Log In Sign up
The largest database of trusted experimental protocols
> Living Beings > Virus > Baculoviridae

Baculoviridae

Baculoviridae are a family of large, double-stranded DNA viruses that predominantly infect insects and other arthropods.
These viruses are known for their unique life cycle and ability to produce occlusion bodies, which protect the virus particles and facilitate their transmission between hosts.
Baculoviridae have become increasingly important in biotechnology and research, with applications ranging from biopesticides to protein expression systems.
This MeSH term provides a concise overview of the Baculoviridae family, its characteristics, and its relevance in various fields of study.

Most cited protocols related to «Baculoviridae»

1
SARS-CoV-2 Spike Protein Expression Protocols
The mammalian cell codon-optimized nucleotide sequence coding for the spike protein of the SARS-CoV-2 isolate (GenBank:MN908947.3) was synthesized commercially (Genewiz). The RBD (amino acids 319–541; RVQP…CVNF), along with the signal peptide (amino acids 1–14; MFVF…VSSQ) plus a hexahistidine tag, was cloned into mammalian expression vector pCAGGS as well as in a modified pFastBac Dual vector for baculovirus system expression. The soluble version of the spike protein (amino acids 1–1,213; MFVF…IKWP), including a C-terminal thrombin cleavage site, T4 foldon trimerization domain and hexahistidine tag, was also cloned into pCAGGS. The protein sequence was modified to remove the polybasic cleavage site (RRAR to A), and two stabilizing mutations were introduced as well (K986P and V987P; wild-type numbering). Recombinant proteins were produced using the well-established baculovirus expression system and this system has been published in detail in refs.20 (link)–22 , including a video guide. Recombinant proteins were also produced in Expi293F cells (Thermo Fisher Scientific) by transfections of these cells with purified DNA using an ExpiFectamine 293 Transfection Kit (Thermo Fisher Scientific). Supernatants from transfected cells were harvested on day 3 post-transfection by centrifugation of the culture at 4,000g for 20 min. Supernatant was then incubated with 6 ml Ni-NTA Agarose (Qiagen) for 1–2 h at room temperature. Next, gravity flow columns were used to collect the Ni-NTA agarose and the protein was eluted. Each protein was concentrated in Amicon centrifugal units (EMD Millipore) and re-suspended in phosphate-buffered saline (PBS). Proteins were analyzed by reducing SDS-PAGE. The DNA sequence for all constructs is available from the Krammer Laboratory and has also been deposited in GenBank (additional information in the ‘Data availability’ statement). Several of the expression plasmids and proteins have also been submitted to the BEI Resources repository and can be requested from their web page for free (https://www.beiresources.org/. S1 proteins of NL63 and 229E were obtained from Sino Biological (produced in hexahistidine-tagged 293HEK cells). A detailed protocol for protein expression of RBD and spike in mammalian cells is also available7 (link).
Amanat F., Stadlbauer D., Strohmeier S., Nguyen T.H., Chromikova V., McMahon M., Jiang K., Arunkumar G.A., Jurczyszak D., Polanco J., Bermudez-Gonzalez M., Kleiner G., Aydillo T., Miorin L., Fierer D.S., Lugo L.A., Kojic E.M., Stoever J., Liu S.T., Cunningham-Rundles C., Felgner P.L., Moran T., García-Sastre A., Caplivski D., Cheng A.C., Kedzierska K., Vapalahti O., Hepojoki J.M., Simon V, & Krammer F. (2020). A serological assay to detect SARS-CoV-2 seroconversion in humans. Nature medicine, 26(7), 1033-1036.
Publication 2020
Amino Acids Amino Acid Sequence Baculoviridae Biopharmaceuticals Cells Centrifugation Cloning Vectors Codon Cytokinesis DNA Sequence Gravity His-His-His-His-His-His isononanoyl oxybenzene sulfonate Mammals M protein, multiple myeloma Mutation Open Reading Frames Phosphates Plasmids Proteins Recombinant Proteins Saline Solution SARS-CoV-2 SDS-PAGE Sepharose Signal Peptides Staphylococcal Protein A Thrombin Transfection
2
AviTag Insertion via Inverse PCR Mutagenesis
A variety of standard molecular biology methods can be used to add the AviTag (seeNote 2) to an appropriate site in a target protein (seeNote 4). For certain experiments it may also be valuable to clone a negative control peptide that is not biotinylated by BirA (seeNote 5). We suggest using a modified inverse PCR mutagenesis (43 (link)) (seeFig. 4) or Site-directed Ligase-Independent Mutagenesis (SLIM) reaction (44 (link)), which enables the insertion of the substrate peptide without requiring any restriction sites nearby. Below is an example inverse PCR mutagenesis protocol.

