Log In Sign up
The largest database of trusted experimental protocols
> Living Beings > Mammal > Canis familiaris

Canis familiaris

Canis familiaris, commonly known as the domestic dog, is a subspecies of the gray wolf and one of the most widely kept companion animals worldwide.
This versatile species has been selectively bred for a variety of purposes, including companionship, herding, hunting, and service roles.
Canis familiaris demonstrates a remarkable diversity in size, appearance, and behavior, making it a fascinationg subject for research across multiple disciplines.
Wheter exploring the complexities of canine cognition, investigating canine health and disease, or studying the unique bond between humans and their canine companions, the domestic dog offers a wealth of opportunities for scientific discovery and advancement.

Most cited protocols related to «Canis familiaris»

1
Allele Counts and Admixture Analysis of Dog Breeds
Allele counts for the dog breeds and wild canids reported in Boyko et al. Boyko:2010fk were downloaded from http://genome-mirror.bscb.cornell.edu/ on July 30, 2011. These data consist of counts of reference and alternate alleles at 61,468 sites in 85 dog breeds and wild canids. We removed the Jackal and Scottish Deerhound for having relatively high amounts of missing data, and the village dogs because it is unclear if they represent a coherent population. We also removed all SNPs on the X chromosome. This left us with 60,615 SNPs in 82 populations. We ran TreeMix with a window size ( ) of 500. This corresponds to a window size of approximately 20 Mb. For all TreeMix analyses, we set the coyote as the outgroup.
The ascertainment scheme used for SNP discovery in dogs was complicated [68] (link). The largest set of SNPs were ascertained by virtue of being different between the boxer and poodle assemblies. This should lead to an overestimation of the distance between the boxer and the poodle in our analysis. Indeed, in Figure 5B, a considerable negative residual between the boxer and poodle is visible. Another set of SNPs were ascertained by being heterozygous within a boxer individual, and a third set were ascertained by comparison between a boxer and wild canids. These latter SNPs should lead to an overestimation of the distance between the boxer and the wolf in our analysis (as we see for the poodle); in fact, we infer migration between the boxer and the wolf. This ascertainment issue may have led us to underestimate the amount of gene flow in the comparison.
Pickrell J.K, & Pritchard J.K. (2012). Inference of Population Splits and Mixtures from Genome-Wide Allele Frequency Data. PLoS Genetics, 8(11), e1002967.
Full text: Click here
Publication 2012
Alleles Breeding Canidae Canis familiaris Coyotes Gene Flow Genome Heterozygote Jackals Population Group Single Nucleotide Polymorphism Wolves X Chromosome
2
Whole Genome Sequencing of Dogs and Wolves
Whole genome sequences of 582 dogs and eight wolves available at the European Nucleotide Archive and the Short Read Archive were used for the analysis. See Table S1 for details of the project and sample accessions. The CanFam3.1 reference genome was downloaded from Ensembl (http://www.ensembl.org/Canis_familiaris/Info/Index) and was used for alignment of reads.
Jagannathan V., Drögemüller C, & Leeb T. (2019). A comprehensive biomedical variant catalogue based on whole genome sequences of 582 dogs and eight wolves. Animal genetics, 50(6), 695-704.
Publication 2019
Canis familiaris Europeans Genome Nucleotides Wolves
3
Genetic Diversity Analysis of Giardia Parasites
The secondary PCR products were purified by using Microcon PCR Centrifugal Filter Devices (Millipore Corp., Bedford, MA) and sequenced on an ABI 3100 automated sequencer by using the Big Dye Terminator Cycle Sequencing Ready Reaction Kit (Perkin-Elmer). Sequence accuracy was confirmed by two-directional sequencing of two separate PCR products. Multiple alignment of the nucleotide sequences was performed by using Wisconsin Package Version 9.0 program (18 ). A phylogenetic analysis was performed on the aligned sequences to assess the extent of genetic diversity within G. duodenalis parasites as well as their evolutionary relationships with other Giardia species. In this analysis, published TPI nucleotide sequences representing G. duodenalis (from humans, cattle, cat, dog, muskrat, pig, and rat), G. muris, and G. ardeae were aligned with TPI sequences of Giardia parasites obtained in this study.
A neighbor-joining tree (19 (link)) was constructed on the basis of the evolutionary distances calculated by the Kimura-2-parameter model using the TreeconW program (20 (link)). A sequence of G. ardeae (GenBank accession no. AF069564) was used as the outgroup since the construction of an unrooted tree showed it to be the most divergent member under analysis. The reliability of these trees was assessed by using the bootstrap method (21 (link)) with 1,000 pseudoreplicates; values >70% were reported (22 (link)). Nucleotide sequences of the TPI gene of G. duodenalis from humans, cattle, dogs, muskrat, rat, and rabbit, representing different genotypes, were deposited in GenBank under accession numbers AY228628 to AY228649.
