Log In Sign up
The largest database of trusted experimental protocols
> Living Beings > Virus > Papillomaviridae

Papillomaviridae

Papillomaviridae is a family of small, non-enveloped DNA viruses that infect a variety of host species, including humans.
These viruses are known for their ability to cause benign and malignant growths, such as warts and certain types of cancer.
Papillomaviruses have a circular, double-stranded DNA genome and replicate within the nucleus of the host cell.
The family includes over 200 identified virus types, each with its own tropism and disease association.
Papillomaviridae research is crucial for understanding the epidemiology, pathogenesis, and potential treatments for papillomavirus-related diseases, which can have significant public health implications.
PubCompare.ai is an AI-driven platform that can optimize your Papillomaviridae research by helping you locate the best protocols from literature, preprints, and patents, and identify the most effective methods and prodcuts for your needs, thereby enhancing reproducibility and accuracy in your studies.

Most cited protocols related to «Papillomaviridae»

1
Efficient Production of Fluorescent Pseudoviruses
Nucleotide maps of plasmids used in this work, as well as detailed protocols, are available at our laboratory website (http://home.ccr.cancer.gov/lco/default.asp). Various types of GFP-expressing pseudoviruses were produced according to previously described methods [7 (link)–9 (link),43 (link),44 (link)]. Briefly, 293TT cells were transfected with plasmids expressing the papillomavirus major and minor capsid proteins, L1 and L2, together with a GFP-expressing reporter plasmid, pfwB [8 (link)]. All PsV were produced using codon-modified L1 and L2 genes, except for HPV31 PsV, which used expression constructs based on wild-type L1 and L2 open reading frames. The high particle-to-infectivity ratio of HPV31 PsV stocks (Figure 4) is likely due to relatively poor expression of L2 (unpublished data). Codon-modified HPV45 L1 and L2 genes (p45L1w and p45L2w) were constructed based on sequencing of an HPV45 molecular clone. HPV16 PsV were produced using a previously unreported bicistronic L1/L2 expression plasmid, p16sheLL. Capsids were allowed to mature overnight in cell lysate, then purified using Optiprep gradients. The L1 protein content of PsV stocks was determined by comparison to bovine serum albumin standards in Coomassie-stained NuPAGE gels.
Fluorescently tagged capsids were generated by covalently conjugating Alexa Fluor 488 carboxylic acid, succinimidyl ester (Molecular Probes, Eugene, Oregon, United States) to HPV16 PsV, according to the manufacturer's instructions. Cell-binding inhibition results were also confirmed using fluorescent capsids generated by incorporation of an L2-GFP fusion protein [9 (link)]. Both types of fluorescent capsid displayed particle-to-infectivity ratios similar to wild-type HPV16 PsV (unpublished data).
Buck C.B., Thompson C.D., Roberts J.N., Müller M., Lowy D.R, & Schiller J.T. (2006). Carrageenan Is a Potent Inhibitor of Papillomavirus Infection. PLoS Pathogens, 2(7), e69.
Publication 2006
alexa fluor 488 Bos taurus Capsid Capsid Proteins Carboxylic Acids Cells Clone Cells Codon Esters Gels Genes Human papillomavirus 16 Human papillomavirus 31 human papillomavirus 45 Malignant Neoplasms Microtubule-Associated Proteins Molecular Probes Nucleotides Open Reading Frames Papillomaviridae Plasmids Proteins Psychological Inhibition Serum Albumin
2
HPV Detection from Oral Rinse Samples