Forward and reverse primers for peptide insertion should be designed to each have 18-25 bp matching the parental sequence and have a calculated annealing temperature (to the parent sequence) of at least 55 °C (seeFig. 4).

Assemble the following reaction mixture in a PCR tube: 29.5 μL MilliQ water, 1.5 μL DMSO, 5 μL KOD polymerase buffer, 5 μL 25 mM MgSO4, 1 μL 15 μM forward primer, 1 μL 15 μM reverse primer, 1 μL 100 ng/μL template plasmid DNA, 5 μL 2 mM dNTP mix and finally 1 μL KOD hot start polymerase.

After transferring the tube to a PCR machine, perform an initial denaturing step of 3 minutes at 95 °C, followed by 12 cycles of: 95 °C for 30 seconds, 55 °C for 30 seconds and 68 °C for 30 seconds/kb of target plasmid DNA.

Add 1 μL of 20 U/μL DpnI enzyme to the PCR mix and incubate at 37 °C for 1 hour.

Run an aliquot of the reaction on a 0.7% agarose gel to confirm the success and fidelity of the PCR (a clean band should be observed corresponding to the size of the linearized target plasmid DNA).

To 2 μL of the PCR product, add 14 μL MilliQ water, followed by 2 μL of 10× T4 DNA ligase buffer, 1 μL T4 polynucleotide kinase and 1 μL of T4 DNA ligase.

Incubate the sample for 1 hour at room temperature and transform an appropriate strain of competent E. coli (e.g. DH5α, XL1-Blue, JM109) with 5 μL of the ligation reaction. Cells with competency of at least 107 cfu/μg should be sufficient.

After validating the construct by sequencing, the AviTag-fused protein can be overexpressed in the appropriate cell system (commonly E. coli, baculovirus or HEK 293T cells).

