Picornaviridae

Mitochondrial membrane potential was detected using mitochondrial membrane potential assay kit (Beyotime, Shanghai, China), according to the manufacturer’s instructions. Briefly, the cells were mock-infected or infected with picornavirus and collected and stained with JC-1 (1:200) at 37°C for 30 min. JC-1 fluorescence was tested at 514–529 nm (green fluorescence, JC-1 monomers) and 585–590 nm (red fluorescence, JC-1 aggregates) using a spectrofluorometer (Thermo Scientific). JC-1 fluorescence images were visualized using a Nikon Eclipse 80i fluorescence microscope. The images were captured using NIS Elements F 2.30 software. The occurrence of JC-1 green fluorescence indicates mitochondrial depolarization.

RNA was isolated from samples using the QIAamp Viral RNA kit (Qiagen, Hilden, Germany). Ten μL of undiluted RNA specimen was used as input for first strand synthesis with the Reverta-L RT reagents kit (AmpliSense, Moscow, Russia). Second strand synthesis was performed using Second Strand Synthesis Module (NEB #E611, Ipswich, MA, USA). M220 Focused-ultrasonicator (Covaris, Woburn, MA, USA) was used to fragment DNA to ~550 bp. Paired-end sequencing libraries were constructed with NEBNext^® Ultra™ End Repair/dA-Tailing Module (NEB E7546L, Ipswich, MA, USA), NEBNext^® Ultra™ Ligation Module (NEB E7595L, Ipswich, MA, USA), Y-shaped adapters compatible with IDT for Illumina Nextera DNA UD Indexes, and NEBNext^® Ultra™ II Q5^® Master Mix (NEB M0544X, Ipswich, MA, USA), for barcoding PCR, according to the manufacturer’s instructions. The quality and fragment length distribution of the obtained libraries were evaluated with Agilent Bioanalyzer 2100 (Agilent Technologies, Santa Clara, CA, USA). The first several libraries were sequenced on an Illumina MiSeq instrument using v3 600 cycle reagent kit (Illumina, San Diego, CA, USA). The other libraries were sequenced on an Illumina NextSeq 2000 instrument using P2 300 cycle reagent kit (Illumina, San Diego, CA, USA). Sequencing depth varies among samples and highly depends on the quality of a sample and on the sequencing machine used. Since Illumina NextSeq 2000 generates much more data than Illumina MiSeq, samples sequenced on NextSeq have significantly higher sequencing depths. Final output from NextSeq was 9300 Mb per sample on average (31 million paired-end reads) and from MiSeq 1600 Mb per sample (2,7 millions paired-end reads).
To apply the SMART technology to the samples, we decided to use Mint cDNA synthesis kit (Evrogen JSC, Moscow, Russia) with the replacement of the 3′-primer with another specific one. A contig with a low degree of homology to previously known viruses was selected from the 1_N. noctula_miseq_Saratov sample using the BLASTX tool with the Mask low-complexity regions option turned off. This contig was therefore classified as Picornaviridae sp. with E-value equal to 0.0001 and amino acid identity of 29.4%. Only four reads out of 3,704,908 were mapped to this contig. One of these reads (Supplementary Material S1) was selected for primer construction (AAGCAGTGGTATCAACGCAGAGTAC). When mapping the read with BLAST to picornavirus genome, it was detected that it mapped in the reverse orientation to the virus. Picornaviruses possess an RNA genome with positive polarity, so a reverse primer was selected for SMART amplification to reverse-complement the sequence of the read. It was then tailed with a Mint adapter to facilitate its amplification and sequencing. The final sequence of the primer with the adapter was AAGCAGTGGTGGTATCAACGCAGAGAGTAC-AGGTTTGACAATGCAGCAGA.
Next, following the selection of a picornavirus-like read in the metagenomic data and primer construction, we applied the SMART method using a complementary primer and the Mint cDNA synthesis kit (Evrogen, Russia) in accordance with the manufacturer’s guidelines. SMART product sequencing libraries were prepared using the Nextera XT kit. The sequencing was performed on the Illumina MiSeq, utilizing the V2 300 cycle reagent kit.