Log In Sign up
The largest database of trusted experimental protocols
> Living Beings > Virus > Cowpox virus

Cowpox virus

Cowpox virus is a zoonotic orthopoxvirus that can infect humans and other mammals.
It is closely related to the vaccinia virus used in smallpox vaccines.
Cowpox typically causes mild, localized skin lesions but can lead to more severe systemic illness in some cases.
The virus is transmitted to humans through direct contact with infected animals, often rodents.
Cowpox research is important for understanding the epidemiology, pathogenesis, and potential treatment options for this emerging viral disease.
PubCompare.ai can help streamline Cowpox studies by providing AI-driven comparisons of relevant literature, preprints, and patents to enhance reproducibility and accurcay.

Most cited protocols related to «Cowpox virus»

1
BBB Software for Virus Sequence Analysis
When the BBB project began more than 15 years ago, Java was chosen as the coding language because (1) web browsers were not as capable as today’s JavaScript powered interfaces; (2) Java was the primary language taught to undergraduates at the University of Victoria; and (3) it was relatively platform-independent, promising “code once, deploy everywhere” capability, thereby eliminating the compilation and installation obstacles that hinder users that want to try out new tools.
This updated software application is available from the www.4virology.net website (previously virology.uvic.ca) and code is made available upon request under the GNU General Public License version 3. In addition, the BBB and “consensus-degenerate hybrid oligonucleotide primers” (CODEHOP) source code described below has recently been submitted to the GitHub repository (https://github.com/vbrclab/basebybase; https://github.com/vbrclab/Codehop).
j-CODEHOP can be launched from within BBB (menu: Advanced) or from its own web page on the www.4virology.net website. In each case, the initial step is the download of the BBB alignment editor configuration file (*.jnlp), which is started by Java Web Start on the user’s own computer by default. Java Web Start requires at least Java 7, but less than Java 11 to run. The Java Runtime Environment (JRE) can be downloaded for free, if needed.
Multiple “help” files for BBB and CODEHOP are available, including a “quick start page”, “how to doc” and “help book”, which get progressively more detailed. A j-CODEHOP tutorial is also provided. Although users are requested to register their email for use of the VBRC, this is only used to allow the resource to email users occasionally to make them aware of important new features; many users choose to use nonidentifying email addresses.
The cowpox viruses (CPXV) used as examples are: BR (AF482758.2), Norway 1994 MAN (HQ420899.1), Germany 1998 2 (HQ420897.1), Germany 1980 EP4 (HQ420895.1), Germany 2002 MKY (HQ420898.1), EleGri07/1 (KC813507.1), BeaBer04/1 (KC813491.1), RatHei09/1 (KC813504.1), GRI-90 (X94355.2), and HumGra07 (KC813510.1). The core conserved nucleotide alignment (60 kb) was used to generate a maximum-likelihood phylogenetic tree using the GTRGAMMA model in RAxML v.8.2.10 [3 (link)].
Currently, BBB has an upper limit of about 500 protein sequences (300 aa each) due to the memory assigned to the tool.
Tu S.L., Staheli J.P., McClay C., McLeod K., Rose T.M, & Upton C. (2018). Base-By-Base Version 3: New Comparative Tools for Large Virus Genomes. Viruses, 10(11), 637.
Publication 2018
Amino Acid Sequence Cowpox virus Hybrids Memory Nucleotides Oligonucleotide Primers
2
Phylogenetic Analysis of Monkeypox Virus Isolates
Table 1 summarizes the MPXV isolates used in our phylogenetic analysis and provides references for the original description of the cases; they include (a) four isolates that correspond to MPXV obtained from outbreaks recorded in laboratories; (b) the five isolates included in the study by Likos et al.; (c) twelve isolates available from human case reports in Sub-Saharan Africa between 1970 and 2010; (d) one isolate obtained from a squirrel from Yambuku, DRC, which is the only MPXV isolate derived directly from wildlife included in this study; and (e) 23 isolates from human cases reported in Sankuru District, DRC between 2006 and 2007 [31 (link)]. In all, the 45 analyzed isolates cover the known range for MPX in Central and West Africa (Figure 1). Isolates form Nigeria, Cameroon, and Gabon are of particular interest for the present analysis since they are closer to one of the proposed biogeographic barriers (Cameroon Highlands) than the rest of the isolates from Western Africa or Congo Basin.
