All in vivo murine studies were performed under an approved protocol by the Emory University IACUC. The mouse mammary carcinoma cell line 4T1, which stably expresses a firefly luciferase gene, was obtained from Dr. Lily Yang at Emory University (Atlanta, GA). 4T1 cells were cultured in DMEM containing 10% FBS and 1X antibiotic/antimycotic agent. Prior to injection into mice, the cells were washed two times with PBS and diluted in sterile PBS to a final concentration of 2 × 107 cells/mL. Mammary tumors were inoculated into nude mice by the subcutaneous administration of 2 × 106 4T1 cells into the mouse flank. Once the tumors were approximately 4 mm in diameter, ICG was administered intravenously (i.v.) via a tail vein at a dose of 357 μg/kg. After 24 h, mice were anesthetized by intraperitoneal (i.p.) injection of a 2.5% solution of tribromoethanol (350 mg/kg). Tumor-bearing mice undergoing bioluminescence imaging were administered i.p. 100 uL of a luciferin solution (30 mg/ml). Bioluminescent images were acquired on a Kodak In-Vivo FX Imaging System (Carestream Molecular Imaging; Rochester, NY). Corresponding bright-field images were taken for anatomical reference of the bioluminescence signal. A series of spectra were acquired on tumor-bearing mice using the SpectroPen. First, the position of the SpectroPen was fixed to about 1–2 cm above the location of the acquisition area on the mouse. Spectra were collected in 1 s and were obtained from several locations, including directly over the center of the tumor and the peritumoral region. After the spectra were acquired, the integrated signal intensity was calculated. The signal intensity was compared to both the bright-field anatomical location and the bioluminescence signal.
>
Living Beings
>
Plant
>
Lilium
Lilium
Lilium: An AI-powered platform that empowers researchers to optimize research protocols and enhance reproducibility.
Discover relevant protocols from literature, preprints, and patents, and leverage AI-driven comparisons to identify the best protocols and products for your research needs.
Simplify your workflow and improve your outcomes with Lilium's cutting-edegetools.
Experience the difference today!
Discover relevant protocols from literature, preprints, and patents, and leverage AI-driven comparisons to identify the best protocols and products for your research needs.
Simplify your workflow and improve your outcomes with Lilium's cutting-edegetools.
Experience the difference today!
Most cited protocols related to «Lilium»
Animal Mammary Neoplasms
Antibiotics
Cells
Genes
Institutional Animal Care and Use Committees
Lilium
Luciferases, Firefly
Luciferins
MCF-7 Cells
Mice, Nude
Mus
Neoplasms
Sterility, Reproductive
Tail
tribromoethanol
Veins
The toxicity study used Yellow-fever mosquito larvae. This species is commonly used by the World Health Organization for insecticide evaluation (WHO 1981 ). Sea lily samples were weighed out and mixed with appropriate amounts of methanol resulting in a 1% stock solution. These 1% solutions were then serially diluted (1:1) with methanol to 12 concentrations ranging from 10,000 to 4.9 ppm. The toxicity assays were performed in a 96-well microtitre plate with third instar larva of A. aegypti according to the procedure described by Chio (2007) . Exactly, 100 µl of sea lily sample was transferred to a 96-well plate and allowed to evaporate to complete dryness by a heat block. Samples were reconstituted with 100 µl of 0.01% Keflin solution followed by another 100 µl of water containing several third instar mosquito larvae. Methanol and 0.5% permethrin were adopted as negative and positive controls, respectively. Larvae mobility and mortality 24-hr post-treatment were recorded with “+” for all kill, “±” for partial kill, and “−” for no kill. Four replicates were adopted for each treatment group. Any samples that completely killed the mosquitoes at 156 ppm or higher concentrations were retested at lower concentrations. Another serial dilution (1:1) starting at 200 ppm was used for the retesting. Methanol and 0.5% permethrin were again adopted as negative and positive controls for the retesting. The minimum concentration that provided the complete control of the mosquito larvae was defined as the minimum inhibition concentration (MIC). The MIC method has been demonstrated to match well with that of LC50 by comparison side-by-side with the LC50 values of five common mosquito larvacides (Chio 2007 ). This study adopts the MIC method instead of the LC50 method, because MIC is simpler than LC50, and can handle higher sample volumes.