A similar phylogenetic analysis was carried out on the nucleotide sequences of the SSU rRNA gene from G. microti in muskrats. SSU rRNA nucleotide sequences were deposited in GenBank under accession numbers AY228332 and AY228333.
Sulaiman I.M., Fayer R., Bern C., Gilman R.H., Trout J.M., Schantz P.M., Das P., Lal A.A, & Xiao L. (2003). Triosephosphate Isomerase Gene Characterization and Potential Zoonotic Transmission of Giardia duodenalis. Emerging Infectious Diseases, 9(11), 1444-1452.
Full text: Click here
Publication 2003
Base Sequence Biological Evolution Canis familiaris Cattle Genes Genetic Diversity Genotype Giardia Homo sapiens Medical Devices Ondatra zibethicus Parasites Rabbits Ribosomal RNA Ribosomal RNA Genes Sequence Alignment Trees
4
Comprehensive Frailty Assessment in Mice
A novel 31-item frailty index based on established clinical signs of deterioration in mice was developed in consultation with a veterinarian (B.A.H.). Clinical assessment included evaluation of the integument, the musculoskeletal system, the vestibulocochlear/auditory systems, the ocular and nasal systems, the digestive system, the urogenital system, the respiratory system, signs of discomfort, the body weight (g), and body surface temperature (°C). Table 1 lists clinical signs of deterioration/deficits evaluated in this study. To establish baseline clinical assessment techniques, we first observed and evaluated young adult mice that had few signs of clinical deterioration. With training, an experienced investigator could perform clinical frailty assessments in 3.8±0.1 minutes per animal (n = 15 young adult animals).
Clinical examinations were performed at approximately the same time every day. Mice were briefly observed in their home cage and then taken to an assessment room. Each mouse was weighed, and body surface temperature was measured with an infrared temperature probe (Infrascan; La Crosse Technology) directed at the abdomen (average of three readings was used). Then the mice were assessed with a brief clinical exam to evaluate parameters described in Table 1. Details of the methods used for clinical assessment are outlined in Supplementary Table 2. The severity of each deficit was rated with a simple scale. A score of 0 was given if there was no sign of a deficit, a score of 0.5 indicated a mild deficit, and a score of 1 was given for a severe deficit (Supplementary Table 2). Deficits in body weight (g) and body surface temperature (°C) were scored based on deviation from reference values in young adult animals, as described for the eight-item frailty index. Besides the infrared temperature probe, the only additional equipment required was a clicker of the type used to train dogs (used to evaluate hearing). Table 2 shows the Mouse Frailty Assessment Form we developed for use in these studies.
Whitehead J.C., Hildebrand B.A., Sun M., Rockwood M.R., Rose R.A., Rockwood K, & Howlett S.E. (2013). A Clinical Frailty Index in Aging Mice: Comparisons With Frailty Index Data in Humans. The Journals of Gerontology Series A: Biological Sciences and Medical Sciences, 69(6), 621-632.
Publication 2013
Abdomen Animals Body Weight Canis familiaris Clinical Deterioration Digestive System Ear Eye Mice, Laboratory Musculoskeletal System Nose Physical Examination Respiratory System Skin System, Genitourinary Veterinarian Young Adult
5
Standardized Food and Non-Food Image Database
The database comprises 568 food images including sweet (e.g., ice cream, chocolate), savory (e.g., pistachios, sandwiches), processed (e.g., hamburger, French fries, potato chips, chocolate bars) and whole foods (e.g., vegetables and fruits) and beverages (e.g., coffee, orange juice). Images of single items (e.g., one apple), several items (e.g., three apples) as well as full meals (e.g., roast beef with vegetables), were included. The food images are complemented by 315 non-food images comprising animals (n = 37, e.g., butterflies, dogs), flowers and leaves (n = 42), common household objects (n = 89, e.g., bucket, flat iron), office supply (n = 20, e.g., paper clip, ball pen), kitchen accessories (n = 46, e.g., toaster, pan), as well as tools (n = 23, e.g., pliers, screws), food packaging (n = 33, e.g., pizza box; no food visible on packaging), and other objects (n = 25). Images were selected from a commercially available database (Hemera Photo Objects, Vols. I-III), collected from non-copyrighted sources on the internet, or taken in our lab using an Olympus SZ-31MR digital camera (OlympusCorp., Tokyo, Japan). All images are color photographs with a resolution of 600 × 450 pixels (96 dpi, sRGB color format). Images were standardized on background color (white) and selected/edited to be relatively homogeneous with regard to, viewing distance (≈80 cm), angle and simple figure-ground composition. The background was adapted to meet eating conditions: some foods can be presented without dishware (e.g., fruits or hamburger), while others naturally require a plate or bowl (e.g., soup or fruit salad).
Blechert J., Meule A., Busch N.A, & Ohla K. (2014). Food-pics: an image database for experimental research on eating and appetite. Frontiers in Psychology, 5, 617.
Full text: Click here
Publication 2014
Animals Beef Beverages Butterflies Canis familiaris Chocolate Clip Coffee DNA Chips Eating Disorders Fingers Flowers Food Fruit Households Ice Cream Iron Pistacia vera Potato Salads Savory Vegetables