Fairhead M, & Howarth M. (2015). Site-specific biotinylation of purified proteins using BirA. Methods in molecular biology (Clifton, N.J.), 1266, 171-184.
Publication 2015
Baculoviridae Buffers Cells Clone Cells Enzymes Escherichia coli HEK293 Cells Inverse PCR Ligase Ligation Mutagenesis Mutagenesis, Site-Directed Neoplasm Metastasis Oligonucleotide Primers Parent Peptides Plasmids Polynucleotide 5'-Hydroxyl-Kinase Proteins Protein Targeting, Cellular Sepharose Strains Sulfate, Magnesium Sulfoxide, Dimethyl T4 DNA Ligase
3
Structural Insights into GluCl Receptor
GluClcryst was expressed from baculovirus-infected Sf9 cells and purified by metal ion affinity chromatography. The Fab complex was isolated by size-exclusion chromatography. The GluClcryst-Fab complex was concentrated to 1-2 mg/mL and supplemented with synthetic lipids and ivermectin. Crystallization was performed by hanging drop vapor diffusion at 4°C with a precipitating solution containing 21-23% PEG 400, 50 mM sodium citrate pH 4.5 and 70 mM sodium chloride. Cryoprotection was achieved by soaking crystals in precipitant solution supplemented with 30% PEG 400. Additional complexes were obtained by soaking crystals in cryoprotectant containing L-glutamate, picrotoxin or sodium iodide. Diffraction data were indexed, integrated and scaled and the structure solved by molecular replacement using a GLIC-derived homology model of GluClcryst and a Fab homology model as search probes. The molecular replacement phases were used to initiate autobuilding and the resulting model was iteratively improved by cycles of manual adjustment and crystallographic refinement. Function of GluCl was examined by two-electrode voltage clamp experiments and by [3H]-L-glutamate saturation and competition binding assays.
Hibbs R.E, & Gouaux E. (2011). Principles of activation and permeation in an anion-selective Cys-loop receptor. Nature, 474(7349), 54-60.
Publication 2011
Baculoviridae Biological Assay Chromatography, Affinity Cryoprotective Agents Crystallization Crystallography Diffusion Gel Chromatography Glutamate Ivermectin Lipids Metals Picrotoxin polyethylene glycol 400 Sf9 Cells Sodium Chloride Sodium Citrate Sodium Iodide
4
Engineered β1-Adrenergic Receptor Structure
The β1AR construct T34-424/His642 (link) was the starting point for the generation of the β1AR36-m23 construct that crystallized. The C-terminus was further truncated after Leu367, and 6 histidines were added. Two segments, comprising residues 244-271 and 277-278 of CL3, were also deleted. The construct included the following 8 point mutations: C1163.27L increased expression; C358A at the C-terminus of H8 removed palmitoylation and helped crystallisation; R681.59S, M902.53V, Y2275.58A, A2826.27L, F3277.37A and F3387.48M thermostabilised the receptor in the antagonist conformation15 (link). Baculovirus expression and receptor purification42 (link) were performed in decylmaltoside, with the detergent exchanged to octylthioglucoside on the alprenolol sepharose column. Crystals were obtained by vapour diffusion at 18°C with hanging drops after addition of an equal volume of reservoir solution, 0.1M N-(2-acetamido)iminodiacetic acid:NaOH pH 6.9-7.3 and 29-32% PEG600 to receptor concentrated to 6.0 mg/ml.
Warne T., Serrano-Vega M.J., Baker J.G., Moukhametzianov R., Edwards P.C., Henderson R., Leslie A.G., Tate C.G, & Schertler G.F. (2008). Structure of a β1-adrenergic G protein-coupled receptor. Nature, 454(7203), 486-491.
Publication 2008
Alprenolol Baculoviridae Crystallization Detergents Diffusion Histidine iminodiacetic acid octylthioglucoside Palmitoylation Point Mutation Sepharose
5
Versatile Expression Vector Cloning
Expression clones were generated by PCR and ligation-independent cloning (LIC) into one or more of a set of vectors. The first choice of vector is pNIC28-Bsa4. It is derived from the pET28a vector (Merck), with the expression of the cloned gene driven by the T7-LacO system. Proteins cloned in this vector are fused to an amino-terminal tag of 23 residues (MHHHHHHSSGVDLGTENLYFQ∗SM) including a hexahistidine (His6) and a TEV-protease cleavage site (marked with *). Additional features include cloning sites for ligation-independent cloning (LIC) separated by a “stuffer” fragment that includes the SacB gene. The SacB protein (levansucrase) converts sucrose into a toxic product, allowing selection for recombinant plasmids on agar plates containing 5% sucrose.
Several alternative expression vectors have been used with selected targets (Table 2). pNIC-CTHF appends a C-terminal tag including a TEV-protease cleavage site followed by His6 and a flag epitope. Larger fusion tags include E. coli thioredoxin (combined with hexahistidine and a TEV cleavage site), GST, and a reversible streptavidin binding tag (derived from vector pBEN-SBP-SET1, Stratagene). Baculovirus expression vectors were constructed based on pFastBac (invitrogen), incorporating the same arrangement of LIC2 cloning sites as the bacterial vectors. We have recently adopted a highly charged, globular domain termed the Z-basic tag (Hedhammar and Hober, 2007 (link)), which may provide substantial enrichment of the tagged protein on cation-exchange columns. The Z-basic domain is flanked by a His6 tag and a TEV cleavage site.
An important consideration in vector construction is the ease of cloning the same gene fragment into multiple contexts. LIC requires short (12–16 bp) extensions at both ends of the insert that overlap vector sequences flanking the cloning sites. The vectors used in the SGC can be divided into three LIC classes (Table 2). All vectors within a class utilize the same extensions, so the same PCR fragment can be cloned in parallel into any vector within the class. In practice, cloning a gene into a series of vectors with a variety of N-terminal or C-terminal tags requires at most two PCR reactions (and two pairs of primers). We found this to be nearly as convenient as and more economical than the Gateway system, while minimizing the insertion of extraneous sequences into the expressed proteins.
Host cells are derived from BL21(DE3) and Rosetta2 (Merck). A phage-resistant derivative of BL21(DE3) was isolated in our lab and termed BL21(DE3)-R3; this bacterial strain was then transformed with plasmid pRARE2 (isolated from Rosetta2 calls), which carries seven rare-codon tRNA genes. The resulting chloramphenicol-resistant strain BL21(DE3)-R3-pRARE2 is the standard expression host.
Savitsky P., Bray J., Cooper C.D., Marsden B.D., Mahajan P., Burgess-Brown N.A, & Gileadi O. (2010). High-throughput production of human proteins for crystallization: The SGC experience. Journal of Structural Biology, 172(1), 3-13.
Full text: Click here
Publication 2010
Agar Bacteria Bacteriophages Baculoviridae Cells Chloramphenicol Cloning Vectors Codon Cytokinesis DNA Insertion Elements Epitopes Escherichia coli Eye Gene Expression Genes Genetic Vectors His-His-His-His-His-His levansucrase Ligation Oligonucleotide Primers Plasmids Proteins Sequence Insertion Strains Streptavidin Sucrose TEV protease Thioredoxins Transfer RNA

