Log In Sign up
The largest database of trusted experimental protocols
> Living Beings > Plant > Plant Bulb

Plant Bulb

Plant bulbs are underground storage organs that serve as a way for plants to survive adverse conditions and regrow in favorable seasons.
These structures contain compressed stem and leaf tissue, along with food reserves that enable the plant to rapidly produce new growth.
Bulbs are found in a variety of ornamental and edible plant species, such as tulips, daffodils, onions, and garlic.
Researchers studying plant bulbs can leverage specialized AI-powered tools like PubCompare.ai to enhance their workflow.
These tools help identify the best experimental protocols from literature, preprints, and patents, and provide intelligent comparisons to optimize bulb research and boost productivity.
With PubCompare.ai, scientists can streamline their plant bulb studies and uncover the most effective products and techniques for their investigations.

Most cited protocols related to «Plant Bulb»

1
Locomotor Activity Tracking System
Cited 27 times
We conducted two separate experiments for this paper, the first using Canton S (CS) wild type males (N = 8) and the second using females from both a CASK-β null (CASKP18) (DAM CASK-β N = 30, Track CASK-β N = 30) and a precise excision strain as a wild type genetic control line (CASKP33) (DAM Control N = 30, Track Control N = 29) [19] (link). All flies were raised on a cornmeal-sucrose-agar food in a 25°C incubator with a 12-hr Light/Dark cycle and were 3–5 days old at the start of each experiment. Flies were loaded under CO2 anesthesia into individual glass tubes. Each tube contained an agar/sucrose food plug sufficient to sustain the fly for the duration of the experiment. The tubes were sealed with parafilm at both ends to allow for the fly to be tracked all the way to the end of the tube without visual obstruction. For tracking, the tubes were taped to a piece of white office paper, providing a high visual contrast field against the dark fly and transparent glass tube (Figure 1B). The paper was positioned inside of an incubator under a USB video camera (Logitech, Quickcam for Notebooks). A red compact fluorescent bulb and red LEDs, emitting a wavelength of light not detected well by the fly visual system [4] (link) and incapable of entraining per01 flies (N.D. unpublished observations), were placed into the incubator to provide enough light for the camera to maintain an image when the white lights were off during the night. While Gilestro and Cirelli [20] (link) used infrared (IR) lighting to follow flies in the dark, we achieved better contrast and illumination with red LEDs while also avoiding the excessive heat that we found was generated from the IR emitters. Flies were also loaded into DAM boards as previously described for collecting beam-cross data [21] (link), and run in parallel to the Tracker flies in the same incubator. Data were collected following three days of light∶dark (LD) entrainment to a 12 h∶12 h cycle.
Donelson N., Kim E.Z., Slawson J.B., Vecsey C.G., Huber R, & Griffith L.C. (2012). High-Resolution Positional Tracking for Long-Term Analysis of Drosophila Sleep and Locomotion Using the “Tracker” Program. PLoS ONE, 7(5), e37250.
Full text: Click here
Publication 2012
Agar Anesthesia Diptera Females Food Gene Expression Regulation Light Lighting Males Plant Bulb Strains Sucrose
2
Arabidopsis Molecular Techniques Compendium
Cited 26 times
All wild-type, mutant and transgenic lines were in the Arabidopsis thaliana ecotype Columbia-0 (Col-0). All transgenic and mutant lines were brought to homozygosity before use. The procedures for Arabidopsis husbandry; yeast one-hybrid, two-hybrid, and three-hybrid analyses; biolumenscent imaging; immunoprecipitations; chromatin immunoprecipitations; and hypocotyl measurements were as described previously20 (link),29 (link),30 (link), with modifications detailed in Methods. In all growth chambers, light was supplied at 80 μmol m-2 sec-1 by cool-white fluorescent bulbs at 22 °C. For yeast two-hybrid analyses, SD-WL medium selects for the presence of both bait and prey vectors, and SD-WLHA medium selects for an interaction between bait and prey proteins. IPP2, APX3 and At1g11910 were used to normalize real-time PCR expression analyses, and all primers for quantitative PCR are listed in Supplemental Table 1. ELF4∷ELF4-HA construct includes 580 bp of promoter sequence cloned from Col-0 DNA amplified using primers listed in Supplemental Table 1. The sequence TATGATATCCTTGCGTACCCA is the target of the LUX/NOX amiRNA. Antibodies were generated in rabbits (Sigma Genosys) against either an ELF3 specific peptide (CSIQEERKRYDSSKP), or a full-length LUX protein fused to glutathione-S-transferase (GST). Antibodies were affinity purified against the same ELF3 peptide using a SulfoLink Immobilization kit (Thermo Scientific) or using a GST-LUX affinity column. All immunoprecipitations were performed with Protein G Dynabeads (Invitrogen). For westerns, ACTIN served as a loading control. Blots for ELF4 represent 20% of the total IP sample, as ELF4 must be run on a separate 15% gel, identified by (*), due to its low molecular weight. The dot (·) denotes a background signal arising from the cross-linked HA beads (data not shown). LUX runs as high and low molecular weight isoforms, denoted by (–). Hypocotyl measurements were performed on evenly spaced seedlings grown under 12L:12D, measured on day 10.
Nusinow D.A., Helfer A., Hamilton E.E., King J.J., Imaizumi T., Schultz T.F., Farré E.M, & Kay S.A. (2011). The ELF4-ELF3-LUX Complex Links the Circadian Clock to Diurnal Control of Hypocotyl Growth. Nature, 475(7356), 398-402.
