The largest database of trusted experimental protocols
> Living Beings > Population Group > Companions

Companions

Companions are individuals or animals that provide companionship, emotional support, and social interaction.
They can include pets, service animals, friends, family members, and other close relationships.
Companions play a vital role in human well-being, promoting mental health, reducing loneliness, and enhancing quality of life.
Reserch has shown that having a companion can have positve effects on physical health as well, such as lowering blood pressure and stress levels.
Wheter human or animal, companions offer a sense of connection and purpose that is essential for overall wellbeing.
This MeSH term encompasses the diverse range of companions that can enrich and support an individual's life.

Most cited protocols related to «Companions»

The overarching objective was to allow for broad participation in the biomedical assessments. Thus, all living Project 1 (national survey) respondents were considered eligible for participation if their existing health information indicated an ability to travel to the clinic without excessive risk to the respondent or project staff. Siblings of main sample respondents were not part of the recruitment pool (primarily because of cost), but members of the twin sample were included. Members of the Milwaukee sample of African Americans, newly recruited at MIDUS II, were also part of the recruitment pool. Eligible respondents were first sent a letter explaining what the biological project was about. A brochure sent with the letter sketched the key objectives of the biomedical assessments, outlined what would be included in the clinic visit, and explained how financial matters related to respondents’ time and travel would be handled. Follow-up phone calls were then made to provide additional details and answer any questions the respondent might have. All travel expenses to and from the clinics were covered, and project staff also helped arrange travel itineraries. For aged individuals, or those concerned about traveling alone, an option was provided to travel to the clinic with a companion. Respondents were given $200 in consideration of their two-day visit to the medical clinic. For some, childcare costs were also provided. The study was approved by the Institutional Review Board at each participating center, and informed written consent was obtained for all participants.
Publication 2010
African American Aged Biopharmaceuticals Clinic Visits Companions Ethics Committees, Research Sibling Twins
We compared the accuracy of pixy’s estimates of π and dXY with several popular existing tools: VCFTOOLS, ANGSD, POPGENOME, and SCIKIT-ALLEL (Danecek et al., 2011 (link); Korneliussen et al., 2014 (link); Miles et al., 2019 ; Pfeifer et al., 2014 (link)). We computed π using PIXY, VCFTOOLS, POPGENOME, SCIKIT-ALLEL, and ANGSD. Note that ANGSD was only applied to the empirical data, since its diversity functions are not designed to work with VCFs. We computed dXY using PIXY, POPGENOME, SCIKIT-ALLEL, and the ANGSD companion script “calcDxy” (https://github.com/mfumagalli/ngsPopGen/blob/master/scripts/calcDxy.R). For VCFtools, we used the “--window-pi” method to estimate windowed π. For scikit-allel, we used the allel.sequence_diversity and allel.sequence_divergence functions to estimate windowed π and dXY, respectively. For PopGenome, we used the nuc.diversity.within and nuc.diversity. between functions, following the recommendations in the manual. We stress that the PopGenome manual explicitly warns that computing π and dXY in the presence of missing data will result in biased estimates (Pfeifer et al., 2014 (link)). We have chosen to include it here because PopGenome is commonly used to estimate π and dXY in spite of this warning.
We first used our simulated data sets to examine pixy’s accuracy in comparison to these existing methods. To obtain two simulated populations for evaluating dXY, we split the 100 simulated samples into two random groups. To standardize sample sizes between π and dXY estimates, we computed π using the first half of the simulated individuals (n = 50), and dXY by designating the first half of the individuals as drawn from “Population 1” and the second half as drawn from “Population 2” (each with n = 50 individuals). We computed π and dXY in 10 kb windows in each of the VCFs with variable missing data. pixy was run using default settings, and each pre-existing method was applied using the functions described above (see code supplement).