Genomes were sequenced using Sanger sequencing or Illumina® (Illumina Inc., San Diego, CA USA) paired end sequencing. Whole genomes of MPXV isolates were aligned using MAFFT v7.017 [32 (link)]. Cowpox virus (Grisham 1990, X94355) and horsepox virus (Mongolia 1976, DQ792504) isolates were included as outgroup taxa. The original alignment was 241,258 bp in length. The first 25 kb and last 26 kb are highly variable between CPXV and other Orthopoxviruses since they contain a large number of indels; thus, they were trimmed. Subsequently, all columns containing indels were removed, resulting in an alignment of 173,804 bases from the central conserved region of the genome. A majority-rules consensus tree was estimated from the alignment of all genomes using MrBayes v3.2.2 [33 (link),34 (link)]. Settings included a general time reversible model (lset nst = 6) with estimated stationary state frequencies and substitution rates, and a model of gamma-shaped rate variation across sites (rates=gamma). The tree search was carried out over five million generations.
A patristic distances matrix was obtained from the consensus tree and separated into the groups representing the two recognized MPXV clades. We tested the distance values within each group for normality via the Shapiro-Wilk test, compared their variances via the F-test and compared the two groups using a Student’s t-test; all statistical test were performed in R 3.1.1 [35 ]. MEGA v6.06 [36 (link)] was used to calculate within group uncorrelated p-distances for a subset of samples from the Lomela Health Zone in DRC.
Nakazawa Y., Mauldin M.R., Emerson G.L., Reynolds M.G., Lash R.R., Gao J., Zhao H., Li Y., Muyembe J.J., Mbala Kingebeni P., Wemakoy O., Malekani J., Karem K.L., Damon I.K, & Carroll D.S. (2015). A Phylogeographic Investigation of African Monkeypox. Viruses, 7(4), 2168-2184.
Publication 2015
Cowpox virus Disease Outbreaks Gamma Rays Genome Homo sapiens Horsepox virus INDEL Mutation Orthopoxvirus Squirrels Student Trees
3
Characterization of Reassortant H5N1 Influenza Viruses
The H5 HA and N1 NA of the reassortant H5N1 2003 and 2004 ca vaccine viruses were derived from influenza A/HK/213/2003 (H5N1 2003 wt) and A/VN/1203/2004 (H5N1 2004 wt) viruses, respectively, and the internal protein genes came from the AA ca donor virus. The H5N1 1997 reassortant vaccine candidate's H5 HA was derived from A/HK/491/1997 (H5N1 1997 wt), its N1 NA from A/HK/486/1997 (H5N1), and the remaining gene segments from AA ca. A/Beijing/262/95 ca (H1N1), which was generated by MedImmune Vaccines for seasonal influenza, was used as a control in evaluating the neurotropism of the viruses. A/New Caledonia/99 ca (H1N1) was generated by MedImmune Vaccines and was used as a control for evaluating vaccine efficacy in ferrets. A/Ann Arbor/6/60 (H2N2) wt (AA wt) and AA ca viruses were obtained from MedImmune Vaccines. Additional influenza A viruses used for challenge studies were A/Vietnam/JPHN30321/2005 (H5N1), which belongs to clade 1 [4 (link)], and A/Indonesia/05/2005 (H5N1), which belongs to clade 2 (R. Donis, Influenza Branch, Centers for Disease Control and Prevention, Atlanta, Georgia, United States, personal communication). The wt H5N1 viruses used in this study were kindly provided by N. Cox and A. Klimov, Influenza Branch, Centers for Disease Control and Prevention.
Virus stocks for the wt viruses were propagated in the allantoic cavity of 9- to 11-day-old embryonated specific pathogen-free (SPF) hen's eggs at 37 °C. The allantoic fluids from eggs inoculated with wt viruses were harvested 24 h postinoculation and tested for hemagglutinating activity. Eggs inoculated with ca reassortant viruses were incubated at 33 °C and were harvested 3 d postinoculation. Infectious allantoic fluids were pooled, divided into aliquots, and stored at −80 °C until use. The 50% tissue culture infectious dose (TCID50) for each virus was determined by serial titration of virus in Madin-Darby canine kidney (MDCK) cells and calculated by the method developed by Reed and Muench [22 ].
All experiments, including animal studies with infectious wt H5 avian influenza viruses and the reassortant viruses, were conducted using enhanced BSL-3 containment procedures in laboratories approved for use by the USDA and Centers for Disease Control and Prevention. Animal experiments were approved by the National Institutes of Health Animal Care and Use Committee. Experimental studies in chickens were approved by the USDA (SEPRL) Animal Care and Use Committee.
Suguitan AL J.r., McAuliffe J., Mills K.L., Jin H., Duke G., Lu B., Luke C.J., Murphy B., Swayne D.E., Kemble G, & Subbarao K. (2006). Live, Attenuated Influenza A H5N1 Candidate Vaccines Provide Broad Cross-Protection in Mice and Ferrets. PLoS Medicine, 3(9), e360.
Publication 2006
Allantois Animals Chickens Cowpox virus Dental Caries Eggs Ferrets Gene Products, Protein Genes Infection Influenza Influenza A virus Influenza A Virus, H5N1 Subtype Influenza in Birds Madin Darby Canine Kidney Cells Parainfluenza Virus 2, Human Reassortant Viruses Specific Pathogen Free Tissue Donors Tissues Titrimetry Vaccines Virus Viruses, Fowl Plague
4
Chimeric Orthopoxvirus CF33 Generation