Publication 2011
Actins Animals, Transgenic Antibodies Arabidopsis Arabidopsis thalianas Cloning Vectors Ecotype ELF3 protein, human ELF4 protein, human G-substrate Glutathione S-Transferase Homozygote Hybrids Hypocotyl Immobilization Immunoprecipitation Immunoprecipitation, Chromatin IP 20 Light Oligonucleotide Primers Oryctolagus cuniculus Peptides Plant Bulb Protein Isoforms Proteins Real-Time Polymerase Chain Reaction Saccharomyces cerevisiae Seedlings
3
Comprehensive Plant RNA Isolation Protocol
Cited 24 times
We isolated total RNA from 1115 samples from 695 plant species representing 324 families collected from the field, botanical gardens, greenhouses, growth chambers and axenic cultures. No specific permits were required for the collection of samples as the minority of samples collected directly from the field were taken from public land. None of these samples represent endangered or protected species. Samples included non-vascular plants such as algae, hornworts and mosses, and vascular plants including lycopods, ferns, gymnosperms and angiosperms. We isolated total RNA from tissues categorized into one of eight tissue types, including: i) leaf (489 samples), ii) flower (4), iii) fruit (10), iv) buds (leaf or flower) (15), v) shoot/stem (7), vi) below-ground (12; 10 roots, 2 bulbs), vii) mixed tissues (two or more of tissues i–vi) (276) and viii) algal cells (274). Care was taken to properly differentiate and categorize tissue types, but some samples inevitably had overlapping cell types with other tissue types and we therefore view differences among tissues as conservative patterns. For a subset of 71 species, we also tested the effects of tissue age on RNA quality and sequencing success by comparing “young” freshly expanding leaves and “mature” fully expanded but non-senescing leaves collected from tissue that was pooled from at least two healthy plants grown together in the greenhouse. For these samples we used approximately 0.1–0.5 g of tissue from young leaves and roughly 2× as much (up to 1 g) for old leaves; more tissue was required from mature leaves to achieve equivalent concentrations as young leaves (see Results). The complete data set, including the list of all samples, tissues and data, is provided in Table S1.
Johnson M.T., Carpenter E.J., Tian Z., Bruskiewich R., Burris J.N., Carrigan C.T., Chase M.W., Clarke N.D., Covshoff S., dePamphilis C.W., Edger P.P., Goh F., Graham S., Greiner S., Hibberd J.M., Jordon-Thaden I., Kutchan T.M., Leebens-Mack J., Melkonian M., Miles N., Myburg H., Patterson J., Pires J.C., Ralph P., Rolf M., Sage R.F., Soltis D., Soltis P., Stevenson D., Stewart CN J.r., Surek B., Thomsen C.J., Villarreal J.C., Wu X., Zhang Y., Deyholos M.K, & Wong G.K. (2012). Evaluating Methods for Isolating Total RNA and Predicting the Success of Sequencing Phylogenetically Diverse Plant Transcriptomes. PLoS ONE, 7(11), e50226.
Full text: Click here
Publication 2012
Anthocerotophyta Axenic Culture Cells Cycadopsida Ferns Fruit Histocompatibility Testing Magnoliopsida Minority Groups Mosses Plant Bulb Plant Roots Plants Specimen Collection Stem, Plant Tissues Tracheophyta
4
Laser Fluorescence Imaging of Fossils
Cited 18 times
Laser-stimulated fluorescence (LSF) imaging is a versatile observational technique that has a multitude of paleontological applications. Both automated and manual systems can be used to scan or otherwise observe fossils under laser illumination. A series of common steps apply to any LSF work, these are detailed below.
Laser light is concentrated on a specimen either as a point source for microscopic work, as a divergent light cone for smaller-sized specimens (with the aid of a laser diffuser), or a collimated beam (in which all light rays are parallel) is raster scanned over very large specimens. Since the laser is very bright, it must be blocked with an appropriate filter that still allows the longer wave fluorescence signal to pass through. Proper precautions using laser-blocking protective glasses and manufacturer’s safety protocol should be followed.
The equipment used with this methodology depends on the exact wavelength of light produced by the laser. Specialized light-blocking longpass filters, often used in astronomy, are best-suited for these methods. These particular filters will allow all wavelengths of light longer than a certain wavelength to pass through the filter, however, it will stop all shorter wavelengths. For instance, a red-orange longpass filter (LP580, MidOpt) will allow 91–95% of light between the wavelengths of 600–1100 nm, however, the transmission sharply decreases between 600–520 nm, and by 510 nm, no light passes through the filter (www.midopt.com). A 477 nm blue laser would be efficiently blocked by this filter, but will still allow imaging of longer fluorescent wavelengths. The laser wavelengths and filters for each particular specimen were chosen experimentally via the trial and error method, a procedure that we believe is reasonable given the simplicity of this technique. The setup parameters for each of the five case histories presented in this study are given in Table 1.
Standard UV bulbs can be used in addition to lasers in order to cover a broad range of the light spectrum. Imaging is done in both UVA from 315–400 nm and UVB from 280–315 nm. When working with UV light, photographs can be taken both with and without filters due to the low UV sensitivity of digital camera CCD (charge-coupled device) chips.