Each participant provided an oral rinse sample collected in 0.9% normal saline after completing the survey. Approximately 1 mL of the oral rinse sample was centrifuged at 5000g for 5 minutes and DNA extracted from the pellet using the QIAamp DNA Mini Kit (Qiagen). Two recently developed novel PCR-based next-generation sequencing (NGS) assays targeting the consensus regions of HPV L1 open reading frame were used to detect and identify the full spectrum of human papillomaviruses including alpha-, beta-, and gamma-HPV types (Supplementary Figure S1) [17 , 22 (link)]. For each assay, a pair of unique 12-bp barcodes was introduced to the PCR amplicon by forward and reverse primers. Successful amplicons with predicted fragment sizes were pooled at approximately equal molar DNA concentrations and sequenced on an Illumina MiSeq (Illumina) using 150-bp paired-end reads. The demultiplexed paired-end Illumina short reads passing the quality filter (≥Q20 and ≥50 bp) were merged into single reads using FLASh v1.2.11 [23 (link)] and blasted against a genomes online database (gold) papilloma virus (PV) reference database using UPARSE software [24 (link)]. Our PV reference database contains 387 fully characterized human (n = 225) and animal (n = 162) PV types, and 467 potential novel partial PV sequences. An operation taxonomic unit (OTU) count table giving the number of reads per sample per OTU was created using a 95% identity threshold with in-house developed scripts [22 (link)]. The OTU taxonomy was classified at the type level based on sequence homology to the reference database: if OTUs hitting the reference database had ≥ 90% identities to a characterized PV type, they represented known viruses; those with 60%–89% identities were regarded as “uncharacterized” types and assigned with a unique identity. An HPV type was considered positive if the reads were ≥ 50. The processing from each NGS assay was separated while data was then combined to determine the presence of HPV DNA. HPV test results were not delinked to personal identifiers as clinical follow-up would be arranged for HPV-positive subjects for medicolegal reasons. We performed some measures to minimize the potential of contamination, where we processed the DNA extraction in a physically separated room from PCR amplification and introduced dual-index in the PCR primers. For each PCR amplification, multiple negative controls and random repeats were set.
Wong M.C., Vlantis A.C., Liang M., Wong P.Y., Ho W.C., Boon S.S., Sze R.K., Leung C., Chan P.K, & Chen Z. (2018). Prevalence and Epidemiologic Profile of Oral Infection with Alpha, Beta, and Gamma Papillomaviruses in an Asian Chinese Population. The Journal of Infectious Diseases, 218(3), 388-397.
Publication 2018
Animals Biological Assay Gamma Rays Genome Homo sapiens Molar Mouthwashes Normal Saline Oligonucleotide Primers Operating Tables Papillomaviridae Virus
3
Cost-Effectiveness of HPV Vaccination
The cost-effectiveness of HPV vaccine introduction for 12-year old girls was estimated using the Papillomavirus Rapid Interface for Modelling and Economics (PRIME). PRIME is a static model of HPV vaccination that uses proportional impact to estimate the cost-effectiveness of HPV vaccination before sexual debut. Cost-effectiveness results for all countries have been publicly available since 201413 (link); the model itself is publicly available with a user-friendly Excel interface (http://primetool.org). In this analysis, the published results from 2014 were used (consistent with the online tool), apart from updating vaccine prices to reflect new data and assuming a 2-dose schedule was used instead of a 3-dose schedule from 2015 following revised WHO recommendations.14 (link) The cost-effectiveness calculations account for costs of procuring and delivering 2 to 3 doses, costs averted by vaccination from avoiding cervical cancer treatment, and DALYs averted by vaccination from preventing morbidity and mortality owing to cervical cancer. Discounting at 3% for costs and benefits, a lifetime time horizon and healthcare perspective were used.
, & Jit M. (2021). Informing Global Cost-Effectiveness Thresholds Using Country Investment Decisions: Human Papillomavirus Vaccine Introductions in 2006-2018. Value in Health, 24(1), 61-66.
Publication 2021
Cervical Cancer Human Papilloma Virus Vaccine Papillomaviridae Vaccination Vaccines Woman
4
Systematic review of HPV transmission models