Biological Assay
Culicidae
Insecticides
Keflin
Larva
Lilium
Methanol
Minimum Inhibitory Concentration
Permethrin
Range of Motion, Articular
Technique, Dilution
Yellow Fever
SMRU provides healthcare to refugees and migrants on the Thai-Myanmar border, including weekly screening for malaria in pregnant women due to a lack of other effective preventive measures in this area [24 (link)]. SMRU has been collecting longitudinal data of pregnant women presenting to antenatal care since 1986 representing, to the best of our knowledge, the largest longitudinal dataset of malaria in pregnancy to date. Methods for estimating GA at SMRU clinics have evolved over time, and these changes need to be considered when analysing maternal and newborn data from this 28-year period. Monthly SFH measurement was the predominant method for determining GA until 1992. Between 1992 and 1994 there was a gradual transition from SFH to the Dubowitz Gestational Age Assessment, though SFH continued to be routinely collected. Ultrasound was introduced in 2001 and became routine in 2002, after which Dubowitz exams were only performed on newborns whose mother hadn’t received timely ultrasound assessments (i.e. before 24 weeks gestation). Although LMP has been routinely collected in this population, many women (more than two-thirds) are unable to recall the date due to low literacy rates and unfamiliarity with Gregorian calendars [7 (link)].
SMRU ultrasound practice has also evolved over time, and is informed by the British Medical Ultrasound Society (BMUS) guidelines and local conditions. All women are encouraged to attend the antenatal clinic as early as possible. At the first visit, ultrasound is used to date pregnancies using CRL biometry between 7+0 and 13+6 weeks gestation (or between 7+0 to 10+6 weeks in the early years of ultrasound practice at SMRU, as CRL estimates between 11+0 and 13+6 weeks gestation were avoided to reduce error associated with a flexed fetus, which requires ultrasonographers to overcome a learning curve). For women presenting between 14+0 and 23+6 weeks gestation, BPD was used until 2007, after which HC became the preferred biometric for dating after 14 weeks [25 ]. The Robinson and Fleming formula is used for estimating GA from CRL biometry [26 (link)], the Altman and Chitty formula for estimating GA from HC biometry [25 ,27 (link)], and the formula of Hadlock et al is used for estimating GA from BPD biometry [16 (link)].
The equipment and quality control of the sonographers at SMRU have been detailed previously [1 (link),7 (link)]. Associate Professor Lily Dubowitz introduced the Dubowitz gestational age assessment in 1994 and a quality control program was established in 1995 [28 (link)]. The staff involved in the Dubowitz assessment of gestational age were initially quality controlled against Associate Professor Dubowitz personally, and later against a series of test cards at six-monthly intervals. Details of SFH measurement at SMRU have also been detailed previously [13 (link)].
SMRU ultrasound practice has also evolved over time, and is informed by the British Medical Ultrasound Society (BMUS) guidelines and local conditions. All women are encouraged to attend the antenatal clinic as early as possible. At the first visit, ultrasound is used to date pregnancies using CRL biometry between 7+0 and 13+6 weeks gestation (or between 7+0 to 10+6 weeks in the early years of ultrasound practice at SMRU, as CRL estimates between 11+0 and 13+6 weeks gestation were avoided to reduce error associated with a flexed fetus, which requires ultrasonographers to overcome a learning curve). For women presenting between 14+0 and 23+6 weeks gestation, BPD was used until 2007, after which HC became the preferred biometric for dating after 14 weeks [25 ]. The Robinson and Fleming formula is used for estimating GA from CRL biometry [26 (link)], the Altman and Chitty formula for estimating GA from HC biometry [25 ,27 (link)], and the formula of Hadlock et al is used for estimating GA from BPD biometry [16 (link)].
The equipment and quality control of the sonographers at SMRU have been detailed previously [1 (link),7 (link)]. Associate Professor Lily Dubowitz introduced the Dubowitz gestational age assessment in 1994 and a quality control program was established in 1995 [28 (link)]. The staff involved in the Dubowitz assessment of gestational age were initially quality controlled against Associate Professor Dubowitz personally, and later against a series of test cards at six-monthly intervals. Details of SFH measurement at SMRU have also been detailed previously [13 (link)].