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2018
Cells Chimera Clone Cells Coinfection Cowpox virus Dental Plaque Genotype HCT116 Cells Luciferases Luciferins Orthopoxvirus Parent Rabbitpox virus Raccoonpox virus Senile Plaques Strains Thymidine Kinase Transients Vaccinia virus Virus
5
Pseudorabies Virus Propagation and Vaccine Evaluation
Vero cells were used for virus propagation and titration in Dulbecco Modified Eagle Medium (Invitrogen, Carlsbad, CA, USA) supplemented with 10% heat-inactivated fetal bovine serum (Invitrogen), 100 μg/mL streptomycin, and 100 IU/mL penicillin. PRV Bartha-K61 vaccine with a virus titer of 105.5 50% tissue culture infectious doses (TCID50)/dose was purchased from Harbin Weike Biotechnology Development Co. (Harbin, China). According to the quality standards for this vaccine (14 ), the virus titer of qualified product is >5,000 TCID50/dose. PRV SC strain, which is highly pathogenic to sheep and pigs (4 ), was isolated in 1980 and has been maintained in our laboratory. This strain has been used as a challenge virus to test the effectiveness of Bartha-K61 vaccine in China from the time the vaccine was first licensed in this country (14 ).
An T.Q., Peng J.M., Tian Z.J., Zhao H.Y., Li N., Liu Y.M., Chen J.Z., Leng C.L., Sun Y., Chang D, & Tong G.Z. (2013). Pseudorabies Virus Variant in Bartha-K61–Vaccinated Pigs, China, 2012. Emerging Infectious Diseases, 19(11), 1749-1755.
Publication 2013
Cowpox virus Domestic Sheep Eagle Fetal Bovine Serum Genes, Viral Pathogenicity Penicillins Strains Streptomycin Sus scrofa Tissues Titrimetry Vaccines Vero Cells Virus

Most recents protocols related to «Cowpox virus»

1
Investigating Virus Infectivity's Role in Plaque Size
Not available on PMC !

Example 3

Investigation of Virus Infectivity as a Factor that Determines Plaque Size.

With the revelation that plaque formation is strongly influenced by the immunogenicity of the virus, the possibility that infectivity of the virus could be another factor that determines plaque sizes was investigated. The uptake of viruses into cells in vitro was determined by measuring the amounts of specific viral RNA sequences through real-time PCR.

To measure total viral RNA, total cellular RNA was extracted using the RNEasy Mini kit (Qiagen), and complementary DNA synthesized using the iScript cDNA Synthesis kit (Bio-Rad). To measure total viral RNA, quantitative real-time PCR was done using a primer pair targeting a highly conserved region of the 3′ UTR common to all four serotypes of dengue; inter-sample normalization was done using GAPDH as a control. Primer sequences are listed in Table 5. Pronase (Roche) was used at a concentration of 1 mg/mL and incubated with infected cells for five minutes on ice, before washing with ice cold PBS. Total cellular RNA was then extracted from the cell pellets in the manner described above.