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2016
Conferences Eligibility Determination Human papillomavirus 16 Human Papilloma Virus Vaccine Infection Papillomaviridae Papillomavirus Vaccines prisma Transmission, Communicable Disease Vaccination Woman
5
Comprehensive HPV Genotyping and Viral Load Quantification Protocol
For genotyping, 5 µl of DNA extract was used from each of the
133 specimens. Two sensitive genotyping assays targeting HPV L1 and E7 gene
sequences were applied. The broad spectrum BSGP5+6+-PCR/Multiplex Papillomavirus
Genotyping (BSGP5+6+-PCR/MPG) assay homogenously amplifies a ~150 bp
fragment from the L1 region of 51 defined mucosotropic human
alpha-papillomavirus types including all HPV types classified by IARC/WHO as
carcinogenic, probably carcinogenic, or possibly carcinogenic3 . These 51 HPV types hereafter
are called mucosal HPV types. The assay further amplifies a 208 bp cellular
β-globin sequence. The detection limits per reaction are between 10 to
1,000 copies for the viral genomes and 300 copies for β-globin23 (link).
The type-specific E7-PCR/MPG assay (TS-E7-PCR/MPG) utilizes HPV
type-specific primer pairs targeting the E7 region of 21 genital HPV types plus
primers for the amplification of a β-globin sequence54 (link), 55 (link). The cycling conditions and the sequences of the
primers have been previously described56 (link). Here, a modified protocol for the amplification of
shorter (~100 bp) fragments for ten HPV types: HPV16, 18, 31, 33, 35,
52, 56, 66; 6 and 11, and 117 bp for β-globin, was applied. Modified,
shorter primer sequences are listed in Supplementary Table S2.
To measure viral load, a multiplex HPV16/18 quantitative real-time PCR
(qPCR) with very short amplicons was developed to best suit the analysis of DNA
extracted from fixed tissues (Schmitt et al., in preparation).
The multiplex HPV16/18 qPCR amplifies 104 bp of HPV16 E6, 110 bp of HPV18 E7,
and 110 bp of β-globin sequence with a detection limit of 10 HPV plasmid
and 10 β-globin copies per reaction. One µl of DNA extract was
used for viral load measurements. The primer and probes sequences are listed in
Supplementary Table
S3.
The HPV type-specific E6*I mRNA assays developed for 20 HR/pHR-HPV
types24 (link) and the E6
full length (fl) mRNA assay developed for HPV11, were applied for detection of
viral transcripts. These assays amplify 65 – 75 bp HPV and 81 bp
ubiquitin C (ubC) cDNA and were extensively validated on cervical and
head-and-neck SCC FFPE samples, deep fresh frozen specimens (DFT) and exfoliated
cells24 (link), 29 (link). Analytical sensitivity of
each assay is 10 to 100 copies per reaction for 19 HPV types and for ubC, 1,000
copies for HPV67 and 10,000 copies for HPV7024 (link). All 133 ESCC patients’ tissues were analyzed
for the presence of: (i) HPV16 E6*I mRNA, (ii) ubC mRNA as a cellular mRNA
positive control, and (iii) mRNA of the non-HPV16 types determined by genotyping
and/or serological assays. We did not test for mRNA of LR-HPV6 since the mRNA
assay for HPV6 could not be thoroughly validated on HPV6 DNA+ tissues.
Each ESCC specimen that had ≥25% non-necrotic tumor
cells prior and after sectioning for HPV DNA, RNA and IHC, and yielded HPV DNA
and/or β-globin DNA-positive (DNA+) signal in at least one of the three
methods used in the DNA analysis, was considered DNA valid. Specimens that were
HPV and/or ubC mRNA-positive (RNA+) in RNA analysis were considered RNA
valid.
Halec G., Schmitt M., Egger S., Abnet C.C., Babb C., Dawsey S.M., Flechtenmacher C., Gheit T., Hale M., Holzinger D., Malekzadeh R., Taylor P.R., Tommasino M., Urban M.I., Waterboer T., Pawlita M, & Sitas F. (2016). Mucosal Alpha-Papillomaviruses are not associated with Esophageal Squamous Cell Carcinomas: Lack of Mechanistic Evidence from South Africa, China and Iran and from a World-Wide Meta-Analysis. International journal of cancer, 139(1), 85-98.
Publication 2016
beta-Globins Biological Assay Carcinogens Cells DNA, Complementary E6 protein, Human papillomavirus type 16 Freezing Genitalia Globin Human papillomavirus 11 Human papillomavirus 16 Human papillomavirus 18 Hypersensitivity Mucous Membrane Neck Necrosis Oligonucleotide Primers Papillomaviridae Patients Real-Time Polymerase Chain Reaction RNA, Messenger Tissues Viral Genome

Most recents protocols related to «Papillomaviridae»