Full text: Click here
Care, Prenatal
Fetus
Gestational Age
Infant, Newborn
Learning Curve
Lilium
Malaria
Mental Recall
Migrants
Mothers
Pregnancy
Pregnant Women
Refugees
Thai
Ultrasonography
Woman
pTH-Ubi-Lifeact-mEGFP was constructed via multi-site gateway (Invitrogen). Entry clones containing the Lifeact peptide and mEGFP were generated via BP clonase from PCR products. For Lifeact, the first 51 bp of the coding sequence of the ABP140 gene were amplified from yeast genomic DNA, using primers: LifeactB1F-GGGGACAAGTTTGTACAAAAAAGCAGGCTTAATGGGTGTCGCAGATTTG , and LifeactB5rR-GGGGACAACTTTTGTATACAAAGTTGTTTCTTCCTTTGAGATGCTTTC . For mEGFP, we used primers: attB2-mEGFP-STOP-r-GGGGACCACTTTGTACAAGAAAGCTGGGTATTACTTGTACAGCTCGTCCATGCC and attB5-mEGFP-STOP-f-GGGGACAACTTTGTATACAAAAGTTGTGGTGAGCAAGGGCGAGGAG . The entry clones generated by the BP clonase reaction were sequenced and cloned together into pTH-Ubi-Gate [2] (link) via LR clonase. The resulting expression construct was verified by restriction digest. For stable transformation, plasmids were digested with SwaI and transformed using standard procedures [13] (link). Stable plants were identified by the resistance to hygromycin, after periods of release from selection.
Lifeact-mEGFP was amplified out of pTH-Ubi-Lifeact-mEGFP using the sense primerGGGGGATCCATGGGTGTCGCAGATTTGAT and the anti-sense primer CACGTCGACTTACTTGTACAGCTCGTCC . For tobacco pollen expression, the fragment was then digested with Bam HI and Sal I and inserted into a modified pBS SKII+ that includes the Lat52 promoter [34] . For lily expression, the same construct was subcloned into pBS SKII+ under the control of the zmC13 promoter using the same enzymes [35] (link).
Lifeact-mEGFP was amplified out of pTH-Ubi-Lifeact-mEGFP using the sense primer
Full text: Click here
Enzymes
Genes
Genome
hygromycin A
Lilium
Nicotiana
Oligonucleotide Primers
Open Reading Frames
Peptides
Plants
Plasmids
Pollen
Saccharomyces cerevisiae
For the analysis of Latrunculin B effects on F-actin, moss was cultured in PpNO3 media for 3–5 days, on top of cellophane disks. Pieces of cellophane containing protonemata were cut, flipped, and the protonemata were placed in direct contact with an agar pad containing Hoagland's medium and Latrunculin B at the indicated concentration. The cellophane was removed, 5 µl of liquid medium containing the same concentration of Latrunculin B were added, and a coverslip placed on top. The chamber was sealed with melted VALAP. Images were acquired with an interval of 10–20 min after chamber preparation. Control preparations contained DMSO at 0.2% in medium. Multiple cells and chambers were analyzed with identical results.
For the Latrunculin B sensitivity assay in moss, cells were prepared in the same way as for the growth assay (see above). Protoplasts were plated on small cellophane circles on top of agar in 96 well plates; wells were filled to the top with agar to create a flat surface to deposit the protoplasts. Cells were plated in protoplast regeneration medium in the absence of Latrunculin B for 4 days. At day 4 the cellophane discs were transferred to regular PpNH4 medium containing different amounts of Latrunculin B. Two days after transfer images were acquired from chlorophyll autofluorescence at a 30× zoom as 36-bit RGB color images with a CCD camera (Leica DF300FX) on a fluorescence stereo-microscope (Leica MZ16FA). Filter combinations were: excitation 480/40, dichroic 505 long pass, emission 510 long pass. The red channel of the color images, corresponding to chlorophyll fluorescence was digitally separated. The resulting 12-bit image was thresholded and the solidity estimated as mentioned above. Latrunculin treatments were performed in triplicate; a total of 7 to 38 plants was measured in each replicate. Dose response curves were fitted to the data using the sigmoidal fitting function of the program Origin (Microcal), using a logistic equation and a log10 scale for the concentration of Latrunculin B. The half maximal inhibitory concentration (IC50) was estimated from these fits. To compare the significance of the differences an ANOVA statistical test was used between the means obtained for each replicate. To calculate fractional solidity for each cell line and to plot the data, the following transformation was used: the minimum values obtained from the curve fitting were subtracted from the mean values; the resulting value was divided by the maximum value obtained by curve fitting.