TABLE 5
PCR primer sequences.
Gene TargetPrimer Sequence
DENV LYL 3′UTRForward: TTGAGTAAACYRTGCTGCCTGTA
TGCC (SEQ ID NO: 24)
Reverse: GAGACAGCAGGATCTCTGGTCTY
TC (SEQ ID NO: 25)
GAPDH (Human)Forward: GAGTCAACGGATTTGGTCGT
(SEQ ID NO: 26)
Reverse: TTGATTTTGGAGGGATCTCG
(SEQ ID NO: 27)
CXCL10 (Human)Forward: GGTGAGAAGAGATGTCTGAATCC
(SEQ ID NO: 28)
Reverse: GTCCATCCTTGGAAGCACTGCA
(SEQ ID NO: 29)
ISG20 (Human)Forward: ACACGTCCACTGACAGGCTGTT
(SEQ ID NO: 30)
Reverse: ATCTTCCACCGAGCTGTGTCCA
(SEQ ID NO: 31)
IFIT2 (Human)Forward: GAAGAGGAAGATTTCTGAAG
(SEQ ID NO: 32)
Reverse: CATTTTAGTTGCCGTAGG
(SEQ ID NO: 33)
IFNα (Canine)Forward: GCTCTTGTGACCACTACACCA
(SEQ ID NO: 34)
Reverse: AAGACCTTCTGGGTCATCACG
(SEQ ID NO: 35)
IFNβ (Canine)Forward: GGATGGAATGAGACCACTGTCG
(SEQ ID NO: 36)
Reverse: ACGTCCTCCAGGATTATCTCCA
(SEQ ID NO: 37)

The proportion of infected cells was assessed by flow cytometry. Cells were fixed and permeabilised with 3% paraformaldehyde and 0.1% saponin, respectively. DENV envelope (E) protein was stained with mouse monoclonal 4G2 antibody (ATCC) and AlexaFluor488 anti-mouse secondary antibody. Flow cytometry analysis was done on a BD FACS Canto II (BD Bioscience).

Unexpectedly, despite DENV-2 PDK53 inducing stronger antiviral immune responses, it had higher rates of uptake by HuH-7 cells compared to DENV-2 16681 (FIG. 5). This difference continued to be observed when DENV-2 PDK53 inoculum was reduced 10-fold. In contrast, DENV-3 PGMK30 and its parental strain DENV-3 16562 displayed the same rate of viral uptake in host cells. Furthermore, DENV-2 PDK53 showed a higher viral replication rate compared to DENV-2 16681. This was determined by measuring the percentage of cells that harbored DENV E-protein, detected using flow cytometry. DENV-2 PDK53 showed a higher percentage of infected cells compared to DENV-2 16681 at the same amount of MOI from Day 1 to 3 (FIG. 6). In contrast, DENV-3 PGMK30 showed a reverse trend and displayed lower percentage of infected cells compared to DENV-3 16562. Results here show that successfully attenuated vaccines, as exemplified by DENV-2 PDK53, have greater uptake and replication rate.

Results above demonstrate that the DENV-2 PDK53 and DENV-3 PGMK30 are polarized in their properties that influence plaque morphologies. While both attenuated strains were selected for their formation of smaller plaques compared to their parental strains, the factors leading to this outcome are different between the two.

Accordingly, this study has demonstrated that successfully attenuated vaccines, as exemplified by DENV-2 PDK53 in this study, form smaller plaques due to induction of strong innate immune responses, which is triggered by fast viral uptake and spread of infection. In contrast, DENV-3 PGMK30 form smaller plaques due to its slower uptake and growth in host cells, which inadvertently causes lower up-regulation of the innate immune response.

Based on the results presented in the foregoing Examples, the present invention provides a new strategy to prepare a LAV, which expedites the production process and ensures the generation of effectively attenuated viruses fit for vaccine use.

