> Living Beings > Virus > T-Cell Leukemia Viruses, Human

T-Cell Leukemia Viruses, Human

T-Cell Leukemia Viruses are a group of retroviruses that primarily infect and transform T lymphocytes, leading to various forms of T-cell leukemia and lymphoma.
These viruses, including the Human T-Cell Leukemia Virus (HTLV) types 1 and 2, play a crucial role in the development of certain hematological malignancies.
Reserach on T-Cell Leukemia Viruses is essential for understanding the pathogenesis, epidemiology, and potential treatments for these complex and ofthen aggressive cancers.
The PubCompare.ai platform can help accelerate this critical research by streamlining the identification of optimal protocols from the literature, preprints, and patents, enhanceing reproducibility and driving scientific breakthroughs.

Most cited protocols related to «T-Cell Leukemia Viruses, Human»

Clinical Applications of Western Blotting

Cited 24 times

Western blotting is a valuable tool to studies ranging from regulatory signaling processes to confirmatory serum diagnosis of HIV [68 (link)–70 (link)]. The evolution of western blot technique from identification of a specific protein in a complex mixture to the direct detection of protein in a single cell allows this technique to be an important analytical tool for clinical research. An advanced single cell western blotting technique was employed to study stem cell signaling and differentiation as well as drug response in tumor cells [69 (link)]. Through single cell western blotting it was possible to analyze cell-to-cell variations in approximately 2000 cells simultaneously within complex populations of cells [71 (link)]. With the integration of intact cell imaging, the technique allows the identification of protein expression changes of a single drug resistant tumor cell and its isoforms among heterogeneous population of tumor cells in human glioblastoma cells treated with chemotherapeutic daunomycin [69 (link)]. Identification of upregulated multidrug resistant protein, P-glycoprotein in living glioblastoma subpopulations was indicative of an active drug eflux pump as an underlying mechanism for drug resistance [69 (link),71 (link)]. With the application of 2-DE gel separation together with spotting of protein by peptide mass fingerprint, the analysis of clinically relevant Helicobacter pylori (H. pylori) in related gastric disease conditions (chronic gastritis, duodenal ulcer) was possible [72 (link)]. The database of H. pylori (low expressed and membrane proteins) was created through the application of one-dimensional or 2-DE/MALDI-mass spectrometry techniques [72 (link)]. In a similar manner, the Simple Western technique was employed for the analysis of 15-valent pneumococcal vaccine PCV15-CRM197 [73 (link)]. Due to its high sensitivity and automation, the Simple Western method may be extended to analyze serotypes of other polysaccharide protein conjugate vaccines [73 (link)].
Western blotting is commonly used for the clinical diagnosis of various parasitic and fungal diseases including echinococcosis [74 (link)], toxoplasmosis [75 (link)], and aspergillosis [76 (link)]. In a recent study, the assay was successfully used for the reliable serodiagnosis of Farmer’s lung disease (FLD), a pulmonary disorder caused by inhalation of antigenic particles [77 (link)]. Thus, this technique can be exploited for rapid routine diagnosis of FLD in clinics [77 (link)]. Similarly, for immunodiagnostic of tuberculosis meningitis which is a chronic disease of central nervous system different molecular and immunological methods were used for clinical diagnosis of the disease. However, each of these techniques has their own limitations [78 (link)]. To overcome diagnostic issues of lower sensitivity and specificity, the immunoreactivity to Mycobacterium tuberculosis antigens was performed by western blotting [78 (link)]. Furthermore, western blotting was performed for the early and sensitive diagnosis of congenital toxoplasmosis [79 (link)] and was employed for rapid and sensitive serological diagnosis of a serious infectious disease paracoccidioidomycosis (PCM) [80 (link)]. Using immunoblotting, a new subgroup of human lymphotropic retroviruses (HTLV), was detected in patients with the acquired immunodeficiency syndrome (AIDS) [81 (link)]. Antigens of HTLV-III, specifically detected by antibodies in serum from AIDS or pre-AIDS patients [81 (link)]. Western blotting has also been used as a test for variant Creutzfeldt-Jakob Disease [82 (link)], some forms of Lyme disease [83 (link)] and is sometimes used as a confirmatory test for Hepatitis B [84 ] and Herpes Type 2 [85 (link)] infections. Western blots have also been used to confirm feline immunodeficiency status in cats [86 (link)].
Recently, a commercial Aspergillus western blotting IgG kit was developed by LD Bio Diagnostics (France) to carry out immunoblotting for the clinical diagnosis of chronic aspergillosis. The commercial kit was found to be sensitive and can analyze hundreds of samples from patients with aspergillus disease [87 (link)]. Thus, the clinical applications of western blotting technique will continue to progress as further advancements are made to improve sensitivity and reproducibility of the western blot.