No special digital cameras are needed to photograph specimens using laser fluorescence. Typically, digital single lens reflex cameras (DSLRs) capable of manual time exposures (e.g. Nikon D610) with either wide angle or macro lenses are sufficient. Ideally, the photography should be done in a darkroom, basement, or office without windows or with blackout curtains, as any influence of natural light will reduce the clarity of the fluorescence. The use of a tripod is necessary, as the exposure time during photography is typically long—up to several minutes, although this may not be the case for close macro photography. The aperture setting (f-value) should be as low as possible for long-exposure shots.
Multiple types of laser light sources can be used. The more powerful the laser, the better and brighter the fluorescence. For the experiments outlined here, class III lasers in the 300–500 mW category were used. These were well below the threshold that results in radiation damage to the specimens studied. A lab laser, which plugs into the wall and is fairly static, and a high-powered laser pointer that runs off of CR123A lithium batteries, have both been used successfully depending on the locality of the specimen. The benefit of using a lab laser is that it can be used for hours at a time without overheating. It is typically used for precision work and photographing larger specimens. A high-power laser pointer is more portable and adjustable than a lab laser, however it can only be used for ~5 minutes, or else it will overheat and become damaged. If the photographer knows what f-value and shutter speeds are necessary for photography, a laser pointer can be used to great effect. It is excellent for macro photography in the field due to its portability.
A laboratory setup for table-top-sized specimens would typically hold the laser on a fixed mount (Fig 1). The laser itself emits a collimated beam, which results in only a small dot of illumination. This beam can be used as is for maximum flux or be expanded using a diffuser (ARF used a 20-degree diffraction diffuser from Thorlabs). The smaller the angle of the diffuser, the better—i.e. 20 degrees would be better than 50 degrees, as it restricts the beam to a narrower angle and results in a brighter and smaller area of illumination, even if the laser is placed further away from the specimen. The laser should illuminate as much of the specimen as possible, and the diffuser’s cone angle changes the area covered by the laser depending on the laser-to-specimen distance.
Larger specimens can be scanned using a custom device (Fig 2A and 2B). A Powel laser line lens projects a laser line in the Y direction that evenly distributes the laser energy over the length of the line (Fig 2C). A motor scans the entire assembly in the X direction (Fig 2A and 2B). This allows specimens of almost any size to be imaged. The exposure time of the DSLR camera should cover one or more of the X direction scans of the specimen.
For a microscope setup, the collimated laser beam is directed through one of the illumination ports or projected directly onto the specimen. The emitted light, laser and fluorescence, comes back through the microscope’s optical train where a longpass filter is placed either before the objective lens or internally in a filter slot to block the intense laser light. The fluorescence can then be observed and photographed in detail.
Specimen sources for each case history:
Case history 1: Burke Museum of Natural History and Culture, UWBM 103073—feather from Green River Fm.; UWBM 103074—feather from Parachute Member of Green River Fm.
Case history 2: Department of Land and Resources of Liaoning Province, LVH 0026—fish specimen from Jiufotang Fm. [20 (link)]
Case history 3: UWBM 103075—microfossils from Brule Fm.; UWBM 103076—microfossils from Hell Creek Fm.
Case history 4: Gobero specimen housed in the University of Chicago Research Collection, G1B2—juvenile female skeleton from mid-Holocene lake deposits
Case history 5: Institute of Vertebrate Paleontology and Paleoanthropology, Beijing, China, IVPP V13320—Microraptor skull from Jiufotang Fm. [21 (link)]
Kaye T.G., Falk A.R., Pittman M., Sereno P.C., Martin L.D., Burnham D.A., Gong E., Xu X, & Wang Y. (2015). Laser-Stimulated Fluorescence in Paleontology. PLoS ONE, 10(5), e0125923.
Full text: Click here
Publication 2015
Cardiac Arrest Cranium DNA Chips Feathers Fishes Fluorescence Hypersensitivity Lens, Crystalline Light Light Microscopy Lithium Medical Devices Microscopy Plant Bulb Radiation Radionuclide Imaging Reflex Retinal Cone Rivers Safety Skeleton Strains Transmission, Communicable Disease Vertebrates Woman
5
MicroRNA Prediction Models for Animals and Plants
Cited 17 times
For all candidate microRNAs generated in the step above, we calculate several features based on both, the secondary structure and expression derived properties [see Ref. (9 (link)) for a more detailed description]. In a first step, we discard a candidate if (i) its read cluster overlaps with the loop by more than 5 bp in the 5′-arm (on the 3′-arm no overlap is allowed), (ii) it has no hairpin, (iii) it has less than 19 bindings to the putative precursor sequence and (iv) it has less than 11 bindings to the region occupied by the read cluster (putative mature microRNA sequence). For the remaining candidates, the features described in Table 3 are calculated. These features have been selected out of a large pool of possible features applying the CfsSubsetEval algorithm in Weka. Finally, the training of five Random forest models (28 ) for both animals and plants is performed.