1
Comprehensive Viral Genome Sequencing Pipeline
The TaME-seq2 bioinformatic pipeline includes trimming of raw pair-end reads by removal of adapters, virus-specific primers, and nucleotides with a quality < 20 by cutadapt (v3.4) and quality check by FastQC (v.0.11.9) and MultiQC (v1.10.1). The trimmed reads were mapped to the virus-specific and human (hg38) reference genomes using HISAT2 [31 (link)] (v2.2.1). All available HPV reference genomes retrieved from the Papillomavirus Episteme (PaVE) [32 (link)] database were used in the reference genome file for HPV-positive samples, while NC_045512.2 was used for SARS-CoV-2 positive samples. Subsequently, mpileup from bcftool (v1.12) compiled the mapping statistics at a single nucleotide resolution. Mapping statistics and sequencing coverage from forward and reverse reactions for each sample were combined and visualised with an in-house R (v3.5.1) script, enabling evaluation of the method performance and downstream chromosomal integration and sequence variation analysis. This study excluded samples with < 300× mean sequencing depth from downstream analyses. This threshold may vary depending on the research aim.
Hesselberg Løvestad A., Stosic M.S., Costanzi J.M., Christiansen I.K., Aamot H.V., Ambur O.H, & Rounge T.B. (2023). TaME-seq2: tagmentation-assisted multiplex PCR enrichment sequencing for viral genomic profiling. Virology Journal, 20, 44.
Publication 2023
Chromosomes Genome Homo sapiens Nucleotides Oligonucleotide Primers Papillomaviridae SARS-CoV-2 Sequence Analysis Tosylarginine Methyl Ester Virus
2
Computational Epitope Prediction for HPV
Proteomic and genomic sequences of HPV strains were retrieved from Papillomavirus Episteme (PaVE) [45 (link)]. Uniprot database and Virus-mPLoc server were used to find subcellular positions of HPV proteins [46 (link)]. VaxiJen v2.0 server was used to predict antigenicity of selected proteins [47 (link)]. Molecular weight of antigenic protein was calculated using ‘Protein Information Resource’ (PIR) and verified by Expasy tool and Sequence Manipulation Suite (SMS) [48 (link)]. MvirDB was used to find proteins that are highly virulent and essential to HPV. Immune Epitope Database (IEDB) tool was used to predict T cell epitopes of selected antigenic proteins for multiple alleles of MHC class-I and II molecules. Epitope conservation analysis was also done by IEDB tool [49 (link)]. PEP_FOLD server was used to predict Three-Dimensional (3D) structure of peptides [50 (link)]. I-Tasser and Chimera [51 (link),52 (link)] tools were used to observe and visualize the epitopic regions and the underlying pattern of amino acids. Protein-Protein Interaction (PPI) analysis is important for the development of therapeutic strategies. Host-pathogen protein interaction helps to reveal therapeutic targets. PPI analysis helps in a prediction of protein functions and their role in inducing the host immunity [53 (link)]. We used cytoscape v3.6.0 software to construct PPI network [54 (link)]. Molecular Docking and in silico binding affinity of peptides with MHCI and II molecules was calculated by Molecular Operating Environment (MOE) software [14 (link)].