Mishra M., Tiwari S, & Gomes A.V. (2017). Protein purification and analysis: next generation Western blotting techniques. Expert review of proteomics, 14(11), 1037-1053.

Publication 2017

Acquired Immunodeficiency Syndrome Antibodies Antigens Aspergillosis Aspergillus Biological Assay Biological Evolution Cells Central Nervous System Diseases Communicable Diseases Complex Mixtures CRM197 (non-toxic variant of diphtheria toxin) Daunorubicin Diagnosis Duodenal Ulcer Echinococcosis Farmers Felidae Fingerprints, Peptide Gastritis Glioblastoma Helicobacter pylori Hepatitis B HIV Antigens Homo sapiens Hypersensitivity Immunodiagnosis Immunologic Deficiency Syndromes Immunologic Techniques Infection Inhalation Lung Diseases Lyme Disease Mass Spectrometry Membrane Proteins Mycobacterium tuberculosis antigens Mycoses Neoplasms New Variant Creutzfeldt-Jakob Disease P-Glycoprotein Paracoccidioidomycosis Patients Pharmaceutical Preparations Pharmacotherapy Pneumococcal Vaccine Polysaccharides Population Group Protein Isoforms Proteins Resistance, Drug Retroviridae Serodiagnosis Serum Spectrometry, Mass, Matrix-Assisted Laser Desorption-Ionization Staphylococcal Protein A Stem, Plant Stem Cells Stomach Diseases T-Cell Leukemia Viruses, Human Toxoplasmosis Toxoplasmosis, Congenital Tuberculosis, Meningeal Vaccines, Conjugate Western Blot Western Blotting

Characterization of Diverse Viral Systems

Cited 23 times

Huh-7, Huh-7.5, and 293T cells were maintained in DMEM (Invitrogen) with 10% FBS and 0.1mM non-essential amino acids. STAT1^−/−Fib (an SV40 large T antigen immortalized skin fibroblast line) and MT-4 (an HTLV-1 immortalized T cell line) were grown in RPMI (Invitrogen) with 10% FBS. BHK-J cells were grown in MEM (Invitrogen) with 7.5% FBS. Infectious HCV-Ypet³¹ (derived from Bi-Ypet-Jc1FLAG2), YFV-Venus³¹ (derived from YF17D-5′C25Venus2AUbi), WNV-GFP³² (derived from pBELO-WNV-GFP-RZ ic) and CHIKV-GFP³³ (derived from pCHIKV-LR 5′GFP), SINV/SINV-GFP³⁴ (derived from pS300/pS300-GFP), SINV-Fluc and the temperature sensitive variant SINV(ts6)Fluc were derived from pToto1101/Luc and pToto11-1/Luc:ts6. SINV(ts6)Fluc carries mutations that prevent replication at the nonpermissive temperature, but the virus retains the ability to translate incoming genomes³⁵. VEEV-GFP is a double subgenomic EGFP reporter virus derived from the TC83 vaccine strain of Venezuelan equine encephalitis (kindly provided by I. Frolov).
HCV subgenomic replicon RNAs were derived from Bi-Gluc-JFH(SG) and Bi-Gluc-JFH-GNN(SG), which are bicistronic constructs expressing Gluc from the HCV IRES and genotype 2a JFH-1 nonstructural proteins from the EMCV IRES. The GNN variant encodes polymerase mutations and is not competent for replication. Viral stocks were generated by electroporation of in vitro transcribed RNAs into Huh-7.5 (HCV) or BHK-J (YFV, WNV, VEEV, CHIKV, SINV) as previously described^{32 ,33 ,35 , 36 ,37 ,38}. Single cycle HIV-1-GFP was generated by transfection of HEK 293T cells with a modified env- proviral plasmid encoding GFP in place of Nef (pR7/Δenv/GFP)³⁹. HIV particles were pseudotyped with VSV-G glycoprotein. Lentiviral pseudoparticles with no envelope or carrying HCV glycoprotein (HCVpp) were generated and assayed for HCV entry as previously described⁴⁰. Experiments with WNV, CHIKV, and HIV-1 were carried out in biosafety level 3 containment in compliance with institutional and federal guidelines.