We then compared the accuracy of each method using the empirical Anopheles gambiae data. To do this, we first applied a basic genotype-level hard filter (DP > =10, GQ >= 40|RGQ >= 40) to the invariant sites VCF produced by GATK. We also removed all variants apart from biallelic SNPs – like other existing methods, pixy does not support the calculation of summary statistics for INDELs or other structural variants. The filtered VCF was used as the input file for all methods apart from ANGSD (see below). We then computed π (PIXY, VCFTOOLS, ANGSD, POPGENOME, SCIKIT-ALLEL) and dXY (PIXY, POPGENOME, SCIKIT-ALLEL, ANGSD) in 10 kb windows. We computed π separately for the BFS and KES populations. For ANGSD, the BAM files generated from the Anopheles BFS and KES populations were used as input, resulting in estimates of both π (ANGSD’s “pairwise theta”) and dXY (obtained via a companion script: calcDxy – by Joshua Penalba, https://github.com/mfumagalli/ngsPopGen/blob/master/scripts/calcDxy.R). In the case of π, we explicitly divided the raw estimates of pairwise theta by the number of sites (nSites) provided by ANGSD, and not the window size (10,000).
Full details and scripts for all of the above procedures are available at https://github.com/ksamuk/pixy_analysis.
Publication 2021
Alleles Anopheles Anopheles gambiae Companions Dietary Supplements Genotype INDEL Mutation Population Group Single Nucleotide Polymorphism
To count alignment breakpoints, we mapped all assemblies to the corresponding reference genomes with minimap2 under the option “--paf-no-hit -cxasm20 -r2k -z1000,500”. We used the companion script paftools.js to collect various metrics (command line: “paftools.js asmstat -q50000 -d.1”, where “-q” sets the minimum contig length and “-d” sets the max sequence divergence). To count substitutions and gaps, we applied a different minimap2 setting “-cxasm5 --cs -r2k”. This setting introduces more alignment breakpoints but avoids poorly aligned regions harboring spuriously high number of differences that are likely caused by large-scale variations and skew the counts. We used “paftools.js call” to call variations.
Publication 2019
Companions Genome
To count alignment breakpoints, we mapped all assemblies to the corresponding reference genomes with minimap2 under the option “--paf-no-hit -cxasm20 -r2k -z1000,500”. We used the companion script paftools.js to collect various metrics (command line: “paftools.js asmstat -q50000 -d.1”, where “-q” sets the minimum contig length and “-d” sets the max sequence divergence). To count substitutions and gaps, we applied a different minimap2 setting “-cxasm5 --cs -r2k”. This setting introduces more alignment breakpoints but avoids poorly aligned regions harboring spuriously high number of differences that are likely caused by large-scale variations and skew the counts. We used “paftools.js call” to call variations.
Publication 2019
Companions Genome
Detailed methods are described in the companion paper [30] (link). Briefly, we extracted DNA from fecal samples of three individuals before, during, and after a 5-day course of the antibiotic ciprofloxacin, then performed PCR with primers designed to amplify the SSU rRNA gene (hereafter referred to as “full-length”), as well as the V3 and V6 hypervariable regions of the full-length gene. The forward primers for the full-length product were 90% bacterial primer 8F (AGAGTTTGATCMTGGCTCAG) and 10% 8F-Bif targeting Bifidobacteria (AGGGTTCGATTCTGGCTCAG), and were paired with the 3 domain reverse primer 1391R (GACGGGCGGTGTGTRCA). Re-conditioning PCR reactions were performed for the full-length gene amplifications. Full-length amplicons were cloned and sequenced with Sanger dideoxy methods, assembled with phrap [36] (link), aligned with NAST [31] (link) and evaluated for chimeras with Bellerophon [37] (GenBank Accession numbers: EU761594-EU768801). The V3 and V6 amplicon libraries were sequenced with a Roche GS FLX pyrosequencer.
The primers spanning V3 were 338F (ACT CCT ACG GGA GGC AGC AG) and 533R (TTA CCG CGG CTG CTG GCA C). The primers spanning V6 were a combination of 967F primers (CAA CGC GAA GAA CCT TAC C and ATA CGC GA[AG] GAA CCT TAC C) and a combination of 1046R primers (AGG TGN TGC ATG GCT GTC G and AGG TGN TGC ATG GTT GTC G).
Publication 2008
Antibiotics Bacteria Bifidobacterium Chimera Ciprofloxacin Companions Feces Gene Amplification Genes Oligonucleotide Primers Ribosomal RNA Genes