US11865083B2. Rapid method of generating live attenuated vaccines (2024-01-09). NATIONAL UNIVERSITY OF SINGAPORE [SG]. Inventors: Eng Eong Ooi [SG], Kenneth Goh [SG], Swee Sen Kwek [SG], Choon Kit Tang [SG].
Patent 2024
Antibodies, Anti-Idiotypic Antigens, Viral Antiviral Agents Canis familiaris Cells Common Cold Cowpox virus Dengue Fever Dental Plaque DNA, Complementary DNA Replication Flow Cytometry GAPDH protein, human Genes Homo sapiens Immunity, Innate Infection Interferon-alpha Monoclonal Antibodies Mus Oligonucleotide Primers paraform Parent Pellets, Drug Pronase Proteins Real-Time Polymerase Chain Reaction Response, Immune RNA, Viral Saponin Senile Plaques Strains Vaccines Virus Virus Diseases Virus Replication
2
Vaccine-Virus Titration by Plaque Assay
Vaccine-virus titration was conducted by plaque assay as reported previously (Lopez Juan de Abad et al.; 2019). Secondary chicken embryo fibroblasts (CEFs) were seeded with Leibovitz/McCoy medium modified with glutamine media and 4% calf serum for 24 h until a confluent monolayer formed. The monolayer was supplemented with 2% calf serum, changed every other day for the duration of the titration, and cells were incubated at 37 °C with 5% CO2. Briefly monolayer cultures of CEFs were infected with one dose of vaccine (which was reconstituted as per the manufacturers recommendations) and with three serial 10-fold dilutions. Vaccine ± CpG-ODN doses (5, 10, and 25 µg) were titrated in triplicate and the growth of the virus was determined through assessing the cytopathic effect on CEFs using an inverted microscope. Titration was evaluated through counting the number of plaque-forming nits (PFUs). Post-ED18 in ovo inoculations, the chicks that hatched in each of the treatment groups were counted and the hatchability was calculated and depicted in Figure 1.
Gaghan C., Browning M., Cortes A.L., Gimeno I.M, & Kulkarni R.R. (2023). Effect of CpG-Oligonucleotide in Enhancing Recombinant Herpes Virus of Turkey-Laryngotracheitis Vaccine-Induced Immune Responses in One-Day-Old Broiler Chickens. Vaccines, 11(2), 294.
Publication 2023
Biological Assay Cells Chickens Cowpox virus CPG-ODN Cytopathogenic Effect, Viral Dental Plaque Embryo Fibroblasts Glutamine Lice, Head Microscopy Serum Technique, Dilution Titrimetry Vaccination Vaccines Virus
3
PRV Virus Propagation and Titration
PRV wt Becker strain is a virulent field isolate from a dog at Iowa State University [16 (link)]. PRVtmv+ vaccine virus was constructed and characterized earlier [1 (link)]. Both PRV wt and PRVtmv+ were propagated in SK cells. Low-passage virus stocks were titrated by plaque assay in MDBK cells as described previously [17 (link)], aliquoted, and maintained at −80 °C.
Pavulraj S., Stout R.W., Paulsen D.B, & Chowdhury S.I. (2023). Live Triple Gene-Deleted Pseudorabies Virus-Vectored Subunit PCV2b and CSFV Vaccine Undergoes an Abortive Replication Cycle in the TG Neurons following Latency Reactivation. Viruses, 15(2), 473.
Publication 2023
Biological Assay Cells Cowpox virus Dental Plaque Strains Virus
4
Cross-protection Evaluation of Foot-and-Mouth Disease Vaccines
The two-dimensional virus neutralization test (2D-VNT) was conducted according to the foot-and-mouth disease manual [21 ]. Serum samples at 28 DPV were collected from 5 vaccinated cattle and pigs using the JC-VP1 and PA2-VP1 vaccines. The field viruses and homologous vaccine viruses were used for 2D-VNT. The neutralizing antibody titer of the vaccine serum against 100 TCID50 of each virus was estimated via regression. The r1 value was calculated as neutralizing antibody titer to field virus/neutralizing antibody titer to vaccine virus. An r1 value ≥ 0.3 was interpreted as cross-protected, and an r1 value < 0.3 was interpreted as unprotected.