Features used for the Random forest prediction models

FeatureUsed for kingdom
Number of bindings in read cluster sequenceAnimal
Normalized mean free energy of precursor sequencePlant and Animal
Number of bindings in precursorAnimal
Length of read clusterPlant and Animal
The corresponding putative maturestar sequence is also present (binary value 0, 1)Plant and Animal
Number of bindings in read cluster divided by the read cluster lengthPlant
Number of reads in read clusterPlant and Animal
Mean free energy of precursor sequencePlant and Animal
Degree of bulb asymmetry in precursorAnimal
The number of bulbs in precursor secondary structurePlant
Hackenberg M., Rodríguez-Ezpeleta N, & Aransay A.M. (2011). miRanalyzer: an update on the detection and analysis of microRNAs in high-throughput sequencing experiments. Nucleic Acids Research, 39(Web Server issue), W132-W138.
Publication 2011
Animals MicroRNAs Plant Bulb Plants

Most recents protocols related to «Plant Bulb»

1
Coating Deposition and Friction Testing
Not available on PMC !

Example 3

Coatings were deposited onto each of Pebax rods (72D; 63D; and 35D—40% BASO4), NYLON-12 rods, PEEK rods, and HDPE rods.

Specifically, coating solution A was applied to each substrate using a dip coat method. Specifically, the substrate was immersed in the base coat coating solution with a dwell time of 5 seconds. The substrate was then extracted from the solution at a speed of 0.3 cm/s. The first layer was then air dried for at least 10 minutes. The first layer was then UV cured. Specifically the coated substrate was rotated in front of a Dymax 2000-EC series UV flood lamp with a 400 Watt metal halide bulb for 3 minutes, approximately 20 cm from the light source.