Most recents protocols related to «Companions»

Example 3

With reference to FIG. 1, the sensor 120 senses vasopressin, and the sensor 124 senses Na+, which is an indicator of sweat generation rate. The sensor 124 could therefore provide a leading warning of possible dehydration before dehydration occurs as recorded by sensor 220, which measures changes in levels of vasopressin.

Patent 2024
AVP protein, human Companions Dehydration Medical Devices Sweat

Example 7

To perform PLA with PDX samples, the glioblastoma patient derived FFPE samples were used (provided by Samsung Seoul hospital in Seoul, Korea). After FFPE sample were de-paraffinized and performed heat induced antigen retrieval for 15 minutes at 100° C. Slides were blocked with blocking solution provided by Duolink and incubated with rabbit anti-CXCR4 (1:200, Thermoscientific, PA3305), mouse anti-ADRB2 (1:200, Santacruz, Sc-271322), at 37° C. for 1 h in a humidifying chamber. The other process was same as described above (PLA with PDC).

In the FIG. 15A, nuclei were visualized with DAPI staining, and CXCR4-ADRB4 heteromers were stained with PLA as small dots. As shown in FIG. 15B, PLA ratio is different according to the patient and based on this result, indicating that it is possible to perform personalized medicine by the companion diagnostics.

Patent 2024
ADRB2 protein, human Antigens Cell Nucleus Companions CXCR4 protein, human DAPI Diagnosis Glioblastoma Mus Patients Precision Medicine Rabbits
In Norway, approximately 53,000 babies are born each year [20 ]. Maternity care is part of the public healthcare system and is built on the principle of free and equal access for all regardless of factors such as ethnicity or social background [21 , 22 ]. Prior to the COVID-19 pandemic, Norway reported one of the highest rates of exclusive breastfeeding at 6 months of age in Europe [23 (link)]. Breastfeeding is promoted in a national action plan launched in 2017 for a healthier diet [24 ] and national surveys published in 2020 showed that 78% of babies in Norway were breastfed at 6 months [25 ] and 48% at 12 months [26 ]. By National law, parents in Norway are entitled to 49 weeks paid parental leave [27 ]. Additionally, a nursing mother returning to work is entitled to 30 minutes time off, which may be taken twice daily or as a reduction in working hours by up to 1 hour per day, to promote breastfeeding [28 ].
During the COVID-19 pandemic, in Norway the risk of maternal hospitalization due to COVID-19 disease in pregnancy was low [29 (link)]. However, maternity wards changed their practices, companion of choice often encountered restrictions in participation of care [30 ], and women were on average discharged from hospital earlier than in preceding years [20 ]. Further, during the pandemic women who gave birth in Norway have described feelings of loneliness and isolation in relation to antenatal care, when arriving at the hospital for labor, in cases of induction of labor, and at the postnatal ward [30 ]. This could result in a lack of maternal support which is crucial for the establishment of exclusive breastfeeding, especially during the hospital stay in the early postpartum period [3 (link)]. Women remained isolated from their social network after discharge due to strict social distancing regulations [18 ]. While several restrictions remained in healthcare services in Norway in 2021, the first year of the pandemic (2020) was characterized by more uncertainties both for new families and healthcare workers.
Publication 2023
Care, Prenatal Childbirth Companions COVID 19 Ethnicity Feelings Health Personnel Hospitalization Infant isolation Labor, Induced Mothers Obstetric Labor Pandemics Parent Patient Discharge Pregnancy Woman
We used descriptive statistics to summarize quantitative data, reported as frequencies and percentages. Differences of sample characteristics by year of birth (2020, 2021) were tested with a Chi-square test or a Fisher exact test. To examine associations between year of birth and early breastfeeding-related factors (n = 13), we estimated crude and adjusted odds ratios (adjORs) with 95% confidence intervals (CIs) using logistic regression. The main exposure was year of birth (2020, 2021). Outcome variables were dichotomized variables related to early breastfeeding and included the following: opportunity to have skin-to-skin within the first hour after birth (yes, no); early breastfeeding within the first hour after giving birth when applicable (yes, no); adequate breastfeeding support (yes, no); exclusive breastfeeding at discharge from hospital (yes, no); immediate attention by healthcare providers when needed (yes, no); clear communication from healthcare providers (yes, no); allowed companion of choice (yes, no); adequate number of women per room (yes, no); adequate visiting hours for companion of choice (yes, no); adequate number of healthcare providers (yes, no); adequate professionalism of the healthcare providers (yes, no); reduction in QMNC due to COVID-19 (yes, no); and reduction in their general satisfaction due to COVID-19 pandemic (yes, no). When the option “partially” was available, such answers were categorized as “no”. Other variables included in the model were: women born in Norway (yes, no, missing); answered the survey in other language than Norwegian (yes, no); age range (18–24, 25–30, 31–35, 36–39, ≥ 40); educational level (None, Elementary school, Junior High school, High School, University degree, Postgraduate degree / Master / Doctorate or higher); parity (1, > 1); birth mode (vaginal spontaneous, instrumental vaginal birth, Cesarean section).
A two-tailed P-value < 0.05 was considered statistically significant. Statistical analyses were performed using Stata version 14 (Stata Corporation, College Station, TX, USA) and R version 4.1.1 (R Foundation for Statistical Computing, Vienna, Austria).
Publication 2023
Attention Cesarean Section Childbirth Companions COVID 19 Health Personnel Patient Discharge Satisfaction Skin Vagina Woman
Data were collected between November 2020 and September 2021. First, a rapid literature review informed the development of a short online survey (hosted on the Qualtrics® Insight Platform) to establish the relevance of alerts for health and community service workers and understand the scope of their information needs and preferences. Victorian alcohol and other drug (AOD) and urgent care (UC) workers were recruited via convenience and referral sampling methods. Four virtual co-design workshops were held in December 2020. We facilitated semi-structured workshop consultations using open-ended questions, opinion polls, and other interactive, ideas-generating techniques such as ‘brainwriting’—a timed activity where participants rapidly record independent responses to prompts before sharing them with the group [91 (link)]. Interactive software allowed participants to view and discuss responses in real-time (e.g. Mentimeter™, Google Slides, and chat functions). Workshops were hosted and recorded using Zoom video conferencing, and all media were transcribed verbatim. Interim analyses and researcher observations are fed-forward to inform future workshop discussions and alert prototype designs. We drafted alert prototypes based on co-design consultations and sought preliminary feedback during feedback sessions held between May and August 2021. Data from the interactive feedback sessions were reviewed by the research team and conflicting perspectives were escalated for discussion with an advisory group of experts working across government, health, AOD treatment, harm reduction, and research sectors. Unresolved tensions, alert dissemination and design were discussed with participants of the final ‘prototype review’ workshop held in September 2021. Unresolved tensions are presented in our companion paper, Volpe et al. [86 (link)].
Publication 2023
ARID1A protein, human Companions Ethanol Harm Reduction Health Personnel Pharmaceutical Preparations Workers