Most recents protocols related to «Canis familiaris»

1
Investigating Virus Infectivity's Role in Plaque Size
Not available on PMC !

Example 3

Investigation of Virus Infectivity as a Factor that Determines Plaque Size.

With the revelation that plaque formation is strongly influenced by the immunogenicity of the virus, the possibility that infectivity of the virus could be another factor that determines plaque sizes was investigated. The uptake of viruses into cells in vitro was determined by measuring the amounts of specific viral RNA sequences through real-time PCR.

To measure total viral RNA, total cellular RNA was extracted using the RNEasy Mini kit (Qiagen), and complementary DNA synthesized using the iScript cDNA Synthesis kit (Bio-Rad). To measure total viral RNA, quantitative real-time PCR was done using a primer pair targeting a highly conserved region of the 3′ UTR common to all four serotypes of dengue; inter-sample normalization was done using GAPDH as a control. Primer sequences are listed in Table 5. Pronase (Roche) was used at a concentration of 1 mg/mL and incubated with infected cells for five minutes on ice, before washing with ice cold PBS. Total cellular RNA was then extracted from the cell pellets in the manner described above.

TABLE 5
PCR primer sequences.
Gene TargetPrimer Sequence
DENV LYL 3′UTRForward: TTGAGTAAACYRTGCTGCCTGTA
TGCC (SEQ ID NO: 24)
Reverse: GAGACAGCAGGATCTCTGGTCTY
TC (SEQ ID NO: 25)
GAPDH (Human)Forward: GAGTCAACGGATTTGGTCGT
(SEQ ID NO: 26)
Reverse: TTGATTTTGGAGGGATCTCG
(SEQ ID NO: 27)
CXCL10 (Human)Forward: GGTGAGAAGAGATGTCTGAATCC
(SEQ ID NO: 28)
Reverse: GTCCATCCTTGGAAGCACTGCA
(SEQ ID NO: 29)
ISG20 (Human)Forward: ACACGTCCACTGACAGGCTGTT
(SEQ ID NO: 30)
Reverse: ATCTTCCACCGAGCTGTGTCCA
(SEQ ID NO: 31)
IFIT2 (Human)Forward: GAAGAGGAAGATTTCTGAAG
(SEQ ID NO: 32)
Reverse: CATTTTAGTTGCCGTAGG
(SEQ ID NO: 33)
IFNα (Canine)Forward: GCTCTTGTGACCACTACACCA
(SEQ ID NO: 34)
Reverse: AAGACCTTCTGGGTCATCACG
(SEQ ID NO: 35)
IFNβ (Canine)Forward: GGATGGAATGAGACCACTGTCG
(SEQ ID NO: 36)
Reverse: ACGTCCTCCAGGATTATCTCCA
(SEQ ID NO: 37)