Hwang S.Y., Shin S.H., Kim H.M., Shin S., Lee M.J., Kim S.M., Lee J.S, & Park J.H. (2023). Evaluation of Vaccine Strains Developed for Efficient, Broad-Range Protection against Foot-and-Mouth Disease Type O. Vaccines, 11(2), 271.
Publication 2023
Antibodies, Neutralizing Cattle Cowpox virus Foot-and-Mouth Disease Neutralization Tests Serum Sus scrofa Vaccines Virus
5
Phylogenetic Analysis of Swine Influenza Viruses
At the biannual WHO information meeting on the composition of influenza virus vaccines, animal influenza activity data for 6-month periods are presented and compared against human IAV vaccine components and pre-pandemic CVVs. All swine H3 HA sequences collected between 1 January 2020, and 30 June 2020 were downloaded from GISAID [19 (link)]. Sequences were compiled with human seasonal vaccine and CVV strains and aligned using MAFFT v7.453 [20 (link)]. We inferred a maximum-likelihood phylogeny for the HA nucleotide alignment using IQ-TREE v2 implementing automatic model selection [21 (link),22 (link)] with subsequent tree visualization and annotation in Smot v.1.0.0 [23 (link)]. The HA genes and associated available whole genome data were classified to a genetic clade or evolutionary lineage using the octoFLU pipeline [24 (link)], and a consensus HA1 for each identified clade was generated from the translated amino acid sequence data using flutile (https://github.com/flu-crew/flutile, accessed on 5 December 2022). We identified lineages circulating in the U.S. and selected a representative strain for each genetic clade by generating a pairwise distance matrix and choosing the best match between the HA1 clade consensus sequence and a virus isolate available in the USDA IAV swine virus repository. We excluded the 1970.1, 2000.3, and Other-Human-1990 lineages as they were not detected in the U.S. We did not identify field isolates for additional assessment from the 2010.2 lineage because it was less frequently detected and retained cross-reactivity with human seasonal vaccine anti-sera [14 (link)] or the 2010.1 lineage because it includes a within-clade CVV that was previously characterized in our swine-to-ferret model [25 (link)], and human sera contained cross-reactive antibodies to this clade [18 (link)]. Selected viruses were tested by hemagglutinin inhibition (HI) assay (using guinea pig red blood cells) against ferret antisera raised against human seasonal vaccine viruses and CVVs. For swine-to-ferret transmission studies, we expanded the selection criteria to ensure the identified strain included a representative neuraminidase (NA) and internal gene constellation through identifying the predominant evolutionary lineages and genetic clades paired to the HA genes using octoFLUshow [24 (link)]. We identified the amino acid differences between the characterized strains, clade consensus HA1 sequences, and within-clade CVVs, or human seasonal vaccine strains, using flutile (https://github.com/flu-crew/flutile, accessed on 5 December 2022).
Souza C.K., Kimble J.B., Anderson T.K., Arendsee Z.W., Hufnagel D.E., Young K.M., Gauger P.C., Lewis N.S., Davis C.T., Thor S, & Vincent Baker A.L. (2023). Swine-to-Ferret Transmission of Antigenically Drifted Contemporary Swine H3N2 Influenza A Virus Is an Indicator of Zoonotic Risk to Humans. Viruses, 15(2), 331.
Publication 2023
Amino Acids Amino Acid Sequence Animals Antibodies Biological Assay Biological Evolution Cavia Consensus Sequence Cowpox virus Cross Reactions Erythrocytes Ferrets Genes Genes, vif Genome Hemagglutinin Homo sapiens Immune Sera Neuraminidase Nucleotides Pandemics Psychological Inhibition Reproduction Serum Strains Sus scrofa Transmission, Communicable Disease Trees Vaccines Virus Virus Vaccine, Influenza