Schoggins J.W., Wilson S.J., Panis M., Murphy M.Y., Jones C.T., Bieniasz P, & Rice C.M. (2011). A diverse array of gene products are effectors of the type I interferon antiviral response. Nature, 472(7344), 481-485.

Publication 2011

Amino Acids, Essential Cell Lines Cells DNA Replication Electroporation Encephalomyocarditis virus Fibroblasts Genotype Glycoproteins HEK293 Cells HIV-1 Infection Internal Ribosome Entry Sites Large T-Antigen Mutation Plasmids Proteins Proviruses RNA Simian virus 40 Skin STAT1 protein, human Strains Subgenomic Replicon RNA T-Cell Leukemia Viruses, Human Transfection Vaccines Venezuelan Equine Encephalomyelitis Virus

Versatile CRISPR/Cas9 Vector Construction

Cited 22 times

Vector expressing both gRNA and mCherry (pCAGmCherry-gRNA) was generated as previously described^{30 (link)}. To construct gRNA expression vectors, each 20 bp target sequence was sub-cloned into pCAGmCherry-gRNA or gRNA_Cloning Vector (Addgene 41824). The CRISPR/Cas9 target sequences (20 bp target and 3 bp PAM sequence (underlined)) used in this study include: scramble, GCTTAGTTACGCGTGGACGAAGG; mutant GFP, CAGG GTAATCTCGAGAGCTTAGG; MH1, GCCGCTTTACTTAGGTCCCCGGG; and MH2, GGAGATCCACTCTCGAGCCCGGG; for PITCh donor: mouse Tubb3, AGCTGCGAGCAACTTCACTTGGG; human TUBB3, AGCTGCGAGCAGCTT CACTTGGG; human KCNQ1, AGTACGTGGGCCTCTGGGGGCGG; the downstream of CAG promoter in Ai14 mouse, TAGGAACTTCTTAGGGCCCGCGG; rat Mertk for HITI, GAGGACCACTGCAACGGGGCTGG; rat Mertk for HDR, TCAGGTGCTTAGGCATTTCGTGG. The Scramble-gRNA target sequence we designed is an artificial sequence that does not exist in human, mouse and rat genomes. We used the off-target finder software Cas-OFFinder (http://www.rgenome.net/cas-offinder/) to confirm that there were no genomic target sites within 2-bp mismatches. We have confirmed that the Scramble-gRNA can cut its target site in the donor vector (Extended Data Fig. 1b). pMDLg/pRRE, pRSV-Rev and pMD2.G (Addgene 12251, 12253 and 12259) were used for packaging lentiviruses. pEGIP*35 and tGFP (Addgene 26776 and 26864) were used for examining HDR and HITI efficiencies. To construct IRESmCherry-0c, IRESmCherry-1c, IRESmCherry-2c, IRESmCherry-MH, IRESmCherry-HDR-0c and IRESmCherry-HDR-2c, IRES and mCherry sequences were amplified with Cas9 target sequence by PCR from pEGIP*35 and pCAGmCherry-gRNA, respectively and co-integrated into pCR-bluntII vector (Invitrogen) with zero, one or two CAS9/gRNA target sequences. Cas9 expression plasmid (hCas9) was purchased from Addgene (41815). To generate different NLS-dCas9 constructs, pMSCV-LTR-dCas9-VP64-BFP (Addgene 46912) was used to amplify dCas9, which was subsequently subcloned into pCAG-containing plasmid with different NLS and 3 × Flag tag. To construct pCAG-Cas9 (no NLS), pCAG-1NLS-Cas9-1NLS and