Next, coating solution B was applied to the first layer, also by dip coating at the same speed to form the second layer. The second layer was then air dried and UV cured using the same conditions as for the first layer.

The friction of the coating on each substrate was then tested according to the testing procedure outlined above. The results are shown in FIG. 5.

US11872325B2. Lubricious medical device coating with low particulates (2024-01-16). Surmodics, Inc. [US]. Inventors: David E. Babcock [US].
Full text: Click here
Patent 2024
Floods Friction Light Metals nylon 12 Plant Bulb polyetheretherketone Polyethylene, High-Density Rod Photoreceptors
2
Molybdenum Tube Nuclear Reactor Design
Not available on PMC !

Example 2

A nuclear reactor core is formed from a series of molybdenum tubes containing a mixture of uranium fluoride and sodium fluoride. The uranium is enriched in U235 isotope. The tubes are located in channels in graphite blocks and a coolant liquid passes downwards through the channel between the graphite and the tube.

FIG. 3 shows an arrangement in which the bulbs 301 of the passive reactor control devices are located below the fuel tubes, i.e. below the fuel salt 310, and the stems 302 extend up between the graphite moderators 320 and the fuel salt 310.

US11862354B2. Nuclear reactor passive reactivity control system (2024-01-02). None [GB]. Inventors: Ian Richard Scott [GB].
Full text: Click here
Patent 2024
Fluorides Graphite Isotopes Medical Devices Molybdenum Plant Bulb Sodium Chloride Sodium Fluoride Stem, Plant Uranium
3
UV-Cured Multilayer Coating Characterization
Not available on PMC !

Example 2

Coating solution A was applied to the substrate (72D Pebax rods) using a dip coat method. Specifically, the substrate was immersed in the base coat coating solution with a dwell time of 5 seconds. The substrate was then extracted from the solution at a speed of 0.3 cm/s. The first layer was then air dried for at least 10 minutes. The first layer was then UV cured. Specifically the coated substrate was rotated in front of a Dymax 2000-EC series UV flood lamp with a 400 Watt metal halide bulb for 3 minutes, approximately 20 cm from the light source.

Next, either coating solution B (n=4) or solution D (n=4) was applied to the first layer, also by dip coating at the same speed to form the second layer or top coat. The second layer was then air dried and UV cured using the same conditions as for the first layer.

The friction of the coating was then tested according to the testing procedure outlined above. The results are shown in FIG. 4.

Particulate generation testing was also performed. For an average of 3 rods, it was found that the PA-AMPS-BBA-MA group generated 4,447(+/−567) particulates greater than 10 microns in size and the PA-BBA-AMPS-PEG group generated 4,140(+/−725) particulates greater than 10 microns in size.

US11872325B2. Lubricious medical device coating with low particulates (2024-01-16). Surmodics, Inc. [US]. Inventors: David E. Babcock [US].
Full text: Click here
Patent 2024
Floods Friction Light Metals Plant Bulb polyacrylamide Polymers Rod Photoreceptors
4
Multilayer UV-Cured Coating Friction Evaluation
Not available on PMC !

Example 8

Coating solution E was applied to the substrate (72D Pebax rods) using a dip coat method. Specifically, the substrate was immersed in the base coat coating solution with a dwell time of 5 seconds. The substrate was then extracted from the solution at a speed of 0.3 cm/s. The first layer was then air dried for at least 10 minutes. The first layer was then UV cured. Specifically the coated substrate was rotated in front of a Dymax 2000-EC series UV flood lamp with a 400 Watt metal halide bulb for 3 minutes, approximately 20 cm from the light source.

Next, coating solution F was applied to the first layer, also by dip coating at the same speed to form the second layer. The second layer was then air dried and UV cured using the same conditions as for the first layer.

The friction of the coating was then tested according to the testing procedure outlined above. The results are shown in FIG. 11.

US11872325B2. Lubricious medical device coating with low particulates (2024-01-16). Surmodics, Inc. [US]. Inventors: David E. Babcock [US].
Full text: Click here
Patent 2024
Floods Friction Light Metals Plant Bulb Rod Photoreceptors
5
Selective Photonic Patterning of Molecular Ink
Not available on PMC !