Top products related to «Cowpox virus»

1
Fetal bovine serum (fbs) by Thermo Fisher Scientific
Sourced in United States, China, United Kingdom, Germany, Australia, Japan, Canada, Italy, France, Switzerland, New Zealand, Brazil, Belgium, India, Spain, Israel, Austria, Poland, Ireland, Sweden, Macao, Netherlands, Denmark, Cameroon, Singapore, Portugal, Argentina, Holy See (Vatican City State), Morocco, Uruguay, Mexico, Thailand, Sao Tome and Principe, Hungary, Panama, Hong Kong, Norway, United Arab Emirates, Czechia, Russian Federation, Chile, Moldova, Republic of, Gabon, Palestine, State of, Saudi Arabia, Senegal
Fetal Bovine Serum (FBS) is a cell culture supplement derived from the blood of bovine fetuses. FBS provides a source of proteins, growth factors, and other components that support the growth and maintenance of various cell types in in vitro cell culture applications.
2
Qiaamp dna mini kit by Qiagen
Sourced in Germany, United States, France, United Kingdom, Netherlands, Spain, Japan, China, Italy, Canada, Switzerland, Australia, Sweden, India, Belgium, Brazil, Denmark
The QIAamp DNA Mini Kit is a laboratory equipment product designed for the purification of genomic DNA from a variety of sample types. It utilizes a silica-membrane-based technology to efficiently capture and purify DNA, which can then be used for various downstream applications.
3
Vero cell by American Type Culture Collection
Sourced in United States, Germany, Japan, United Kingdom, China
Vero cells are a cell line derived from the kidney of a normal adult African green monkey. They are epithelial-like cells and widely used in research, vaccine production, and viral infection studies.
4
Mdck cells by American Type Culture Collection
Sourced in United States, Germany, United Kingdom
MDCK cells are a well-established cell line derived from the kidney of a normal adult female cocker spaniel. These cells are commonly used in research to study various biological processes, including cell signaling, protein trafficking, and virus-host interactions. The MDCK cell line maintains a stable epithelial phenotype and is a widely utilized model system for studying cell polarity and tight junction formation.
5
Phytohemagglutinin (pha) by Merck Group
Sourced in United States, Germany, United Kingdom, Canada, Italy, Spain, Belgium, France, Australia, Switzerland, Brazil, Austria, Denmark, Norway
PHA is a type of laboratory equipment used for the analysis and characterization of polyhydroxyalkanoates (PHAs), which are biodegradable and renewable biopolymers. The PHA equipment is designed to facilitate the extraction, purification, and quantification of PHA samples, enabling researchers and scientists to study the properties and potential applications of these materials.
6
Vrna isolation kit by Qiagen
The VRNA isolation kit is a laboratory product designed to extract and purify viral RNA from various sample types. It is intended for use in scientific research and diagnostic applications.
7
Bovine serum albumin (bsa) by Merck Group
Sourced in United States, Germany, United Kingdom, China, Italy, Japan, France, Sao Tome and Principe, Canada, Macao, Spain, Switzerland, Australia, India, Israel, Belgium, Poland, Sweden, Denmark, Ireland, Hungary, Netherlands, Czechia, Brazil, Austria, Singapore, Portugal, Panama, Chile, Senegal, Morocco, Slovenia, New Zealand, Finland, Thailand, Uruguay, Argentina, Saudi Arabia, Romania, Greece, Mexico
Bovine serum albumin (BSA) is a common laboratory reagent derived from bovine blood plasma. It is a protein that serves as a stabilizer and blocking agent in various biochemical and immunological applications. BSA is widely used to maintain the activity and solubility of enzymes, proteins, and other biomolecules in experimental settings.
8
Bhk 21 cells by American Type Culture Collection
Sourced in United States, Germany
BHK-21 cells are a continuous cell line derived from baby hamster kidney cells. They are widely used in various research applications, including virus propagation, vaccine production, and cytotoxicity studies.
9
Vero e6 by American Type Culture Collection
Sourced in United States, Germany, Japan, Israel, Austria
The Vero E6 is a cell line derived from the kidney of the African green monkey (Cercopithecus aethiops). It is a widely used substrate for the isolation and propagation of various viruses, including coronaviruses. The Vero E6 cell line provides a consistent and reliable platform for viral culture and research.
10
Gentamicin sulfate by Thermo Fisher Scientific
Sourced in United States, United Kingdom, Italy
Gentamicin sulfate is a broad-spectrum antibiotic used in various laboratory applications. It acts as an antimicrobial agent to inhibit the growth of bacteria. Gentamicin sulfate is commonly used in cell culture media to prevent bacterial contamination.

More about "Cowpox virus"

Cowpox virus is a member of the Orthopoxvirus genus, which also includes the closely related vaccinia virus used in smallpox vaccines.
This zoonotic virus can infect both humans and other mammals, typically causing mild, localized skin lesions.
However, in some cases, it can lead to more severe systemic illness.
The virus is primarily transmitted to humans through direct contact with infected animals, often rodents like voles or mice.
Cowpox research is crucial for understanding the epidemiology, pathogenesis, and potential treatment options for this emerging viral disease.
Techniques like DNA extraction using the QIAamp DNA Mini Kit, cell culture in Vero or MDCK cells, and RNA isolation with VRNA kits can aid in studying the virus.
Factors like PHA stimulation and the use of bovine serum albumin or BHK-21 cells may also be relevant in Cowpox studies.
Vero E6 cells have been used to isolate and propagate the virus, while gentamicin sulfate can be employed as an antibiotic during culturing.
By leveraging the insights and tools provided by PubCompare.ai, researchers can streamline their Cowpox investigations, enhancing reproducibility and accuracy.