Most recents protocols related to «Baculoviridae»

1
In Vivo Albumin Gene Editing using Zinc Finger Nucleases
Not available on PMC !

Example 5

To deliver the albumin-specific ZFNs to the liver in vivo, the normal site of albumin production, we generated a hepatotropic adeno-associated virus vector, serotype 8 expressing the albumin-specific ZFNs from a liver-specific enhancer and promoter (Shen et al., ibid and Miao et al., ibid). Adult C57BL/6 mice were subjected to genome editing at the albumin gene as follows: adult mice were treated by i.v. (intravenous) injection with 1×1011 v.g. (viral genomes)/mouse of either ZFN pair 1 (SBS 30724 and SBS 30725), or ZFN pair 2 (SBS 30872 and SBS 30873) and sacrificed seven days later. The region of the albumin gene encompassing the target site for pair 1 was amplified by PCR for the Cel-I mismatch assay using the following 2 PCR primers:

Cel1 F1:
(SEQ ID NO: 69)
5′ CCTGCTCGACCATGCTATACT 3′
Cel1 R1:
(SEQ ID NO: 70)
5′ CAGGCCTTTGAAATGTTGTTC 3′

The region of the albumin gene encompassing the target site for pair 2 was amplified by PCR for the Cel-I assay using these PCR primers:

mAlb set4F4:
(SEQ ID NO: 71)
5′ AAGTGCAAAGCCTTTCAGGA 3′
mAlb set4R4:
(SEQ ID NO: 72)
5′ GTGTCCTTGTCAGCAGCCTT 3′

As shown in FIG. 4, the ZFNs induce indels in up to 17% of their target sites in vivo in this study.

The mouse albumin specific ZFNs SBS30724 and SBS30725 which target a sequence in intron 1 were also tested in a second study. Genes for expressing the ZFNs were introduced into an AAV2/8 vector as described previously (Li et al. (2011) Nature 475 (7355): 217). To facilitate AAV production in the baculovirus system, a baculovirus containing a chimeric serotype 8.2 capsid gene was used. Serotype 8.2 capsid differs from serotype 8 capsid in that the phopholipase A2 domain in capsid protein VP1 of AAV8 has been replaced by the comparable domain from the AAV2 capsid creating a chimeric capsid. Production of the ZFN containing virus particles was done either by preparation using a HEK293 system or a baculovirus system using standard methods in the art (See Li et al., ibid, see e.g., U.S. Pat. No. 6,723,551). The virus particles were then administered to normal male mice (n=6) using a single dose of 200 microliter of 1.0el 1 total vector genomes of either AAV2/8 or AAV2/8.2 encoding the mouse albumin-specific ZFN. 14 days post administration of rAAV vectors, mice were sacrificed, livers harvested and processed for DNA or total proteins using standard methods known in the art. Detection of AAV vector genome copies was performed by quantitative PCR. Briefly, qPCR primers were made specific to the bGHpA sequences within the AAV as follows:

Oligo200 (Forward)
(SEQ ID NO: 102)
5′-GTTGCCAGCCATCTGTTGTTT-3′
Oligo201 (Reverse)
(SEQ ID NO: 103)
5′-GACAGTGGGAGTGGCACCTT-3′
Oligo202 (Probe)
(SEQ ID NO: 104)
5′-CTCCCCCGTGCCTTCCTTGACC-3′

Cleavage activity of the ZFN was measured using a Cel-I assay performed using a LC-GX apparatus (Perkin Elmer), according to manufacturer's protocol. Expression of the ZFNs in vivo was measured using a FLAG-Tag system according to standard methods.

As shown in FIG. 5 (for each mouse in the study) the ZFNs were expressed, and cleave the target in the mouse liver gene. The % indels generated in each mouse sample is provided at the bottom of each lane. The type of vector and their contents are shown above the lanes. Mismatch repair following ZFN cleavage (indicated % indels) was detected at nearly 16% in some of the mice.

The mouse specific albumin ZFNs were also tested for in vivo activity when delivered via use of a variety of AAV serotypes including AAV2/5, AAV2/6, AAV2/8 and AAV2/8.2. In these AAV vectors, all the ZFN encoding sequence is flanked by the AAV2 ITRs, contain, and then encapsulated using capsid proteins from AAV5, 6, or 8, respectively. The 8.2 designation is the same as described above. The SBS30724 and SBS30725 ZFNs were cloned into the AAV as described previously (Li et al., ibid), and the viral particles were produced either using baculovirus or a HEK293 transient transfection purification as described above. Dosing was done in normal mice in a volume of 200 μL per mouse via tail injection, at doses from 5e10 to 1e12 vg per dose. Viral genomes per diploid mouse genome were analyzed at days 14, and are analyzed at days 30 and 60. In addition, ZFN directed cleavage of the albumin locus was analyzed by Cel-I assay as described previously at day 14 and is analyzed at days 30 and 60.

As shown in FIG. 6, cleavage was observed at a level of up to 21% indels. Also included in Figure are the samples from the previous study as a comparison (far right, “mini-mouse” study-D14 and a background band (“unspecific band”).

US11859190B2. Methods and compositions for regulation of transgene expression (2024-01-02). Sangamo Therapeutics, Inc. [US]. Inventors: Edward J. Rebar [US].
Full text: Click here
Patent 2024
Adult Albumins Baculoviridae Biological Assay Capsid Proteins Chimera Cloning Vectors Cytokinesis Dependovirus Diploidy Genes Genome INDEL Mutation Introns Liver Males Mice, Inbred C57BL Mismatch Repair Mus Oligonucleotide Primers Protein Domain Proteins Tail Transfection Transients Viral Genome Virion
2
Efficacy of PCV2b Variant Vaccine
Not available on PMC !

Example 2

This study demonstrates the efficacy of one embodiment of the Porcine Circovirus Type 2 ORF2b Vaccine against a PCV2a and/or PCV2b challenge. Cesarean-derived colostrum-deprived (CDCD) piglets are used in this study and separated into 2 groups; 1) pigs vaccinated with an experimental Porcine Circovirus Vaccine including the PCV2b ORF2 R63T variant of Example 1 (Killed Baculovirus Vector) that are challenged with virulent PCV2b and, 2) non-vaccinated challenged control pigs that are challenged with virulent PCV2b. On Day 0, Group 1 is administered 1 mL of vaccine intramuscularly (IM) whereas Group 2, non-vaccinated challenge control pigs do not receive any treatment. On Day 28, all pigs in groups 1 and 2 are challenged with virulent PCV2b 1 mL intranasally (IN) and 1 mL IM with an approximate dosage of 3.0 Log10 TCID5/mL of live virus. All pigs receive 2.0 mL Keyhole Limpet Hemocyanin emulsified in Incomplete Freunds Adjuvant (KLH/ICFA) IM on Days 25 and 31. Pigs are monitored daily for clinical signs, and blood is drawn for serologic testing periodically. On Day 56 all pigs are necropsied and select tissues are collected and gross pathology observations are made.