The framework shown in Figure 8 is applied to predict and design the potential epitopes of HPV using list of tools, servers and databases (Table 2).
Ismail M., Bai B., Guo J., Bai Y., Sajid Z., Muhammad S.A, & Shaikh R.S. (2023). Experimental Validation of MHC Class I and II Peptide-Based Potential Vaccine Candidates for Human Papilloma Virus Using Sprague-Dawly Models. Molecules, 28(4), 1687.
Publication 2023
Alleles Amino Acids Antigens Chimera Epitopes Epitopes, T-Lymphocyte Epitopic Genes, MHC Class I Genome Host-Pathogen Interactions Papillomaviridae Peptides Proteins Response, Immune Staphylococcal Protein A Strains Therapeutics Virus
3
Curating Canine Viral Genomic Sequences
We started by searching RefSeq (version 214) for virus assemblies with host field matching to “Canis lupus”, “Canis lupus familiaris” or “dog”, or virus name matching “Canine”. This resulted in 44 accessions including 30 complete genomes and 14 complete cds sequences. We then complemented this list by searching VirusHostDB [39 (link)] for viruses that were labelled with “Canis lupus familiaris” as their host. From this list we manually selected assemblies for viruses that are either well established canine pathogens (e.g., Lyssavirus rabies) or that have been isolated from a dog. We further extended our collection by adding Canine Influenza A virus H3N2 from the NCBI Influenza Virus Sequence Database. The H3N2 subtype is the latest and most common Influenza virus isolated from dogs in Asia and the United States [38 (link)]. Lastly, we pruned the list of collected canine papillomaviruses to include only one genome for each species-level taxon. This resulted in 7 canine papillomaviruses. The resulting collection of canine viral genomes included 57 assemblies and 39 unique virus taxa (accessions available in File S1).
Plyusnin I., Vapalahti O., Sironen T., Kant R, & Smura T. (2023). Enhanced Viral Metagenomics with Lazypipe 2. Viruses, 15(2), 431.
Publication 2023
Canis familiaris Genome Hydrophobia Influenza A virus Lupus Vulgaris Lyssavirus Orthomyxoviridae Papillomaviridae Pathogenicity Viral Genome Virus Virus Assembly Wolves
4
Papillomavirus Detection by PCR Screening
PCR screening for the presence of papillomavirus was done using the OneStep RT-PCR kit (Qiagen), according to the manufacturer’s instructions but omitting the initial reverse transcription step. In a first attempt, five sets of degenerate primer pairs previously developed by other groups were used to screen for papillomavirus DNA: FAP59 and FAP64, AR-L1F1 and AR-L1R3, AR-L1F11 and AR-L1R10, AR-E1F2 and AR-E1R3, and AR-E1F14 and AR-E1R12 [21 (link)–23 (link)]. Because all primer sets failed to amplify the target sequence, two specific primer sets were designed based on the FAP59 and FAP64 primer pair, replacing all degenerate sites by their specific counterparts in the EdPV-1/-2 genome. Amplicons obtained using these novel sets were purified using ExoSAP-IT (Thermo Fisher Scientific, Waltham, MA, US) and sent to Macrogen Europe for sanger sequencing. The resulting chromatograms were inspected using Chromas v2.6.2. A list of all used primer sequences is provided in Table 1.

