (Vatican City State), Czechia, Singapore, Panama, Thailand, Moldova, Republic of, Finland, Morocco
Penicillin is a type of antibiotic used in laboratory settings. It is a broad-spectrum antimicrobial agent effective against a variety of bacteria. Penicillin functions by disrupting the bacterial cell wall, leading to cell death.
9
Retigaex charge coupled device camera by PerkinElmer
Sourced in Canada
The RetigaEX charge-coupled-device (CCD) camera is a high-performance imaging device designed for scientific and industrial applications. It features a large sensor area, high resolution, and low noise characteristics to capture detailed images and data. The core function of the RetigaEX camera is to provide reliable and accurate image acquisition for a variety of analytical and research tasks.
10
Streptomycin by Thermo Fisher Scientific
Sourced in United States, United Kingdom, Germany, China, France, Canada, Australia, Japan, Switzerland, Italy, Belgium, Israel, Austria, Spain, Netherlands, Poland, Brazil, Denmark, Argentina, Sweden, New Zealand, Ireland, India, Gabon, Macao, Portugal, Czechia, Singapore, Norway, Thailand, Uruguay, Moldova, Republic of, Finland, Panama
Streptomycin is a broad-spectrum antibiotic used in laboratory settings. It functions as a protein synthesis inhibitor, targeting the 30S subunit of bacterial ribosomes, which plays a crucial role in the translation of genetic information into proteins. Streptomycin is commonly used in microbiological research and applications that require selective inhibition of bacterial growth.

More about "Tetrahymena"

Tetrahymena is a genus of free-living, single-celled ciliated protozoa that are widely used as a model organism in biological research.
These unicellular eukaryotes exhibit a variety of cellular processes and structures, making them highly valuable for studying fundamental aspects of cell biology, genetics, and physiology.
Tetrahymena are commonly found in freshwater habitats and can be easily cultured in the laboratory, allowing researchers to conduct a wide range of experimental studies.
The availability of genomic resources and well-established experimental protocols have further cemented Tetrahymena's role as a key model system for investigating cellular mechanisms, signaling pathways, and epigenetic regulation.
Researchers can leverage PubCompare.ai's AI-driven protocol comparisons to optimize their Tetrahymena research, easily locate the best protocols from literature, preprints, and patents, and improve reproducibility with the intelligent protocol comparison tool, enabling seamless and efficient research.
Tetrahymena research often utilizes a range of laboratory techniques and reagents, such as yeast extract, antibiotic/antimycotic mixes, the Vitrobot Mark IV for cryo-electron microscopy, TRIzol reagent for RNA extraction, proteose peptone for cell culture media, IGEPAL CA-630 for cell lysis, the Wizard Genomic DNA Purification Kit for DNA extraction, and antibiotics like penicillin and streptomycin.
Additionally, the RetigaEX charge-coupled-device camera is commonly used for imaging and analysis of Tetrahymena samples.
By incorporating these insights and related terms, researchers can enhance their Tetrahymena studies, streamline their workflow, and improve the reproducibility and impact of their findings.
PubCompare.ai's AI-driven protocol comparison tool can be a valuable resource in this endeavor, helping scientists navigate the vast landscape of Tetrahymena research and identify the most relevant and effective experimental protocols.