As a whole, vaccinated animals exhibit reduction when compared to their respective challenge control group in all parameters tested.

US11858963B2. PCV2 ORF2 protein variant and virus like particles composed thereof (2024-01-02). Boehringer Ingelheim Animal Health USA Inc. [US]. Inventors: Luis Alejandro Hernandez [US], Christine Margaret Muehlenthaler [US], Eric Martin Vaughn [US], Gregory Haiwick [US].
Full text: Click here
Patent 2024
Animals Baculoviridae BLOOD Cloning Vectors Colostrum incomplete Freund's adjuvant keyhole-limpet hemocyanin MLL protein, human Mutant Proteins Porcine Circovirus Sus scrofa Tissues Vaccines Virion Virus
3
Screening sEH Inhibitors for FAAH Activity
Not available on PMC !

Example 36

A crude preparation of recombinant FAAH enzyme was derived from baculovirus with the fluorescent-based substrate, octamide 4-methoxypyridine (OMP). Approximately 1700 compounds designed to inhibit sEH were tested with the FFAH preparation. Results shown in FIG. 1 were used to determine that only 38 of the tested compounds inhibited at least 75% of the FAAH enzyme activity at 10 μM. Of these 38, trans-4-{4-[3-(4-trifluoromethoxyphenyl)-ureido]cyclohexyloxy}benzoic acid (t-TUCB) had the highest potency, with an IC50 value of 140 nM. Although t-TUCB appears to have potency on FAAH, its relative inhibitory effect is low when compared to that of other molecules not considered to be dual sEH/FAAH inhibitors.

