Trematoda

Between July 2013 and April 2015, 1019 aqueous samples were collected from 974 geothermal features within 18 geothermal fields in the TVZ. A 3 L water column sample was taken (to 1 m depth where possible) from each geothermal spring, lake, stream, or the catchment pool of geysers for microbial and chemical analyses. Samples were collected either at the centre of the feature or at ~3 m from the edge to target well-mixed and/or more representative samples, depending on safety and size of the spring. Comprehensive physical and chemical measurements, and field observational metadata were recorded contemporaneously with a custom-built application and automatically uploaded to a database (Supplementary Table 7). All samples were filtered within 2 h of collection and stored accordingly. Total DNA was extracted using a modified CTAB method^{59 (link)} with the PowerMag Microbial DNA Isolation Kit using SwiftMag technology (MoBio Laboratories, Carlsbad, CA, USA). The V4 region of the 16S rRNA gene was amplified in triplicate using universal Earth Microbiome Project^{44 (link)} primers F515 (5′-GTGCCAGCMGCCGCGGTAA-3′) and R806 (5′-GGACTACVSGGGTATCTAAT-3′), details of which can be found in Supplementary Methods. SPRIselect (Beckman Coulter, Brea, CA, USA) was used to purify DNA following amplification. Amplicon sequencing was performed using the Ion PGM System for Next-Generation Sequencing with the Ion 318v2 Chip and Ion PGM Sequencing 400 Kits (ThermoFisher Scientific, Waltham, MA, USA).
Forty-six separate physicochemical parameters were determined for each geothermal spring sample collected. Inductively coupled plasma–mass spectrometry (ICP-MS) was used to determine the concentrations of aqueous metals and non-metals (31 species; a full list is provided in Supplementary Table 7), and various UV–vis spectrometry methods were used to determine aqueous nitrogen species ( ${\mathrm{NH}}_4^{+}$ , ${\mathrm{NO}}_3^{-}$ , ${\mathrm{NO}}_2^{-}$ ), Fe²⁺, and ${\mathrm{PO}}_4^{3-}$ , with H₂S, ${\mathrm{HCO}}_3^{-}$ , and Cl⁻ determined via titration, and SO₄^2– concentration measured via ion chromatography (IC). COND, dO, ORP, pH, and TURB were determined using a Hanna Instruments (Woonsocket, RI, USA) multiparameter fieldmeter at room temperature. Spring temperature (TEMP) was measured in situ immediately after sampling, using a Fluke 51-II thermocouple (Fluke, Everett, WA, USA).
Expanded details on sampling procedures, sample processing, and protocols for DNA extraction, DNA amplification, and chemical analyses can be found in Supplementary Methods and Supplementary Table 7.

The morphological characteristics of O. viverrini (Ov) and minute intestinal flukes (MIFs) eggs are similar. So, the Ov egg was confirmed by specific PCR amplification from genomic DNA using OvNad5 primer as previously described [30 (link)]. PCR amplifications were done by using GoTaq® Colorless Master Mix (Promega, USA) containing 3 µL of genomic DNA, and 25 pmol of each forward and reverse primer (OvNad5-F: TTTGCGGAGGTTTGTTACCT and OvNad5-R: CACCTCACCAATTCAACACG) in a thermal cycler (Mastercycler nexus Eppendorf flexlid, Germany). The amplification steps were including initial denaturation at 95ºC for 5 min, followed by 35 cycles of denaturation at 95ºC for 1 min, annealing at 55 ºC for 1 min, extension at 72 ºC for 1 min, and one cycle of a final extension at 72 ºC for 10 min. The PCR products were size separated on 2% agarose gel containing ViSafe Red Gel Stain (Vivantis, USA) using 1X TBE buffer at 80 V for 2 h. The PCR products were confirmed for their correction by DNA sequencing service (Macrogen, Republic of Korea).

Gas exchange measurements were performed using a portable photosynthesis system (Li-6400; LI-COR, Inc., Lincoln, NE, USA) in the morning between 9:00-10: 30am, on the first fully expanded leaf between 1 and 6 h of the light period on the third day of control (day 3 control), and moderate stress (day 3 stress) and high temperature treated (day 8 stress) plants. Air temperature was between 25°C - 30°C as per the temperature of the growth chamber. The light response curves were measured at ambient CO₂ concentrations (350-400 μmol) during photosynthetic observations. Leaves were illuminated with photon flux densities 1500 μmol photons m^-2s^-1. Net photosynthetic rate (P_N), stomatal conductance (g_s), transpiration rate (E), and intracellular CO₂ concentration (Ci) was measured. Canopy temperature of cucumber leaves was performed using an imaging FLUKE thermal imager.