pCAG-1BPNLS-Cas9-1BPNLS, D10A and H840A mutations of dCas9 plasmids were exchanged to wild-type sequence by In-Fusion HD Cloning kit (Clontech). Then, pCAG-Cas9-2AGFP (no NLS), pCAG-1NLS-Cas9-1NLS-2AGFP and pCAG-1BPNLS-Cas9-1BPNLS-2AGFP were constructed by adding 2AGFP downstream of Cas9. To construct pCAG-floxSTOP-1BPNLS-Cas9-1BPNLS, 1BPNLS-Cas9-1BPNLS was amplified by PCR and exchanged with GFP of pCAG-floxSTOP-EGFP-N1 vector^{31 (link)}. To construct HITI donor plasmids for mouse and human Tubb3 gene (Tubb3-1c, Tubb3-2c, Tubb3-2cd, hTUBB3-1c and hTUBB3-2c) and PITCh donor (Tubb3-MH), GFP was subcloned into pCAG-floxSTOP plasmid with one or two CAS9/gRNA target sequences. To construct HDR donor for mouse Tubb3 gene (Tubb3-HR), GFP, 5′ and 3′ homology arms were amplified from pCAG-GFP-N1 or mouse genome, then subcloned into pCAG-floxSTOP plasmid. pCAG-ERT2-Cre-ERT2 was purchased from Addgene (13777). PX551 and PX552 were purchased from Addgene (60957 and 60958). To construct AAV-Cas9, nEF (hybrid EF1 α/HTLV) promoter (Invivogen) was exchanged with Mecp2 promoter of PX551. To construct donor/gRNA AAVs for HITI, donor DNA sandwiched by Cas9/gRNA target sequence, gRNA expression cassette and GFPKASH (or mCherryKASH) expression cassettes were subcloned between ITRs of PX552, and generated pAAV-mTubb3, pAAV-Ai14-HITI, pAAV-Ai14-luc, pAAV-Ai14-scramble and pAAV-rMertk-HITI. For pAAV-rMertk-HITI, exon 2 of rat Mertk gene including the surrounding intron is sandwiched by Cas9/gRNA target sequence, which is expected to integrate within intron 1 of Mertk by HITI. For HDR AAV (pAAV-Ai14-HDR and pAAV-rMertk-HDR), the homology arms were amplified by PCR from mouse and rat genome DNA, and subcloned into AAV backbone plasmid. The plasmids described in this manuscript will be available to academic researchers through Addgene.

Suzuki K., Tsunekawa Y., Hernandez-Benitez R., Wu J., Zhu J., Kim E.J., Hatanaka F., Yamamoto M., Araoka T., Li Z., Kurita M., Hishida T., Li M., Aizawa E., Guo S., Chen S., Goebl A., Soligalla R.D., Qu J., Jiang T., Fu X., Jafari M., Esteban C.R., Berggren W.T., Lajara J., Nuñez-Delicado E., Guillen P., Campistol J.M., Matsuzaki F., Liu G.H., Magistretti P., Zhang K., Callaway E.M., Zhang K, & Belmonte J.C. (2016). In vivo genome editing via CRISPR/Cas9 mediated homology-independent targeted integration. Nature, 540(7631), 144-149.

Publication 2016

Arm, Upper c-Mer Tyrosine Kinase Cloning Vectors Clustered Regularly Interspaced Short Palindromic Repeats Elongation Factor 1alpha Exons Genes Genome Homo sapiens Hybrids Internal Ribosome Entry Sites Introns Lentivirus MECP2 protein, human Mice, Laboratory mitogen-activated protein kinase 3, human Mutation NO-BP Plasmids T-Cell Leukemia Viruses, Human Tissue Donors TUBB3 protein, human Vertebral Column