The proportion of infected cells was assessed by flow cytometry. Cells were fixed and permeabilised with 3% paraformaldehyde and 0.1% saponin, respectively. DENV envelope (E) protein was stained with mouse monoclonal 4G2 antibody (ATCC) and AlexaFluor488 anti-mouse secondary antibody. Flow cytometry analysis was done on a BD FACS Canto II (BD Bioscience).

Unexpectedly, despite DENV-2 PDK53 inducing stronger antiviral immune responses, it had higher rates of uptake by HuH-7 cells compared to DENV-2 16681 (FIG. 5). This difference continued to be observed when DENV-2 PDK53 inoculum was reduced 10-fold. In contrast, DENV-3 PGMK30 and its parental strain DENV-3 16562 displayed the same rate of viral uptake in host cells. Furthermore, DENV-2 PDK53 showed a higher viral replication rate compared to DENV-2 16681. This was determined by measuring the percentage of cells that harbored DENV E-protein, detected using flow cytometry. DENV-2 PDK53 showed a higher percentage of infected cells compared to DENV-2 16681 at the same amount of MOI from Day 1 to 3 (FIG. 6). In contrast, DENV-3 PGMK30 showed a reverse trend and displayed lower percentage of infected cells compared to DENV-3 16562. Results here show that successfully attenuated vaccines, as exemplified by DENV-2 PDK53, have greater uptake and replication rate.

Results above demonstrate that the DENV-2 PDK53 and DENV-3 PGMK30 are polarized in their properties that influence plaque morphologies. While both attenuated strains were selected for their formation of smaller plaques compared to their parental strains, the factors leading to this outcome are different between the two.

Accordingly, this study has demonstrated that successfully attenuated vaccines, as exemplified by DENV-2 PDK53 in this study, form smaller plaques due to induction of strong innate immune responses, which is triggered by fast viral uptake and spread of infection. In contrast, DENV-3 PGMK30 form smaller plaques due to its slower uptake and growth in host cells, which inadvertently causes lower up-regulation of the innate immune response.

Based on the results presented in the foregoing Examples, the present invention provides a new strategy to prepare a LAV, which expedites the production process and ensures the generation of effectively attenuated viruses fit for vaccine use.

US11865083B2. Rapid method of generating live attenuated vaccines (2024-01-09). NATIONAL UNIVERSITY OF SINGAPORE [SG]. Inventors: Eng Eong Ooi [SG], Kenneth Goh [SG], Swee Sen Kwek [SG], Choon Kit Tang [SG].
Full text: Click here
Patent 2024
Antibodies, Anti-Idiotypic Antigens, Viral Antiviral Agents Canis familiaris Cells Common Cold Cowpox virus Dengue Fever Dental Plaque DNA, Complementary DNA Replication Flow Cytometry GAPDH protein, human Genes Homo sapiens Immunity, Innate Infection Interferon-alpha Monoclonal Antibodies Mus Oligonucleotide Primers paraform Parent Pellets, Drug Pronase Proteins Real-Time Polymerase Chain Reaction Response, Immune RNA, Viral Saponin Senile Plaques Strains Vaccines Virus Virus Diseases Virus Replication
2
Conserved Amino Acid Substitutions in Canine H3N8 Influenza Viruses
Not available on PMC !