For lily, bombarded pollen was grown on a slide and imaged according to our standard procedure (see above). The growth media was then replaced with fresh media plus 2 nM Latrunculin using a pipette. The procedure was performed twice to ensure that all of the media had been replaced.
For the Latrunculin B sensitivity assay in moss, cells were prepared in the same way as for the growth assay (see above). Protoplasts were plated on small cellophane circles on top of agar in 96 well plates; wells were filled to the top with agar to create a flat surface to deposit the protoplasts. Cells were plated in protoplast regeneration medium in the absence of Latrunculin B for 4 days. At day 4 the cellophane discs were transferred to regular PpNH4 medium containing different amounts of Latrunculin B. Two days after transfer images were acquired from chlorophyll autofluorescence at a 30× zoom as 36-bit RGB color images with a CCD camera (Leica DF300FX) on a fluorescence stereo-microscope (Leica MZ16FA). Filter combinations were: excitation 480/40, dichroic 505 long pass, emission 510 long pass. The red channel of the color images, corresponding to chlorophyll fluorescence was digitally separated. The resulting 12-bit image was thresholded and the solidity estimated as mentioned above. Latrunculin treatments were performed in triplicate; a total of 7 to 38 plants was measured in each replicate. Dose response curves were fitted to the data using the sigmoidal fitting function of the program Origin (Microcal), using a logistic equation and a log10 scale for the concentration of Latrunculin B. The half maximal inhibitory concentration (IC50) was estimated from these fits. To compare the significance of the differences an ANOVA statistical test was used between the means obtained for each replicate. To calculate fractional solidity for each cell line and to plot the data, the following transformation was used: the minimum values obtained from the curve fitting were subtracted from the mean values; the resulting value was divided by the maximum value obtained by curve fitting.
For lily, bombarded pollen was grown on a slide and imaged according to our standard procedure (see above). The growth media was then replaced with fresh media plus 2 nM Latrunculin using a pipette. The procedure was performed twice to ensure that all of the media had been replaced.
Full text: Click here
Agar
Biological Assay
Cell Lines
Cellophane
Cells
Chlorophyll
Culture Media
DNA Replication
F-Actin
Fluorescence
Hypersensitivity
latrunculin B
Lilium
Microscopy, Fluorescence
Mosses
neuro-oncological ventral antigen 2, human
Operator, Genetic
Plants
Pollen
Protoplasts
Psychological Inhibition
Regeneration
Sulfoxide, Dimethyl
Most recents protocols related to «Lilium»
Based on this study’s principle that the suburbs and downtown areas should be covered during the field measurement, the bus route No. 406 in Dalian was selected (Lily Villa-Hope Square, with a one-way running distance of 13.5 km and a duration of around 40 min) for the preliminary investigation. This route passes through the urban area of Dalian, has a large passenger flow, and is characterized by traffic jam during the morning and nightfall rush hours, which are typical features of bus lines through the city center. Due to the requirements of environmental protection, the buses in Dalian are basically powered by liquefied natural gas (LNG). Detailed information of the vehicle is provided in Table S1 and Fig. S1 . Our experiment has no extra effect on the normal operation of the vehicle. During the test, the bus air conditioning system was shut down. As usual, the bus opened the front and rear doors to load and unload passengers at each stop. A complete test route includes the outbound and return. The specific station names are shown in Tables S2 and S3 . Fig. S2 is a satellite map of the tested route.
Digitorenocerebral Syndrome
KM 13
Lanugo
Lilium
Inoculations were done using homogenized virus-infected tissue preserved at −80°C. The virus inoculum consisted of 100 mg of homogeneous N2-frozen infected tissue mixed with 1 ml of phosphate buffer and 10% carborundum (100 mg ml−1). For testing the susceptibility of Arabidopsis to different viruses, 12 plants per developmental stage were inoculated for each virus.