Overview of used primer sequences

Primer nameSequence (5’-3’)References
FAP59TAACWGTNGGNCAYCCWTATTForslund et al. [23 (link)]
FAP64CCWATATCWVHCATNTCNCCATC
AR-L1F1TTDCAGATGGCNGTNTGGCTRector et al. [22 (link)]
AR-L1R3CATRTCHCCATCYTCWAT
AR-E1F2ATGGTNCAGTGGGCNTATGARector et al. [22 (link)]
AR-E1R3TTNCCWSTATTNGGNGGNCC
AR-L1F11GGDGAYATGATGGAHATWGGKhalafalla et al. [21 (link)]
AR-L1R10CCATTRTTCATDCCCTGDGC
AR-E1F14CTTTGACACAYAYCTCAGAAAYKhalafalla et al. [21 (link)]
AR-E1R12AGVTCTAANCGYYCCCATARCCTT
FAP59-EdPV-1TGACTGTCGGTCATCCTTATT
FAP64-EdPV-1TATGTCCACCATGTCCGAATC
FAP59-EdPV-2GCACTGTTGGACATCCATATT
FAP64-EdPV-2CCTATATCAAACATGTCTCCATC
EdPV-1-LT-FAAACCCAGCTCATCATTGTAGGG
EdPV-1-LT-RCAACAAAGACGCTCAGTTTCTGC
EdPV-2-LT-FTGTGTCCTTTGACCCTAAACAGG
EdPV-2-LT-RGTAGCTTCCACACAAGACGTTCC
Vanmechelen B., Lahoreau J., Dendauw P., Nicolier A, & Maes P. (2023). Co-infection of distinct papillomavirus types in a captive North American porcupine. Virology Journal, 20, 12.
Publication 2023
Genome Oligonucleotide Primers Papillomaviridae Reverse Transcriptase Polymerase Chain Reaction Reverse Transcription
5
Discovery and Characterization of Pangolin Papillomaviruses
We discovered an unidentified papillomavirus contig (NW_023450026.1) in pangolins by querying the RefSeq eukaryotic genomes database (ref_euk_rep_genomes) with 1413 papillomavirus reference proteins obtained from the NCBI Virus Resource (June/2022) [18 (link),19 (link)]. Screening was performed using the tblastn algorithm (-task tblastn-fast) implemented by the ElasticBLAST (v0.2.6) method on the Google Cloud Platform [20 ,21 ]. The search returned 1017 hits with e-values less than 1×10−5 to an unplaced genomic scaffold (YNU_ManJav_2.0 scaffold_14136) from the RefSeq genome assembly of the Malayan pangolin.
The 7307-bp contig was annotated using the PuMA pipeline [22 (link)]. This sequence corresponded to a full papillomavirus genome encoding L1, L2, E1, E2, E6 and E7, in addition to two spliced products (E1^E4 and E8^E2). Given that the papillomavirus genome was intact, we screened the short-read data of the re-sequenced genomes of 72 Malayan pangolin and 22 Chinese pangolin individuals, which were deep-sequenced from samples of pangolin muscle by Hu et al. [23 (link)]. We obtained the SRA experiment accession numbers from this study (BioProject IDs: PRJNA529540 and PRJNA529512) and used a combination of blastn and tblastn on the NCBI [24 (link)] to find reads with significant similarity to papillomaviruses.
We downloaded the short-read sequences of the SRA experiments with more than 100 significant matches (e-value < 0.01) and tried to de novo assemble complete viral genomes or the L1 gene. Fasta files were concatenated, and the duplicate sequences were removed with SeqKit [25 (link)]. We used a custom Python 3 script to sort the sequences into forward, reverse and orphan reads (script available in the electronic supplementary material). The reads in these files were assembled in SPAdes v3.15.4 [26 (link)], using the ‘–metaviral’ and ‘–assembler-only’ flags. Contigs of complete viral genomes were annotated using PuMA. Contigs of L1 genes were examined in ORFfinder to check for the presence of an intact L1 open reading frame [27 ]. The molecular weight and isoelectric point of predicted protein products were estimated in ExPASy [28 (link)]. We calculated the coverage (depth) of our assembled sequences using Magic-BLAST [29 (link)], mapped reads were sorted and the coverage calculated using samtools [30 (link)].
To study the systematics of these viruses, we inferred a Bayesian phylogeny of the L1 and E1 proteins. We first selected a set of viruses using the pangolin papillomavirus L1 sequences in searches of the PaVE papillomavirus taxonomy tool [31 (link)]. We chose papillomaviruses recognized by the ICTV in addition to the Tupaia belangeri papillomavirus 1 (TbelPV1) and Tupaia belangeri papillomavirus 2 (TbelPV2) described in the study of Liu et al. [32 (link)]. Sequences were aligned in MAFFT v7.490 using the accurate option (MAFFT L-INS-i) [33 (link)]. Alignments were trimmed and the best substitution models for the alignments (both LG + I + G4 + F) were found in ModelTest-NG [34 (link)]. We then inferred a Bayesian phylogeny in MrBayes version 3.2.7a [35 (link)] with an MCMC chain length of 1 000 000 or 4 000 000 generations, respectively (burn-in = 25%). In both cases, convergence was assessed by ensuring that the average s.d. of split frequencies was less than 0.01, and the potential scale reduction factor for all parameters was approximately 1.
Nino Barreat J.G., Kamada A.J., Reuben de Souza C, & Katzourakis A. (2023). Discovery of novel papillomaviruses in the critically endangered Malayan and Chinese pangolins. Biology Letters, 19(1), 20220464.
Publication 2023
Chinese Eukaryota Genes Genome Muscle Tissue Orphaned Children Papillomaviridae PAVe protocol 1 Pholidota Proteins Puma Python Tupaia Viral Genome Virus

Top products related to «Papillomaviridae»