Example 5

The molecular ink I3 was deposited as a 2 cm circular trace on a PET substrate. A triangular opening was cut out of a first card and the triangle cut out was centered over the 2 cm circular trace. Slots were cut out of a second card and the slots were centered over a second 2 cm circular trace. The covered traces were then exposed to a DYMAX 5000-EC Series UV Curing Flood Lamp system at a distance of 10 cm from the bulb for about 200 s. Over the duration of the exposure, the temperatures of the exposed part (E) and covered part (C) of the trace were measured, with the results shown in FIG. 5A. As seen in FIG. 5A, the temperature of the exposed parts (E) reached about 150° C. after 120 s, whereas the temperature of the covered parts (C) reached only about 70° C. after 120 s and reached no higher than about 90° C. during the sintering process. After exposure, the trace was washed with methanol, which readily removed the unreacted covered parts of the trace, while the exposed parts remained bound to the PET substrate. FIG. 5B illustrates the pattern formed from the triangular opening and FIG. 5C illustrates the pattern formed from the slots.

US11873413B2. UV-sinterable molecular ink and processing thereof using broad spectrum UV light (2024-01-16). National Research Council of Canada [CA]. Inventors: Xiangyang Liu [CA], Jianfu Ding [CA], Patrick Roland Lucien Malenfant [CA], Chantal Paquet [CA], Bhavana Deore [CA], Arnold J. Kell [CA].
Full text: Click here
Patent 2024
Floods Methanol Plant Bulb Vision

Top products related to «Plant Bulb»

1
Whatman no 1 filter paper by Cytiva
Sourced in United Kingdom, Germany, United States, Switzerland, India, Japan, China, Australia, France, Italy, Brazil
Whatman No. 1 filter paper is a general-purpose cellulose-based filter paper used for a variety of laboratory filtration applications. It is designed to provide reliable and consistent filtration performance.
2
No 1 filter paper by Cytiva
Sourced in United Kingdom, Germany, United States, Japan, Switzerland, China, Italy, India
Cytiva No. 1 filter paper is a high-quality laboratory filtration product designed for general-purpose filtration tasks. It is composed of cellulose fibers and is suitable for a variety of applications requiring efficient separation of solids from liquids.
3
Digital camera dxm 1200f by Adobe
The Digital Camera DXM 1200F is a compact and versatile digital camera designed for professional use. It features a high-resolution 12-megapixel sensor, advanced autofocus capabilities, and the ability to capture Full HD video. The camera offers a range of manual controls and connectivity options, making it suitable for a variety of photographic applications.
4
Agilent 2100 bioanalyzer by Agilent Technologies
Sourced in United States, Germany, Canada, China, France, United Kingdom, Japan, Netherlands, Italy, Spain, Australia, Belgium, Denmark, Switzerland, Singapore, Sweden, Ireland, Lithuania, Austria, Poland, Morocco, Hong Kong, India
The Agilent 2100 Bioanalyzer is a lab instrument that provides automated analysis of DNA, RNA, and protein samples. It uses microfluidic technology to separate and detect these biomolecules with high sensitivity and resolution.
5
Fetal bovine serum (fbs) by Thermo Fisher Scientific
Sourced in United States, China, United Kingdom, Germany, Australia, Japan, Canada, Italy, France, Switzerland, New Zealand, Brazil, Belgium, India, Spain, Israel, Austria, Poland, Ireland, Sweden, Macao, Netherlands, Denmark, Cameroon, Singapore, Portugal, Argentina, Holy See (Vatican City State), Morocco, Uruguay, Mexico, Thailand, Sao Tome and Principe, Hungary, Panama, Hong Kong, Norway, United Arab Emirates, Czechia, Russian Federation, Chile, Moldova, Republic of, Gabon, Palestine, State of, Saudi Arabia, Senegal
Fetal Bovine Serum (FBS) is a cell culture supplement derived from the blood of bovine fetuses. FBS provides a source of proteins, growth factors, and other components that support the growth and maintenance of various cell types in in vitro cell culture applications.
6
Ethovision by Noldus
Sourced in Netherlands, United States
EthoVision XT is a video tracking software that can automatically track and analyze the behavior of animals in real-time or from recorded videos. It provides detailed data on various parameters such as distance moved, velocity, and position of the tracked animal within the experimental arena.
7
Trizol reagent by Thermo Fisher Scientific
Sourced in United States, China, Japan, Germany, United Kingdom, Canada, France, Italy, Australia, Spain, Switzerland, Netherlands, Belgium, Lithuania, Denmark, Singapore, New Zealand, India, Brazil, Argentina, Sweden, Norway, Austria, Poland, Finland, Israel, Hong Kong, Cameroon, Sao Tome and Principe, Macao, Taiwan, Province of China, Thailand
TRIzol reagent is a monophasic solution of phenol, guanidine isothiocyanate, and other proprietary components designed for the isolation of total RNA, DNA, and proteins from a variety of biological samples. The reagent maintains the integrity of the RNA while disrupting cells and dissolving cell components.
8
Methanol by Merck Group
Sourced in Germany, United States, Italy, India, United Kingdom, China, France, Poland, Spain, Switzerland, Australia, Canada, Sao Tome and Principe, Brazil, Ireland, Japan, Belgium, Portugal, Singapore, Macao, Malaysia, Czechia, Mexico, Indonesia, Chile, Denmark, Sweden, Bulgaria, Netherlands, Finland, Hungary, Austria, Israel, Norway, Egypt, Argentina, Greece, Kenya, Thailand, Pakistan
Methanol is a clear, colorless, and flammable liquid that is widely used in various industrial and laboratory applications. It serves as a solvent, fuel, and chemical intermediate. Methanol has a simple chemical formula of CH3OH and a boiling point of 64.7°C. It is a versatile compound that is widely used in the production of other chemicals, as well as in the fuel industry.
9
Dulbecco modified eagle medium (dmem) by Thermo Fisher Scientific
Sourced in United States, China, United Kingdom, Germany, France, Australia, Canada, Japan, Italy, Switzerland, Belgium, Austria, Spain, Israel, New Zealand, Ireland, Denmark, India, Poland, Sweden, Argentina, Netherlands, Brazil, Macao, Singapore, Sao Tome and Principe, Cameroon, Hong Kong, Portugal, Morocco, Hungary, Finland, Puerto Rico, Holy See (Vatican City State), Gabon, Bulgaria, Norway, Jamaica
DMEM (Dulbecco's Modified Eagle's Medium) is a cell culture medium formulated to support the growth and maintenance of a variety of cell types, including mammalian cells. It provides essential nutrients, amino acids, vitamins, and other components necessary for cell proliferation and survival in an in vitro environment.
10
Ethovision software by Noldus
Sourced in Netherlands, United States, United Kingdom
Ethovision is a video tracking software developed by Noldus. It is used to automatically track and analyze the movement and behavior of animals in a variety of experimental settings.