The following viruses were used: Begomovirus (tomato leaf curl New Delhi virus, ToLCNDV), Betacarmovirus (turnip crinkle virus, TCV), Caulimovirus (cauliflower mosaic virus, CaMV), Cucumovirus (CMV), Potexvirus (pepino mosaic virus, PepMV) and Potyvirus (lettuce mosaic virus, LMV; TuMV; watermelon mosaic virus, WMV; and zucchini yellow mosaic virus, ZYMV). Virus stocks were generated by harvesting and homogenizing infected tissue of Arabidopsis (CaMV, TCV and TuMV-DV), Nicotiana benthamiana Domin (CMV, LMV, PepMV, TuMV-AS and WMV) or Chenopodium quinoa Willdenow (ZYMV and ToLCNDV). The two isolates of TuMV used differ in their degree of adaptation to Arabidopsis: DV has an increased virulence and fixed mutations (CI/T1293I and VPg/N2039H) in comparation with AS. The naive AS isolate came from strain YC5 (GenBank, AF53055.2), originally obtained from calla lily (Zantedeschia sp.), which was cloned under the 35S promoter and NOS terminator, resulting in the p35STunos infectious clone [56 (link)]. The Arabidopsis-adapted DV isolate was obtained after experimentally evolving the AS isolate for 12 passages in prebolting Col-0 plants [3 (link)].
For the evolution experiment, 10 plants were inoculated per combination of developmental stage and TuMV strain. Fourteen days post-inoculation (dpi), the symptomatic infected plants were collected, making a pool of infected tissue that was homogenized and used as inoculum to start a five-passages evolution. For each one of the three developmental stages, three independent lineages were established to serve as biological replicates of the evolutionary process (figure 2 ).
![]()
The following viruses were used: Begomovirus (tomato leaf curl New Delhi virus, ToLCNDV), Betacarmovirus (turnip crinkle virus, TCV), Caulimovirus (cauliflower mosaic virus, CaMV), Cucumovirus (CMV), Potexvirus (pepino mosaic virus, PepMV) and Potyvirus (lettuce mosaic virus, LMV; TuMV; watermelon mosaic virus, WMV; and zucchini yellow mosaic virus, ZYMV). Virus stocks were generated by harvesting and homogenizing infected tissue of Arabidopsis (CaMV, TCV and TuMV-DV), Nicotiana benthamiana Domin (CMV, LMV, PepMV, TuMV-AS and WMV) or Chenopodium quinoa Willdenow (ZYMV and ToLCNDV). The two isolates of TuMV used differ in their degree of adaptation to Arabidopsis: DV has an increased virulence and fixed mutations (CI/T1293I and VPg/N2039H) in comparation with AS. The naive AS isolate came from strain YC5 (GenBank, AF53055.2), originally obtained from calla lily (Zantedeschia sp.), which was cloned under the 35S promoter and NOS terminator, resulting in the p35STunos infectious clone [56 (link)]. The Arabidopsis-adapted DV isolate was obtained after experimentally evolving the AS isolate for 12 passages in prebolting Col-0 plants [3 (link)].
For the evolution experiment, 10 plants were inoculated per combination of developmental stage and TuMV strain. Fourteen days post-inoculation (dpi), the symptomatic infected plants were collected, making a pool of infected tissue that was homogenized and used as inoculum to start a five-passages evolution. For each one of the three developmental stages, three independent lineages were established to serve as biological replicates of the evolutionary process (
(a) Experimental evolution design. (b) Box plot representation of rates of phenotypic evolution for lineages evolved from the naive AS (left) and the preadapted DV (right) turnip mosaic virus (TuMV) isolates. Rates are calculated for both AUDPS (area under the disease progression stairs, upper row) and AUSIPS (area under the intensity progression stairs; lower row). (c) Box plot representation of evolved (grey) lineages' infection traits (AUDPSon the left; AUSIPS on the right) compared with their corresponding ancestral (white) viruses. Upper row shows the relative phenotype of viruses evolved from the naive AS isolate, while the lower row represents the values for viruses evolved from the preadapted DV isolate. In the box plot, horizontal lines represent the median, and boxes represent the interquartile range (IQR), and error bars ±1.5 × IQR.