Example 10

There were conserved amino acid substitutions in all 6 canine isolates that differentiated them from contemporary equine influenza viruses (Table 9). These conserved substitutions were 115M, N83S, W222L, I328T, and N483T. Phylogenetic comparisons of the mature HA protein showed that the canine/Jax/05, canine/Miami/05, and canine/Iowa/05 viruses formed a subgroup with the canine/TX/04 isolate (FIG. 4). There were 3 amino acid changes (L118V, K261N, and G479E) that differentiated this subgroup from the other canine viruses (Table 9). There were 2 amino acid changes (F79L and G218E) that differentiated the 2005 isolates from their canine/TX/04 root. Furthermore, the 2005 isolates from non-greyhound dogs, canine/Jax/05 and canine/Miami/05, differed from the canine/Iowa/05 greyhound isolate by one amino acid change, R492K. Finally, canine/Jax/05 differed from canine/Miami/05 at a single amino acid, S107P. In all other H3N8 equine and canine viruses, S is conserved at position 107 except for A/Equine/Jilin/1/89 which has a T (Guo Y. et al., 1992).

US11865172B2. Materials and methods for respiratory disease control in canines (2024-01-09). UNIVERSITY OF FLORIDA RESEARCH FOUNDATION, INC. [US], CORNELL RESEARCH FOUNDATION, INC. [US], The Government of The United States of America as represented by The Secretary of the Department of [US]. Inventors: Patti Cynthia Crawford [US], Paul J. Gibbs [US], Edward J. Dubovi [US], Ruben Omar Donis [US], Jacqueline Katz [US], Alexander I. Klimov [US], Nallakannu P. Lakshmanan [US], Melissa Anne Lum [US], Daniel Ghislena Emiel Goovaerts [NL], Mark William Mellencamp [US], Nancy J. Cox [US], William L. Castleman [US].
Full text: Click here
Patent 2024
Amino Acids Amino Acid Substitution Canis familiaris Equus caballus Influenza Orthomyxoviridae Plant Roots Proteins Virus
3
Canine Respiratory Pathology in Viral Infection
Not available on PMC !

Example 14

In contrast to the previous experimental infection using specific pathogen-free Beagles (Crawford et al., 2005), the virus-inoculated mongrel dogs had pneumonia as evidenced by gross and histological analyses of the lungs from days 1 to 6 p.i. In addition to pneumonia, the dogs had rhinitis, tracheitis, bronchitis, and bronchiolitis similar to that described in naturally infected dogs (Crawford et al., 2005). There was epithelial necrosis and erosion of the lining of the airways and bronchial glands with neutrophil and macrophage infiltration of the submucosal tissues (FIG. 5, upper panels). Immunohistochemistry detected viral H3 antigen in the epithelial cells of bronchi, bronchioles, and bronchial glands (FIG. 5, lower panels). No bacterial superinfection was present. The respiratory tissues from the 2 sham-inoculated dogs were normal.

US11865172B2. Materials and methods for respiratory disease control in canines (2024-01-09). UNIVERSITY OF FLORIDA RESEARCH FOUNDATION, INC. [US], CORNELL RESEARCH FOUNDATION, INC. [US], The Government of The United States of America as represented by The Secretary of the Department of [US]. Inventors: Patti Cynthia Crawford [US], Paul J. Gibbs [US], Edward J. Dubovi [US], Ruben Omar Donis [US], Jacqueline Katz [US], Alexander I. Klimov [US], Nallakannu P. Lakshmanan [US], Melissa Anne Lum [US], Daniel Ghislena Emiel Goovaerts [NL], Mark William Mellencamp [US], Nancy J. Cox [US], William L. Castleman [US].
Full text: Click here
Patent 2024
Antigens, Viral Autopsy Bacteria Bronchi Bronchioles Bronchiolitis Bronchitis Canis familiaris Epithelial Cells Immunohistochemistry Infection Lung Macrophage Necrosis Neutrophil Pneumonia Respiratory Rate Rhinitis Specific Pathogen Free Superinfection Tissues Tracheitis Virus
4
In Vivo Imaging of MMP Activation in MI
Not available on PMC !