More about "Plant Bulb"

Plant bulbs, also known as underground storage organs or vegetative reproductive structures, are essential for the survival and regrowth of various ornamental and edible plant species, such as tulips, daffodils, onions, and garlic.
These compressed stem and leaf tissues contain food reserves that enable rapid new growth during favorable seasons.
Researchers studying plant bulbs can leverage specialized AI-powered tools like PubCompare.ai to enhance their workflow.
These tools help identify the best experimental protocols from literature, preprints, and patents, and provide intelligent comparisons to optimize bulb research and boost productivity.
With PubCompare.ai, scientists can streamline their plant bulb studies and uncover the most effective products and techniques for their investigations.
For example, researchers may use Whatman No. 1 filter paper or No. 1 filter paper to filter solutions during their experiments.
They may also utilize a Digital Camera DXM 1200F to capture images of their plant bulb samples.
Additionally, the Agilent 2100 Bioanalyzer can be employed to analyze the molecular composition of bulb tissues.
Furthermore, researchers may supplement their plant bulb cultures with fetal bovine serum (FBS) to provide necessary growth factors.
The Ethovision software can be employed to track and analyze the behavior of bulb-derived plantlets.
To extract RNA from plant bulb tissues, scientists may use the TRIzol reagent, a commonly used solution for RNA isolation.
Methanol and DMEM (Dulbecco's Modified Eagle Medium) may also be utilized in various stages of the research process, such as sample preparation and cell culture maintenance.
By incorporating these specialized tools and techniques, researchers can streamline their plant bulb studies, optimize their experimental protocols, and uncover the most effective products and methods for their investigations, ultimately enhancing their productivity and advancing the field of plant bulb research.