Full text: Click here
Arabidopsis
Begomovirus
Biological Evolution
Biopharmaceuticals
Buffers
Calla Plant
carborundum
Cauliflower Mosaic Virus
Caulimovirus
Chenopodium quinoa
Clone Cells
Cucumovirus
Disease Progression
Freezing
Infection
Lettuce mosaic virus
Lilium
Mutation
Nicotiana
Pepino mosaic virus
Phenotype
Phosphates
Plant Development
Plants
Potexvirus
Potyvirus
Strains
Susceptibility, Disease
Tissues
Tomato leaf curl New Delhi virus
Turnip crinkle virus
Turnip mosaic virus
Vaccination
Virulence
Virus
Watermelon mosaic virus
Zantedeschia
Zucchini yellow mosaic virus
The headspace analysis was performed with a commercial PEN3.5 E-nose (Airsense Analytics, GmBH, Schwerin, Germany). The system contained 10 metal oxide sensors (namely, W1C, W5S, W3C, W6S, W5C, W1S, W1W, W2S, W2W and W3S). Prior to detection, each sample (2 g of scale samples) was placed in an airtight glass vial and closely capped with a PTFE–silicone stopper. Then, the samples were kept at 25 ± 1 °C for approximately 40 min (headspace generation time). The detection time of the sample was 120 s, the cleaning time of the sensor was 300 s and the adjustment time of automatic zero was 5 s. All samples were run with three repetitions.
The values of 101~110 s for each measurement using an E-nose were imported into WinMuster software and repeated 3 times to generate a principal component analysis (PCA) figure. PCA employs the idea of dimensionality reduction to simplify problems. A plurality of number indexes interconnected to each other were translated into several comprehensive and unrelated indicators, which are the principal components of the original multiple indexes. The between-group linkage method with a metric of Euclidean distance was performed to apply hierarchical cluster analysis (HCA) in this study. The merged data presented as a dendrogram, where the horizontal axis represented the Euclidean distance amongst groups and the vertical axis indicated the lily scale flavor similarity. The data obtained in Winmuster were averaged in excel to calculate the response values of the ten electronic metal sensors for the control and H2 fumigation during the storage period, and radar plots were generated using the data analysis tool.
The values of 101~110 s for each measurement using an E-nose were imported into WinMuster software and repeated 3 times to generate a principal component analysis (PCA) figure. PCA employs the idea of dimensionality reduction to simplify problems. A plurality of number indexes interconnected to each other were translated into several comprehensive and unrelated indicators, which are the principal components of the original multiple indexes. The between-group linkage method with a metric of Euclidean distance was performed to apply hierarchical cluster analysis (HCA) in this study. The merged data presented as a dendrogram, where the horizontal axis represented the Euclidean distance amongst groups and the vertical axis indicated the lily scale flavor similarity. The data obtained in Winmuster were averaged in excel to calculate the response values of the ten electronic metal sensors for the control and H2 fumigation during the storage period, and radar plots were generated using the data analysis tool.
Full text: Click here
Epistropheus
Flavor Enhancers
Fumigation
Lilium
Metals
Nose
Oxides
polytetrafluoroethylene-silicone
The fresh bulbs used in this study were obtained from the Xiguoyuan of Qilihe District, Lanzhou, China. The bulbs were vacuum-packed with food-grade materials before storage and transported fresh using preservation cabinets at a storage temperature of 0–2 °C. Single head, consistent size, mechanical damage-free, pest-free and disease-free and white appearance of healthy Lanzhou lily bulbs were selected. The outer two layers of the bulbs and the other inner layers were discarded. The scales of the third, fourth and fifth layers were approximately the same size and similar thickness as experimental materials. The lily scales were rinsed three times with tap water, sterilized with 5% sodium hypochlorite for 15 min, finally washed with distilled water three times and placed on clean filter paper to dry naturally at room temperature. Dried scales (500 g) were placed in the fumigation unit (the fumigation bottle has inlet and outlet ports of air on both sides, with valves to control opening and closing). The H2 generator (QL-300, Saikesaisi Hydrogen Energy Co., Ltd., Shandong, China) was connected to the air inlet with a hose and continuously pumped in the hydrogen for 10 min. H2 fumigation in Lanzhou lily scales was continued for 3 d, which was renewed every 12 h. Fumigation bottles in the control group were filled with air. After fumigation, the lily scales (50 g) were randomly weighed and placed in a preservation box at room temperature (23 ± 2 °C) for 15 d. The sample was taken and photographed every three days to determine the relevant indicators. Each experiment was conducted in three biological replicates.
Full text: Click here
Biologic Preservation
Biopharmaceuticals
Food
Fumigation
Head
Hydrogen
Lilium
Plague
Plant Bulb
Sodium Hypochlorite
Vacuum
The surface color change of scales was estimated using a colorimeter (Model CR-400, Minolta, Tokyo, Japan), which showed the L*, a* and b* values by CIE color. The colorimeter was calibrated using a standard white tile (L* = 97.40, a* = −0.91, b* = 1.53).