1
Dneasy blood and tissue kit by Qiagen
Sourced in Germany, United States, United Kingdom, Spain, Canada, Netherlands, Japan, China, France, Australia, Denmark, Switzerland, Italy, Sweden, Belgium, Austria, Hungary
The DNeasy Blood and Tissue Kit is a DNA extraction and purification product designed for the isolation of genomic DNA from a variety of sample types, including blood, tissues, and cultured cells. The kit utilizes a silica-based membrane technology to efficiently capture and purify DNA, providing high-quality samples suitable for use in various downstream applications.
2
Kapa hifi polymerase by Roche
Sourced in United States, Switzerland
KAPA HiFi polymerase is a high-fidelity DNA polymerase enzyme used in various molecular biology applications. It is known for its ability to perform accurate and efficient DNA amplification with a low error rate.
3
Pjet1.2 plasmid by Thermo Fisher Scientific
Sourced in United States
The PJET1.2 plasmid is a laboratory tool used for molecular cloning and recombinant protein expression. It features a T7 promoter, which allows for high-level expression of target genes in Escherichia coli (E. coli) host cells. The plasmid also contains a multiple cloning site, allowing for the insertion of foreign DNA fragments, and an antibiotic resistance marker for selection purposes.
4
Chemiimager 5500 by Bio-Techne
Sourced in United States
The ChemiImager 5500 is a laboratory imaging system designed for the detection and analysis of chemiluminescent and fluorescent signals in a variety of applications, including Western blotting, EMSA, and colony counting.
5
T4 dna ligase by Roche
Sourced in Germany, United States, Switzerland
T4 DNA ligase is an enzyme that catalyzes the formation of phosphodiester bonds between adjacent 3'-hydroxyl and 5'-phosphate termini in double-stranded DNA. It is derived from the T4 bacteriophage and is commonly used in molecular biology and genetic engineering applications for the ligation of DNA fragments.
6
Kapa htp library preparation kit by Roche
Sourced in Switzerland, United States
The KAPA HTP Library Preparation Kit is a laboratory equipment product designed for the preparation of DNA libraries used in next-generation sequencing applications. The kit provides the necessary reagents and protocols for efficient library construction from a variety of sample types.
7
Tapestation by Agilent Technologies
Sourced in United States, Germany, United Kingdom, France, Canada, Japan, Australia
The TapeStation is a laboratory instrument that provides automated analysis of DNA and RNA samples. It measures the size, concentration, and integrity of nucleic acid samples in a quick and efficient manner.
8
Sw41.1 rotor by Beckman Coulter
The SW41.1 rotor is a high-performance swinging-bucket ultracentrifuge rotor designed for Beckman Coulter centrifuge instruments. It is capable of achieving high centrifugal forces, making it suitable for a variety of sample preparation and separation applications.
9
Nextflex 96 dna barcodes by PSC Biotech
Sourced in United States
The NEXTflex-96 DNA Barcodes is a set of 96 unique DNA barcode sequences designed for multiplexed sequencing applications. These barcodes can be used to label and identify individual samples in a pooled sequencing library, enabling high-throughput analysis of multiple samples simultaneously.
10
Dneasy blood tissue kit by Qiagen
Sourced in Germany, United States, United Kingdom, Netherlands, Spain, Japan, China, Canada, France, Australia, Switzerland, Italy, Belgium, Denmark, Sweden
The DNeasy Blood & Tissue Kit is a DNA extraction and purification kit designed for the efficient isolation of high-quality genomic DNA from a variety of sample types, including whole blood, tissue, and cultured cells. The kit utilizes a silica-based membrane technology to capture and purify DNA, providing a reliable and consistent method for DNA extraction.

More about "Papillomaviridae"

Papillomaviridae, the family of small, non-enveloped DNA viruses, are known for their ability to cause a variety of host-specific diseases, including benign warts and malignant cancers.
These viruses have a circular, double-stranded DNA genome and replicate within the nucleus of the host cell.
With over 200 identified virus types, each with its own unique tropism and disease association, Papillomaviridae research is crucial for understanding the epidemiology, pathogenesis, and potential treatments of these important public health concerns.
To optimize your Papillomaviridae research, the AI-driven platform PubCompare.ai can help you locate the best protocols from literature, preprints, and patents.
By utilizing AI-powered comparisons, you can easily identify the most effective methods and products for your needs, such as the DNeasy Blood and Tissue Kit for DNA extraction, KAPA HiFi polymerase for high-fidelity amplification, and the PJET1.2 plasmid for cloning.
Additionally, tools like the ChemiImager 5500 and T4 DNA ligase can support your Papillomavirus studies.
For library preparation, the KAPA HTP Library Preparation Kit and NEXTflex-96 DNA Barcodes can be valuable resources.
The TapeStation and SW41.1 rotor can also assist in quality control and sample processing.
By streamlining your research with PubCompare.ai and leveraging these specialized tools and kits, you can enhance the reproducibility and accuracy of your Papillomaviridae studies, leading to a better understanding of these important viruses and their related diseases.