US11873288B2. Inhibitors for soluble epoxide hydrolase (sEH) and fatty acid amide hydrolase (FAAH) (2024-01-16). The Regents of the University of California [US]. Inventors: Bruce Hammock [US], Sean Kodani [US].
Full text: Click here
Patent 2024
Baculoviridae Benzoic Acid enzyme activity Enzymes inhibitors Psychological Inhibition t-TUCB Test Preparation
4
Expression and Purification of SARS-CoV-2 Beta RBD
The baculovirus-insect cell expression system (Invitrogen) was utilized to express the RBD of the S protein of SARS-CoV-2 Beta variant as previously described [32 (link)]. The RBDβ-HR/trimer recombinant protein is constructed by the SARS-CoV-2 Beta and Delta variant RBD (amino acids 320–545) of K417N, E484K, N501Y, and L452R mutants and two heptapeptide repeats (HR1, amino acids 916–966; HR2, amino acids 1157–1203) of the SARS-CoV-2 Wuhan-Hu-1 isolate. The gene sequence of GP67-Trx-His-EK-RBDβ-HR was transferred into the pFastBac1 vector, and then the bacmid was transfected into insect Sf9 cells by utilizing LipoInsect Transfection Regent (Beyotime, China). The cell culture supernatant containing the packaged recombinant baculovirus, was collected after 3 days. The baculovirus was expanded in Sf9 cells within 2 ~ 3 generations before being used for RBDβ-HR/trimer protein harvest. For primary purification, the supernatants were collected and purified by a 5-mL HisTrap excel column (GE Healthcare), further purified on Superdex 200 Increase 10/300 GL columns (GE Healthcare), and ultimately dissolved in soluble protein buffer containing 20 mM Tris–HCl and 150 mM NaCl. The prepared RBDβ-HR/trimer protein was investigated by SDS-PAGE and visualized with Coomassie blue.
He C., Chen L., Yang J., Chen Z., Lei H., Hong W., Song X., Yang L., Li J., Wang W., Shen G., Lu G, & Wei X. (2023). Trimeric protein vaccine based on Beta variant elicits robust immune response against BA.4/5-included SARS-CoV-2 Omicron variants. Molecular Biomedicine, 4, 9.
Full text: Click here
Publication 2023
Amino Acids Baculoviridae Buffers CD33 protein, human Cell Culture Techniques Cells Cloning Vectors Coomassie blue Genes Insecta Proteins Recombinant Proteins SARS-CoV-2 SARS-CoV-2 B.1.351 variant SDS-PAGE Severe acute respiratory syndrome-related coronavirus Sf9 Cells Sodium Chloride Transfection Tromethamine
5
Multivalent SARS-CoV-2 Vaccine Formulations
For primary immunization, the mRNA vaccines were SARS-CoV-2 prefusion spike constructs 2 P, GSAS, 2 P/GSAS, 2 P/GSAS/ALAYT, and 6 P/GSAS described in ref. 28 (link), the subunit vaccines were CoV2 preS dTM-AS03 vaccines, where the antigens were produced using the phase-I/-II manufacturing process, 1.3- and 2.6-µg doses, or using an intermediate manufacturing process, 2.4 µg dose.
For the booster, the CoV2 preS dTM derived from the ancestral strain (D614) and the Beta variant were produced using an optimized purification process to ensure a minimum of 90% purity.
The antigens were formulated in monovalent or bivalent formulations with AS03 adjuvant. The CoV2 preS dTM was produced from a Sanofi proprietary cell culture technology based on the insect cell—baculovirus system, referred to as the Baculovirus Expression Vector System (BEVS). The CoV2 preS dTM (ancestral D614) sequence was designed based on the Wuhan YP_009724390.1 strain S sequence, modified with 2 prolines in the S2 region, deletion of the transmembrane region, and addition of the T4 foldon trimerization domain. The CoV2 preS dTM (Beta) was designed based on the Beta (B.1.351) sequence (GISAID Accession EPI_ISL_1048524) and contains the same modifications.
AS03 is a proprietary adjuvant system composed of α-tocopherol, squalene, and polysorbate-80 in an oil-in-water emulsion manufactured by GSK. Vaccine doses were formulated by diluting the appropriate dose of preS dTM with PBS–tween to 250 µL, then mixing with 250 µL of AS03, followed by inversion five times for a final volume of 500 µL. Each dose of AS03 contains 11.86 mg of α-tocopherol, 10.69 mg of squalene, and 4.86 mg of polysorbate-80 (Tween 80) in PBS.
Pavot V., Berry C., Kishko M., Anosova N.G., Li L., Tibbitts T., Huang D., Raillard A., Gautheron S., Gutzeit C., Koutsoukos M., Chicz R.M, & Lecouturier V. (2023). Beta variant COVID-19 protein booster vaccine elicits durable cross-neutralization against SARS-CoV-2 variants in non-human primates. Nature Communications, 14, 1309.
Full text: Click here
Publication 2023
alpha-Tocopherol Antigens AS03 adjuvant Baculoviridae Base Sequence Cell Culture Techniques Cells Cloning Vectors Deletion Mutation Emulsions Immunization Insecta Inversion, Chromosome mRNA Vaccines Pharmaceutical Adjuvants Polysorbate 80 Pressure Proline SARS-CoV-2 SARS-CoV-2 B.1.351 variant Secondary Immunization Squalene Strains Tween 80 Tweens Vaccines Vaccines, Subunit

Top products related to «Baculoviridae»