The browning index (BI), which represents the purity of brown color (Palou et al., 1999), was calculated according to the following equation. Fresh lily scale as reference scale was shown inFigure A1 .
The browning index (BI), which represents the purity of brown color (Palou et al., 1999), was calculated according to the following equation. Fresh lily scale as reference scale was shown in
Full text: Click here
Lilium
Top products related to «Lilium»
Sourced in United States, Germany, United Kingdom, China, Australia, France, Italy, Canada, Sao Tome and Principe, Japan, Macao, Israel, Switzerland, Spain, Belgium, India, Poland, Sweden, Denmark, Norway, Ireland, Mexico, New Zealand, Brazil, Singapore, Netherlands
D-glucose is a type of monosaccharide, a simple sugar that serves as the primary source of energy for many organisms. It is a colorless, crystalline solid that is soluble in water and other polar solvents. D-glucose is a naturally occurring compound and is a key component of various biological processes.
Sourced in United States, Germany, United Kingdom, China, Japan, Italy, Sao Tome and Principe, Macao, France, Australia, Switzerland, Canada, Denmark, Spain, Israel, Belgium, Ireland, Morocco, Brazil, Netherlands, Sweden, New Zealand, Austria, Czechia, Senegal, Poland, India, Portugal
Dexamethasone is a synthetic glucocorticoid medication used in a variety of medical applications. It is primarily used as an anti-inflammatory and immunosuppressant agent.
Sourced in United States, China, United Kingdom, Germany, France, Australia, Canada, Japan, Italy, Switzerland, Belgium, Austria, Spain, Israel, New Zealand, Ireland, Denmark, India, Poland, Sweden, Argentina, Netherlands, Brazil, Macao, Singapore, Sao Tome and Principe, Cameroon, Hong Kong, Portugal, Morocco, Hungary, Finland, Puerto Rico, Holy See (Vatican City State), Gabon, Bulgaria, Norway, Jamaica
DMEM (Dulbecco's Modified Eagle's Medium) is a cell culture medium formulated to support the growth and maintenance of a variety of cell types, including mammalian cells. It provides essential nutrients, amino acids, vitamins, and other components necessary for cell proliferation and survival in an in vitro environment.
Sourced in United States, China, United Kingdom, Germany, Australia, Japan, Canada, Italy, France, Switzerland, New Zealand, Brazil, Belgium, India, Spain, Israel, Austria, Poland, Ireland, Sweden, Macao, Netherlands, Denmark, Cameroon, Singapore, Portugal, Argentina, Holy See (Vatican City State), Morocco, Uruguay, Mexico, Thailand, Sao Tome and Principe, Hungary, Panama, Hong Kong, Norway, United Arab Emirates, Czechia, Russian Federation, Chile, Moldova, Republic of, Gabon, Palestine, State of, Saudi Arabia, Senegal
Fetal Bovine Serum (FBS) is a cell culture supplement derived from the blood of bovine fetuses. FBS provides a source of proteins, growth factors, and other components that support the growth and maintenance of various cell types in in vitro cell culture applications.
Sourced in Germany, United States, United Kingdom, Canada, China, Spain, Netherlands, Japan, France, Italy, Switzerland, Australia, Sweden, Portugal, India
The DNeasy Plant Mini Kit is a lab equipment product designed for the isolation and purification of DNA from plant samples. It utilizes a silica-based membrane technology to extract and concentrate DNA effectively from a variety of plant materials.
Sourced in United States
Peroxidase-conjugated anti-mouse and anti-rabbit IgG is a laboratory reagent used for detection and quantification of mouse and rabbit immunoglobulin G (IgG) in various immunoassays. The peroxidase enzyme is conjugated to the antibody, allowing for colorimetric or chemiluminescent detection upon substrate addition.
Sourced in United States, Germany, United Kingdom, Italy, France, Switzerland, Brazil, China, Poland, Macao, Spain, Canada, Japan, Australia, Austria, Belgium, Israel, Sao Tome and Principe, Netherlands, India, Sweden, Ireland, Argentina, Czechia, Denmark, New Zealand, Hungary, Mexico, Holy See (Vatican City State), Ukraine
Penicillin is a type of antibacterial drug that is widely used in medical and laboratory settings. It is a naturally occurring substance produced by certain fungi, and it is effective against a variety of bacterial infections. Penicillin works by inhibiting the growth and reproduction of bacteria, making it a valuable tool for researchers and medical professionals.