Example 1

We have established the feasibility of in vivo imaging of MMP activation in pigs (Sahul et al. Circ Cardiovasc Imaging 2011, 4:381-391) and dogs (Liu et al. J Nucl Med 2011, 52(3):453-60) post-MI. The data derived in pigs involved surgical occlusion of two marginal branches of the left circumflex artery and resulted in regional activation of MMPs in the inferolateral wall. (Sahul et al. Circ Cardiovasc Imaging 2011, 4:381-391). This surgical model caused significant activation of MMPs in the surgical wound adjacent to both the atria and ventricles of heart, complicating in vivo imaging. The studies in dogs employed percutaneous balloon occlusion of left anterior descending artery, avoided the surgical intervention, and resulted in improved image quality. In these recently published porcine studies with serial SPECT/CT imaging, we demonstrated focal uptake of the MMP-targeted agent 99mTc-RP805 within the infarcted lateral wall, which peaked at ˜2 weeks post injury, and remained elevated at 4 weeks post occlusion. Early MMP activity at 1 week post-MI predicted late post MI ventricular remodeling (FIG. 1).

US11865195B2. Evaluation of presence of and vulnerability to atrial fibrillation and other indications using matrix metalloproteinase-based imaging (2024-01-09). Lantheus Medical Imaging, Inc. [US], Yale University [US]. Inventors: Albert J. Sinusas [US], Joseph G. Akar [US], Richard R. Cesati [US], Heike S. Radeke [US], Stephen B. Haber [US].
Full text: Click here
Patent 2024
Arterial Occlusion Atrial Fibrillation Canis familiaris Dental Occlusion Heart Atrium Heart Ventricle Injuries Interstitial Collagenase MMP1 protein, human Operative Surgical Procedures Pigs Single Photon Emission Computed Tomography Computed Tomography Surgical Wound Sus scrofa
5
Isolation of Canine Influenza H3N8 Viruses
Not available on PMC !

Example 8

Lung tissues from the 7 dogs were analyzed by quantitative real-time RT-PCR assays that detect the M gene of influenza type A and the H3 gene of canine H3N8 influenza A virus. The lungs from all 7 dogs were positive for both the influenza A M gene and the canine influenza H3 gene (Table 8). After 3 passages in MDCK cells, influenza A subtype H3N8 virus was isolated from the lungs of a shelter dog that died after 3 days of pneumonia. This virus was named A/canine/Jacksonville/05 (H3N8) (canine/Jax/05). After 2 passages in embryonated chicken eggs, influenza A subtype H3N8 virus was recovered from the lungs of the pet dog that also died after 3 days of pneumonia. This virus was named A/canine/Miami//05 (H3N8) (canine/Miami/05).

US11865172B2. Materials and methods for respiratory disease control in canines (2024-01-09). UNIVERSITY OF FLORIDA RESEARCH FOUNDATION, INC. [US], CORNELL RESEARCH FOUNDATION, INC. [US], The Government of The United States of America as represented by The Secretary of the Department of [US]. Inventors: Patti Cynthia Crawford [US], Paul J. Gibbs [US], Edward J. Dubovi [US], Ruben Omar Donis [US], Jacqueline Katz [US], Alexander I. Klimov [US], Nallakannu P. Lakshmanan [US], Melissa Anne Lum [US], Daniel Ghislena Emiel Goovaerts [NL], Mark William Mellencamp [US], Nancy J. Cox [US], William L. Castleman [US].
Full text: Click here
Patent 2024
Biological Assay Canis familiaris Chickens Eggs Genes Influenza A virus isolation Lung Madin Darby Canine Kidney Cells Pneumonia Pneumonia, Viral Real-Time Polymerase Chain Reaction Tissues Virus Virus Vaccine, Influenza

Top products related to «Canis familiaris»