Top products related to «Companions»

Sourced in United States
The Creatinine Companion kit is a lab equipment product designed for the measurement of creatinine levels in biological samples. The kit provides the necessary reagents and components to perform creatinine testing in a laboratory setting.
Sourced in United States
The Creatinine Companion is a laboratory instrument designed to measure creatinine levels. Creatinine is a chemical compound produced by the body as a byproduct of muscle metabolism. The Creatinine Companion provides a reliable and accurate method for quantifying creatinine concentrations in various biological samples.
Sourced in United States
The Albuwell M is a laboratory equipment designed for the detection and measurement of albumin levels in urine samples. It provides a standardized and reliable method for quantifying albumin concentrations.
Sourced in Cameroon
The Lab Companion is a multi-purpose laboratory tool designed to assist with various tasks in the scientific research environment. It provides a compact and versatile platform for housing and organizing essential lab equipment and accessories.
Sourced in United States
The Albuwell M kit is a laboratory equipment product that provides a method for the quantitative determination of albumin in urine samples. It functions as a diagnostic tool to measure the concentration of albumin, a protein found in the blood that can indicate various health conditions when present in urine.
Sourced in United States
The 24-well companion plate is a laboratory equipment designed for cell culture and assay applications. It features 24 individual wells arranged in a standard microplate format, enabling simultaneous experiments or sample processing. The plate is intended to be used in conjunction with other laboratory equipment and procedures, providing a platform for various cell-based studies and assays.
Sourced in United States, United Kingdom, Germany, China, Canada, Japan, Italy, France, Belgium, Australia, Uruguay, Switzerland, Israel, India, Spain, Denmark, Morocco, Austria, Brazil, Ireland, Netherlands, Montenegro, Poland
Matrigel is a solubilized basement membrane preparation extracted from the Engelbreth-Holm-Swarm (EHS) mouse sarcoma, a tumor rich in extracellular matrix proteins. It is widely used as a substrate for the in vitro cultivation of cells, particularly those that require a more physiologically relevant microenvironment for growth and differentiation.
Sourced in United States
The CombiFlash Companion is a compact, automated flash chromatography system designed for rapid purification of organic compounds. It features integrated solvent delivery, fraction collection, and UV detection capabilities to efficiently separate and purify a variety of samples.
Covi-ox T-90 is a laboratory equipment product manufactured by BASF. It is a high-performance antioxidant that helps protect materials from oxidative degradation.

More about "Companions"

Companionship, emotional support, and social interaction are essential elements of human wellbeing.
Companions, whether human or animal, can play a vital role in promoting mental health, reducing loneliness, and enhancing overall quality of life.
Research has shown that having a companion, such as a pet, service animal, friend, or family member, can have positive effects on physical health as well, including lowering blood pressure and stress levels.
Companions offer a sense of connection and purpose that is invaluable for individuals.
This can encompass a diverse range of relationships, from pets and service animals to close personal relationships with friends and family members.
The Creatinine Companion kit, Albuwell M, Lab Companion, and 24-well companion plate are all examples of products that may be used in research or laboratory settings to support various aspects of an individual's work or study.
Metadescription: Discover PubCompare.ai, the ultimate AI-powered platform for optimizing your research protocols.
Effortlessly locate the best protocols from literature, pre-prints, and patents, and leverage our cutting-edge AI comparisons to enhance reproducibility and accuracy.
Unleash the power of data-driven decision making and take your research to new heights with PubCompare.ai.