Novel Gene Expression Cassette Design

Cited 17 times

The newly constructed expression cassettes are shown in Fig. 1a. The promoters, RU5′, BGH (bovine growth hormone) polyadenylation (polyA) signal, and a sequence for multiple cloning sites, were synthesized by IDT Inc. (Coralville, IA) and inserted into pDNR-1r promoter-less vector (Clontech, Mountain View, CA) or pIDT-SMART promoter-less vector (IDT Inc.). The RU5′ sequence (269 bp: Accession No. J02029 (374–642)) is derived from the R segment and a part of the U5 sequence of HTLV Type 1 long terminal repeat and used to enhance transcription efficiency [9 (link)]. Sequences of the promoter elements were as follows: hTERT (189 bp: Accession No. DQ264729 (1618–1806)), SV40 (319 bp: Accession No. AY864928 (2156–2474)), and CMV (479 bp: Accession No. AJ318513 (159–637)). The CAG promoter was obtained from the pCAGGS vector (a kind gift from Dr. Jun-ichi Miyazaki; Osaka University, Japan). pTracer-EF/V5-His-A and pEF6/Myc-His-A were purchased from Invitrogen. Full-length cDNAs of human S100A11, REIC/Dkk-3, CD133, LGR5 (leucine-rich repeat-containing G protein-coupled receptor 5), telomerase, erythropoietin (EPO), and green fluorescence protein (GFP) were amplified by RT-PCR.Fig. 1

Schematic diagram of modified gene expression systems and their capabilities for gene expressions. a A series of indicated plasmids were constructed on the basis of the promoter-less pDNR-1r vector. b Expression of KLF16 protein was assessed by Western blot analysis after transfecting the indicated plasmids carrying KLF16 cDNA in HEK293, MCF7, PC-3, HeLa, and HepG2 cells. c Plasmid vectors carrying various cDNAs were constructed using the same series of vectors as those shown in (A). The vectors were transfected to HEK293 cells, and the level of each protein was determined by Western blot analysis. Lane numbers in b and c correspond to the vector numbers shown in (a)

Sakaguchi M., Watanabe M., Kinoshita R., Kaku H., Ueki H., Futami J., Murata H., Inoue Y., Li S.A., Huang P., Putranto E.W., Ruma I.M., Nasu Y., Kumon H, & Huh N.H. (2014). Dramatic Increase in Expression of a Transgene by Insertion of Promoters Downstream of the Cargo Gene. Molecular Biotechnology, 56(7), 621-630.

Publication 2014

CCXCR1 receptor, human Cloning Vectors DKK3 protein, human DNA, Complementary Erythropoietin Gene Expression Genitalia Green Fluorescent Proteins growth hormone, bovine HEK293 Cells HeLa Cells Hep G2 Cells Homo sapiens Leucine Long Terminal Repeat MCF-7 Cells Plasmids Polyadenylation protein B Proteins Reverse Transcriptase Polymerase Chain Reaction Simian virus 40 T-Cell Leukemia Viruses, Human Telomerase Transcription, Genetic Western Blot

Linker-mediated PCR and Illumina sequencing

Cited 8 times

An overview of the linker-mediated PCR, Illumina sequencing, and the bioinformatics pipeline is given in the Results. A complete step-by-step protocol describing the amplification and sequencing protocols is described here. Our experimental approach to identifying and quantifying HIV integration sites is based on linker-mediated amplification of sheared DNA from HTLV and HIV-infected cells [11 (link), 12 (link)], modified to minimize artifacts due to mispriming, PCR recombination, cross-contamination, etc. General considerations are discussed in the main text.

Wells D.W., Guo S., Shao W., Bale M.J., Coffin J.M., Hughes S.H, & Wu X. (2020). An analytical pipeline for identifying and mapping the integration sites of HIV and other retroviruses. BMC Genomics, 21, 216.

Publication 2020

Cells Recombination, Genetic T-Cell Leukemia Viruses, Human

Most recents protocols related to «T-Cell Leukemia Viruses, Human»

Quantitative HIV-1 RT Assay in Cell Cultures

Endogenous
RT activity of supernatants of HIV-1-infected MT-2 cells treated/untreated
with FS-1 drug has been tested using the HS-Lenti Kit-RT assay (Cavidi,
Sweden). The Kit-RT allows quantitative reverse transcriptase (RT,
pg/mL) detection because it has got a standard recombinant RT (rRT).
The source of the virus-containing material is the cell culture
fluid of the H9/HTLV-IIIB line at 48–72 h after dispersal.
The method is non-radioactive and colorimetrically detects a reverse
transcription product at 405 nm (A405).