1
Bac to bac baculovirus expression system by Thermo Fisher Scientific
Sourced in United States, Germany
The Bac-to-Bac baculovirus expression system is a tool used for the production of recombinant proteins in insect cells. It enables the cloning of a gene of interest into a transfer vector, which is then used to generate recombinant baculoviruses that can infect insect cells and express the target protein.
2
Bac to bac system by Thermo Fisher Scientific
Sourced in United States, United Kingdom, Poland, France
The Bac-to-Bac system is a tool for generating recombinant baculoviruses, which are commonly used to express proteins in insect cell lines. The system provides a efficient way to generate recombinant baculoviruses by using site-specific transposition to insert a gene of interest into a baculovirus shuttle vector, which is then used to transfect insect cells and produce the recombinant virus.
3
Cellfectin 2 reagent by Thermo Fisher Scientific
Sourced in United States, Canada, China
Cellfectin II reagent is a cationic lipid-based transfection reagent designed for efficient delivery of nucleic acids into a variety of mammalian cell types. It is used for the introduction of DNA, RNA, or other macromolecules into cells in culture.
4
Pfastbac1 by Thermo Fisher Scientific
Sourced in United States, Canada, Japan, Germany
PFastBac1 is a plasmid vector used in the Baculovirus Expression Vector System (BEVS) for the production of recombinant proteins in insect cells. The plasmid contains the necessary genetic elements for efficient cloning and expression of target genes in the BEVS system.
5
Sf9 cells by Thermo Fisher Scientific
Sourced in United States, United Kingdom, China, Switzerland
Sf9 cells are a type of insect cell line derived from the ovarian cells of the fall armyworm, Spodoptera frugiperda. These cells are commonly used in the production of recombinant proteins and the amplification of baculoviruses, which are often used as vectors for expressing heterologous proteins.
6
Fetal bovine serum (fbs) by Thermo Fisher Scientific
Sourced in United States, China, United Kingdom, Germany, Australia, Japan, Canada, Italy, France, Switzerland, New Zealand, Brazil, Belgium, India, Spain, Israel, Austria, Poland, Ireland, Sweden, Macao, Netherlands, Denmark, Cameroon, Singapore, Portugal, Argentina, Holy See (Vatican City State), Morocco, Uruguay, Mexico, Thailand, Sao Tome and Principe, Hungary, Panama, Hong Kong, Norway, United Arab Emirates, Czechia, Russian Federation, Chile, Moldova, Republic of, Gabon, Palestine, State of, Saudi Arabia, Senegal
Fetal Bovine Serum (FBS) is a cell culture supplement derived from the blood of bovine fetuses. FBS provides a source of proteins, growth factors, and other components that support the growth and maintenance of various cell types in in vitro cell culture applications.
7
High five cells by Thermo Fisher Scientific
Sourced in United States
High Five cells are a type of insect cell line derived from the Trichoplusia ni (cabbage looper) ovarian cells. They are commonly used in the production of recombinant proteins and baculovirus expression systems.
8
Pfastbac dual vector by Thermo Fisher Scientific
Sourced in United States, China
The PFastBac Dual vector is a baculovirus expression vector used for the production of recombinant proteins in insect cells. It provides a dual expression system, allowing for the simultaneous expression of two different genes from a single vector.
9
Bac to bac expression system by Thermo Fisher Scientific
Sourced in United States, United Kingdom
The Bac-to-Bac expression system is a recombinant protein expression system that uses baculovirus as the vector to introduce genes of interest into insect cells. It allows for the production of recombinant proteins in a eukaryotic environment.
10
Pfastbac1 vector by Thermo Fisher Scientific
Sourced in United States
The PFastBac1 vector is a Bacculovirus expression vector used for the generation of recombinant proteins in insect cells. It contains the polyhedrin promoter for high-level expression of target proteins and features multiple cloning sites for the insertion of foreign genes.

More about "Baculoviridae"

Baculoviruses are a family of large, double-stranded DNA viruses that primarily infect insects and other arthropods.
These unique viruses are known for their intricate life cycle and the production of occlusion bodies, which safeguard the virus particles and facilitate their transmission between hosts.
Baculoviridae have become increasingly valuable in biotechnology and research, with applications ranging from biopesticides to protein expression systems.
The Bac-to-Bac baculovirus expression system is a widely used technology that leverages the power of baculoviruses to produce recombinant proteins in insect cells, such as Sf9 (Spodoptera frugiperda) and High Five (Trichoplusia ni) cells.
This system utilizes the PFastBac1 vector, which is engineered to facilitate the insertion of a gene of interest, and the PFastBac Dual vector, which allows for the co-expression of multiple genes.
The Cellfectin II reagent is a liposome-based transfection agent commonly used in conjunction with the Bac-to-Bac system to efficiently deliver recombinant baculovirus DNA into insect cells, enabling the production of the desired proteins.
Baculoviruses and their expression systems have become indispensable tools in various fields, including protein engineering, vaccine development, and fundamental research on virus-host interactions.
By understanding the characteristics and applications of these remarkable viruses, researchers can unlock new possibilities and advance their studies in the dynamic realm of Baculoviridae.