1
Fetal bovine serum (fbs) by Thermo Fisher Scientific
Sourced in United States, China, United Kingdom, Germany, Australia, Japan, Canada, Italy, France, Switzerland, New Zealand, Brazil, Belgium, India, Spain, Israel, Austria, Poland, Ireland, Sweden, Macao, Netherlands, Denmark, Cameroon, Singapore, Portugal, Argentina, Holy See (Vatican City State), Morocco, Uruguay, Mexico, Thailand, Sao Tome and Principe, Hungary, Panama, Hong Kong, Norway, United Arab Emirates, Czechia, Russian Federation, Chile, Moldova, Republic of, Gabon, Palestine, State of, Saudi Arabia, Senegal
Fetal Bovine Serum (FBS) is a cell culture supplement derived from the blood of bovine fetuses. FBS provides a source of proteins, growth factors, and other components that support the growth and maintenance of various cell types in in vitro cell culture applications.
2
Dulbecco modified eagle medium (dmem) by Thermo Fisher Scientific
Sourced in United States, China, United Kingdom, Germany, France, Australia, Canada, Japan, Italy, Switzerland, Belgium, Austria, Spain, Israel, New Zealand, Ireland, Denmark, India, Poland, Sweden, Argentina, Netherlands, Brazil, Macao, Singapore, Sao Tome and Principe, Cameroon, Hong Kong, Portugal, Morocco, Hungary, Finland, Puerto Rico, Holy See (Vatican City State), Gabon, Bulgaria, Norway, Jamaica
DMEM (Dulbecco's Modified Eagle's Medium) is a cell culture medium formulated to support the growth and maintenance of a variety of cell types, including mammalian cells. It provides essential nutrients, amino acids, vitamins, and other components necessary for cell proliferation and survival in an in vitro environment.
3
Streptomycin by Thermo Fisher Scientific
Sourced in United States, United Kingdom, Germany, China, France, Canada, Australia, Japan, Switzerland, Italy, Belgium, Israel, Austria, Spain, Netherlands, Poland, Brazil, Denmark, Argentina, Sweden, New Zealand, Ireland, India, Gabon, Macao, Portugal, Czechia, Singapore, Norway, Thailand, Uruguay, Moldova, Republic of, Finland, Panama
Streptomycin is a broad-spectrum antibiotic used in laboratory settings. It functions as a protein synthesis inhibitor, targeting the 30S subunit of bacterial ribosomes, which plays a crucial role in the translation of genetic information into proteins. Streptomycin is commonly used in microbiological research and applications that require selective inhibition of bacterial growth.
4
Penicillin streptomycin by Thermo Fisher Scientific
Sourced in United States, Germany, United Kingdom, China, Canada, France, Japan, Australia, Switzerland, Israel, Italy, Belgium, Austria, Spain, Gabon, Ireland, New Zealand, Sweden, Netherlands, Denmark, Brazil, Macao, India, Singapore, Poland, Argentina, Cameroon, Uruguay, Morocco, Panama, Colombia, Holy See (Vatican City State), Hungary, Norway, Portugal, Mexico, Thailand, Palestine, State of, Finland, Moldova, Republic of, Jamaica, Czechia
Penicillin/streptomycin is a commonly used antibiotic solution for cell culture applications. It contains a combination of penicillin and streptomycin, which are broad-spectrum antibiotics that inhibit the growth of both Gram-positive and Gram-negative bacteria.
5
Penicillin by Thermo Fisher Scientific
Sourced in United States, United Kingdom, Germany, China, France, Canada, Japan, Australia, Switzerland, Italy, Israel, Belgium, Austria, Spain, Brazil, Netherlands, Gabon, Denmark, Poland, Ireland, New Zealand, Sweden, Argentina, India, Macao, Uruguay, Portugal, Holy See (Vatican City State), Czechia, Singapore, Panama, Thailand, Moldova, Republic of, Finland, Morocco
Penicillin is a type of antibiotic used in laboratory settings. It is a broad-spectrum antimicrobial agent effective against a variety of bacteria. Penicillin functions by disrupting the bacterial cell wall, leading to cell death.
6
Rneasy mini kit by Qiagen
Sourced in Germany, United States, United Kingdom, Netherlands, Spain, Japan, Canada, France, China, Australia, Italy, Switzerland, Sweden, Belgium, Denmark, India, Jamaica, Singapore, Poland, Lithuania, Brazil, New Zealand, Austria, Hong Kong, Portugal, Romania, Cameroon, Norway
The RNeasy Mini Kit is a laboratory equipment designed for the purification of total RNA from a variety of sample types, including animal cells, tissues, and other biological materials. The kit utilizes a silica-based membrane technology to selectively bind and isolate RNA molecules, allowing for efficient extraction and recovery of high-quality RNA.