Yuldasheva G.A., Argirova R, & Ilin A.I. (2023). Molecular Modeling of the Anti-HIV Activity Mechanism of Iodine-Containing Drugs Armenicum and FS-1. ACS Omega, 8(9), 8617-8624.

Publication 2023

Biological Assay HIV-2 pharmaceutical FS-1 Radioactivity RNA-Directed DNA Polymerase T-Cell Leukemia Viruses, Human Virus

Colocalization of HTLV-1 gp46 and LAMP-2

Cells were treated with pepstatin A (15 μg/mL) and leupeptin (25 μg/mL) for 4h and then washed and suspended in unsupplemented RPMI and seeded at 7.2x10⁵ cells/chamber in 8 well μ-Slides (ibidi) coated with poly-L-lysine. Protease inhibitors were used to limit Env degradation in lysosomes, thereby enhancing Env detection in these organelles. Cells were incubated at 37°C for 15m and then fixed with cold PBS (137 mM NaCl, 2.7 mM KCl, 3 mM Na₂HPO₄, and 1.5 mM KH₂PO₄)/4% paraformaldehyde on ice for 30m. Cells were washed with PBS and permeabilized and blocked with PBS/0.1% saponin/5% goat serum for 1h at room temperature. Cells were then probed with 1:50 antibody dilutions of Alexa Fluor 594-conjugated anti-LAMP-2 (H4B4, Santa Cruz Biotechnology, sc-18822 AF594) and Alexa Fluor 488-conjugated HTLV-1 gp46 (1C1, Santa Cruz Biotechnology, sc-53890 AF488) in PBS/0.1% saponin/1% BSA overnight at 4°C. Cells were then washed with PBS and overlayed with ibidi Mounting Medium. Fluorescence images were acquired by confocal microscopy using an LSM 700 microscope (Zeiss), and images were analyzed using Fiji (ImageJ, version 1.53t). Specifically, masks were used to define cells as regions of interest (ROIs) and to show cell boarders. Masks were established from threshold-adjusted Z-projections of max intensities summed from both channels. Colocalization was analyzed with the JaCoP plugin [102 (link)]. Prior to colocalization analysis, ROIs were subjected to background subtraction and deconvolution. Colocalization was performed on a single slice from each ROI that contained a high proportion of pixels displaying above-background fluorescence for each channel with priority placed on the gp46 channel.

Polakowski N., Sarker M.A., Hoang K., Boateng G., Rushing A.W., Kendle W., Pique C., Green P.L., Panfil A.R, & Lemasson I. (2023). HBZ upregulates myoferlin expression to facilitate HTLV-1 infection. PLOS Pathogens, 19(2), e1011202.

Publication 2023

Alexa594 alexa fluor 488 Antibodies, Anti-Idiotypic Cells Cold Temperature Fluorescence Goat Human T-lymphotropic virus 1 LAMP2 protein, human leupeptin Lysine Lysosomes Microscopy Microscopy, Confocal Organelles paraform pepstatin Poly A Protease Inhibitors Saponin Serum Sodium Chloride T-Cell Leukemia Viruses, Human Technique, Dilution Z-Max

Modeling Maternal HTLV-1 Transmission and Disease Progression

Clinical probabilities were collected using MEDLINE from 2000 to December 2022 (Table 1). To obtain maternal HTLV-1 seropositivity, I assumed the maternal age to be 30 years, which is the average age of first-time pregnant women in Japan [9 (link)]. I obtained the maternal HTLV-1 seropositivity rate, HTLV-1 mother-to-child transmission rates with long-term breastfeeding, short-term breastfeeding, and bottle feeding, the incidence of ATL and HAM/TSP in HTLV-1 carriers, the proportion of ATL subtypes in ATL patients, transformation rate from HAM/TSP to ATL, transformation rate from favorable chronic-type and smoldering-type ATL to acute-type ATL, the 4-year survival rates for acute-type and unfavorable chronic-type ATL patients, and the mortality of favorable chronic-type and smoldering-type ATL and HAM/TSP from the literature and Japanese cancer statistics [1 (link),3 (link),4 (link),7 (link),8 (link),23 (link),24 ,26 (link),27 (link),28 ,29 (link)]. The mortality from other causes was calculated by the adjusted risk of death due to any cause in people with HTLV-1 infection when compared with HTLV-1-negative counterparts [30 (link)] and the values obtained from vital statistics [31 ].