Sourced in United States, Germany, China, France, Macao, Italy, Sao Tome and Principe
Rosiglitazone is a synthetic compound used as a laboratory reagent. It is a member of the thiazolidinedione class of drugs and functions as a selective agonist for the peroxisome proliferator-activated receptor gamma (PPAR-gamma). Rosiglitazone is commonly used in research studies to investigate its effects on cellular and metabolic processes.
Sourced in United States, Germany, United Kingdom, China, Canada, France, Japan, Australia, Switzerland, Israel, Italy, Belgium, Austria, Spain, Gabon, Ireland, New Zealand, Sweden, Netherlands, Denmark, Brazil, Macao, India, Singapore, Poland, Argentina, Cameroon, Uruguay, Morocco, Panama, Colombia, Holy See (Vatican City State), Hungary, Norway, Portugal, Mexico, Thailand, Palestine, State of, Finland, Moldova, Republic of, Jamaica, Czechia
Penicillin/streptomycin is a commonly used antibiotic solution for cell culture applications. It contains a combination of penicillin and streptomycin, which are broad-spectrum antibiotics that inhibit the growth of both Gram-positive and Gram-negative bacteria.
Sourced in United States, China, Japan, Germany, United Kingdom, Canada, France, Italy, Australia, Spain, Switzerland, Netherlands, Belgium, Lithuania, Denmark, Singapore, New Zealand, India, Brazil, Argentina, Sweden, Norway, Austria, Poland, Finland, Israel, Hong Kong, Cameroon, Sao Tome and Principe, Macao, Taiwan, Province of China, Thailand
TRIzol reagent is a monophasic solution of phenol, guanidine isothiocyanate, and other proprietary components designed for the isolation of total RNA, DNA, and proteins from a variety of biological samples. The reagent maintains the integrity of the RNA while disrupting cells and dissolving cell components.
More about "Lilium"
Lilium is an innovative AI-powered platform that empowers researchers to optimize their research protocols and enhance the reproducibility of their studies.
Developed by PubCompare.ai, Lilium provides researchers with a comprehensive solution to streamline their workflow and improve research outcomes.
At the heart of Lilium is its ability to help researchers discover relevant protocols from a vast repository of literature, preprints, and patents.
Leveraging advanced AI algorithms, Lilium enables users to perform in-depth comparisons of different protocols, identifying the best options for their specific research needs.
This includes not only the protocols themselves, but also the associated products, such as D-glucose, Dexamethasone, DMEM, FBS, DNeasy Plant Mini Kit, Peroxidase-conjugated anti-mouse and anti-rabbit IgG, Penicillin, Rosiglitazone, Penicillin/streptomycin, and TRIzol reagent.
By simplifying the research process and providing researchers with cutting-edge tools, Lilium helps to reduce the time and effort required to set up and execute experiments, ultimately leading to more reliable and reproducible research outcomes.
With its intuitive interface and AI-driven insights, Lilium empowers researchers to make informed decisions, optimize their protocols, and streamline their workflows, all while enhancing the overall quality and impact of their work.
Experience the difference that Lilium can make in your research journey today!
Developed by PubCompare.ai, Lilium provides researchers with a comprehensive solution to streamline their workflow and improve research outcomes.
At the heart of Lilium is its ability to help researchers discover relevant protocols from a vast repository of literature, preprints, and patents.
Leveraging advanced AI algorithms, Lilium enables users to perform in-depth comparisons of different protocols, identifying the best options for their specific research needs.
This includes not only the protocols themselves, but also the associated products, such as D-glucose, Dexamethasone, DMEM, FBS, DNeasy Plant Mini Kit, Peroxidase-conjugated anti-mouse and anti-rabbit IgG, Penicillin, Rosiglitazone, Penicillin/streptomycin, and TRIzol reagent.
By simplifying the research process and providing researchers with cutting-edge tools, Lilium helps to reduce the time and effort required to set up and execute experiments, ultimately leading to more reliable and reproducible research outcomes.
With its intuitive interface and AI-driven insights, Lilium empowers researchers to make informed decisions, optimize their protocols, and streamline their workflows, all while enhancing the overall quality and impact of their work.
Experience the difference that Lilium can make in your research journey today!