7
L glutamine by Thermo Fisher Scientific
Sourced in United States, United Kingdom, Germany, France, Canada, Switzerland, Italy, Australia, Belgium, China, Japan, Austria, Spain, Brazil, Israel, Sweden, Ireland, Netherlands, Gabon, Macao, New Zealand, Holy See (Vatican City State), Portugal, Poland, Argentina, Colombia, India, Denmark, Singapore, Panama, Finland, Cameroon
L-glutamine is an amino acid that is commonly used as a dietary supplement and in cell culture media. It serves as a source of nitrogen and supports cellular growth and metabolism.
8
Trizol reagent by Thermo Fisher Scientific
Sourced in United States, China, Japan, Germany, United Kingdom, Canada, France, Italy, Australia, Spain, Switzerland, Netherlands, Belgium, Lithuania, Denmark, Singapore, New Zealand, India, Brazil, Argentina, Sweden, Norway, Austria, Poland, Finland, Israel, Hong Kong, Cameroon, Sao Tome and Principe, Macao, Taiwan, Province of China, Thailand
TRIzol reagent is a monophasic solution of phenol, guanidine isothiocyanate, and other proprietary components designed for the isolation of total RNA, DNA, and proteins from a variety of biological samples. The reagent maintains the integrity of the RNA while disrupting cells and dissolving cell components.
9
Lipofectamine 2000 by Thermo Fisher Scientific
Sourced in United States, China, Germany, United Kingdom, Canada, Japan, France, Italy, Switzerland, Australia, Spain, Belgium, Denmark, Singapore, India, Netherlands, Sweden, New Zealand, Portugal, Poland, Israel, Lithuania, Hong Kong, Argentina, Ireland, Austria, Czechia, Cameroon, Taiwan, Province of China, Morocco
Lipofectamine 2000 is a cationic lipid-based transfection reagent designed for efficient and reliable delivery of nucleic acids, such as plasmid DNA and small interfering RNA (siRNA), into a wide range of eukaryotic cell types. It facilitates the formation of complexes between the nucleic acid and the lipid components, which can then be introduced into cells to enable gene expression or gene silencing studies.
10
Fetal bovine serum (fbs) by Merck Group
Sourced in United States, Germany, United Kingdom, Japan, Italy, China, Macao, Switzerland, France, Canada, Sao Tome and Principe, Spain, Australia, Ireland, Poland, Belgium, Denmark, India, Sweden, Israel, Austria, Brazil, Czechia, Netherlands, Portugal, Norway, Holy See (Vatican City State), New Zealand, Hungary, Senegal, Argentina, Thailand, Singapore, Ukraine, Mexico
FBS, or Fetal Bovine Serum, is a commonly used cell culture supplement. It is derived from the blood of bovine fetuses and provides essential growth factors, hormones, and other nutrients to support the growth and proliferation of a wide range of cell types in vitro.

More about "Canis familiaris"

Canis familiaris, commonly known as the domestic dog, is a subspecies of the gray wolf (Canis lupus) and one of the most widely kept companion animals worldwide.
This versatile species has been selectively bred for a variety of purposes, including companionship, herding, hunting, and service roles.
Canis familiaris, or the dog, demonstrates a remarkable diversity in size, appearance, and behavior, making it a fascinating subject for research across multiple disciplines.
Whether exploring the complexities of canine cognition, investigating canine health and disease, or studying the unique bond between humans and their canine companions, the domestic dog offers a wealth of opportunities for scientific discovery and advancement.
Researchers often utilize various cell culture media and reagents, such as Fetal Bovine Serum (FBS), Dulbecco's Modified Eagle Medium (DMEM), Streptomycin, Penicillin/Streptomycin, Penicillin, RNeasy Mini Kit, L-glutamine, TRIzol reagent, and Lipofectamine 2000, to support their studies on Canis familiaris.
The domestic dog, or Canis lupus familiaris, is a versatile and captivating subject of study, with applications ranging from veterinary medicine and animal behavior to genetics and evolutionary biology.
Researchers can leverage the latest tools and techniques to unravel the mysteries of this fascinating species and advance our understanding of the unique bond between humans and their canine companions.