, & Kowada A. (2023). Cost-effectiveness of human T-cell leukemia virus type 1 (HTLV-1) antenatal screening for prevention of mother-to-child transmission. PLOS Neglected Tropical Diseases, 17(2), e0011129.

Publication 2023

HTLV-I Infections Human T-lymphotropic virus 1 Japanese Malignant Neoplasms Maternal-Fetal Infection Transmission Patients Pregnant Women T-Cell Leukemia Viruses, Human Thrombospondin 1

Cost-Effectiveness of HTLV-1 Screening Strategies

To determine which strategy would be more cost-effective if one variable was tested over the widest possible range, holding all other variables constant, one-way sensitivity analyses were conducted on variables such as the maternal HTLV-1 seropositivity rate, the incidence of ATL and HAM/TSP among HTLV-1 carriers, the mortality of ATL and HAM/TSP, the cost of HTLV-1 antibody test, treatment cost of ATL and HAM/TSP, and health utilities (Table 1). A two-way sensitivity analysis was conducted on the maternal HTLV-1 seropositivity rate and the proportion of long-term breastfeeding. To assess the impact of model uncertainty on the base case estimates, the probabilistic sensitivity analysis using a second-order Monte-Carlo simulation over 1000 trials was also performed. The uncertainty had a beta distribution for probability and accuracy, and a gamma distribution for cost.

Publication 2023

Gamma Rays HTLV-I Antibodies Human T-lymphotropic virus 1 Hypersensitivity T-Cell Leukemia Viruses, Human Thrombospondin 1

Long-term Observation of Untreated HBV

HBV-seropositive patients who received clinical observation at Kyoto University Hospital and Osaka Red Cross Hospital between April 2001 and March 2020 were enrolled in this study. The inclusion criteria were: consistently seropositive for HBsAg serum HBV-DNA titer higher than 4.23 LogIU/mL (10⁵ copies/mL) for at least 2 time-points; free from antiviral medications or interferon treatment. The exclusion criteria were: under 20 years old; coinfection with HCV, HIV, or human T-lymphotropic virus; uncontrolled malignancies; liver comorbidities such as alcohol-associated liver disease, nonalcoholic steatohepatitis, autoimmune hepatitis, primary biliary cholangitis, primary sclerosing cholangitis, immunoglobulin G4-related sclerosing cholangitis, or Wilson disease. Two to 5 serum samples were sequentially collected during the observation period. All samples were surpluses of sera drawn for clinical purposes. The collected samples were stored at −80°C.
This study conformed to the provisions of the Declaration of Helsinki. The study protocol (R2594) was approved by the ethics committee of Kyoto University and the clinical samples were obtained with written informed consent or based on an opt-out method of consent from all participants.

Arasawa S., Takeda H., Takai A., Iguchi E., Eso Y., Shimizu T., Takahashi K., Yamashita T., Ueda Y., Marusawa H, & Seno H. (2023). Evolutional transition of HBV genome during the persistent infection determined by single-molecule real-time sequencing. Hepatology Communications, 7(3), e0047.

Publication 2023

Alcoholic Liver Diseases Antiviral Agents Autoimmune Chronic Hepatitis Coinfection Ethics Committees Hepatitis B Surface Antigens Hepatolenticular Degeneration IgG4 Interferons Malignant Neoplasms ML 23 Nonalcoholic Steatohepatitis Patients Primary Biliary Cholangitis Primary Sclerosing Cholangitis Serum Specimen Collection T-Cell Leukemia Viruses, Human

Top products related to «T-Cell Leukemia Viruses, Human»

Rpmi 1640 medium by Thermo Fisher Scientific

Sourced in United States, China, Germany, United Kingdom, Japan, France, Canada, Australia, Italy, Switzerland, Belgium, New Zealand, Spain, Israel, Sweden, Denmark, Macao, Brazil, Ireland, India, Austria, Netherlands, Holy See (Vatican City State), Poland, Norway, Cameroon, Hong Kong, Morocco, Singapore, Thailand, Argentina, Taiwan, Province of China, Palestine, State of, Finland, Colombia, United Arab Emirates

RPMI 1640 medium is a commonly used cell culture medium developed at Roswell Park Memorial Institute. It is a balanced salt solution that provides essential nutrients, vitamins, and amino acids to support the growth and maintenance of a variety of cell types in vitro.

Filtermax f5 multi mode microplate reader by Molecular Devices

Sourced in United States, Japan

The FilterMax F5 Multi-Mode Microplate Reader is a compact and versatile lab equipment designed for absorbance and fluorescence measurements. It features a high-performance optical system and supports 6- to 384-well microplates. The instrument can perform a range of detection modes, including endpoint, kinetic, and spectral scanning.

Qiaamp dna mini kit by Qiagen

Sourced in Germany, United States, France, United Kingdom, Netherlands, Spain, Japan, China, Italy, Canada, Switzerland, Australia, Sweden, India, Belgium, Brazil, Denmark

The QIAamp DNA Mini Kit is a laboratory equipment product designed for the purification of genomic DNA from a variety of sample types. It utilizes a silica-membrane-based technology to efficiently capture and purify DNA, which can then be used for various downstream applications.

Fetal bovine serum (fbs) by Thermo Fisher Scientific

Sourced in United States, China, United Kingdom, Germany, Australia, Japan, Canada, Italy, France, Switzerland, New Zealand, Brazil, Belgium, India, Spain, Israel, Austria, Poland, Ireland, Sweden, Macao, Netherlands, Denmark, Cameroon, Singapore, Portugal, Argentina, Holy See (Vatican City State), Morocco, Uruguay, Mexico, Thailand, Sao Tome and Principe, Hungary, Panama, Hong Kong, Norway, United Arab Emirates, Czechia, Russian Federation, Chile, Moldova, Republic of, Gabon, Palestine, State of, Saudi Arabia, Senegal

Fetal Bovine Serum (FBS) is a cell culture supplement derived from the blood of bovine fetuses. FBS provides a source of proteins, growth factors, and other components that support the growth and maintenance of various cell types in in vitro cell culture applications.

Rpmi 1640 medium by Merck Group

Sourced in United States, Germany, United Kingdom, Japan, Italy, China, France, Sao Tome and Principe, Switzerland, Austria, Australia, Spain, Macao, Belgium, Canada, Hungary, Brazil, Sweden, Ireland, India, Poland, Israel, Mexico, Denmark, Hong Kong, Czechia, Argentina, Portugal, Holy See (Vatican City State)

RPMI-1640 is a widely used cell culture medium formulation, developed at Roswell Park Memorial Institute. It is a complete and balanced medium designed to support the growth and maintenance of a variety of cell types, including human and animal cell lines. The medium contains essential nutrients, vitamins, amino acids, and other components necessary for cell proliferation and survival in in vitro cell culture applications.

Penicillin streptomycin by Thermo Fisher Scientific

Sourced in United States, Germany, United Kingdom, China, Canada, France, Japan, Australia, Switzerland, Israel, Italy, Belgium, Austria, Spain, Gabon, Ireland, New Zealand, Sweden, Netherlands, Denmark, Brazil, Macao, India, Singapore, Poland, Argentina, Cameroon, Uruguay, Morocco, Panama, Colombia, Holy See (Vatican City State), Hungary, Norway, Portugal, Mexico, Thailand, Palestine, State of, Finland, Moldova, Republic of, Jamaica, Czechia

Penicillin/streptomycin is a commonly used antibiotic solution for cell culture applications. It contains a combination of penicillin and streptomycin, which are broad-spectrum antibiotics that inhibit the growth of both Gram-positive and Gram-negative bacteria.

Penicillin by Thermo Fisher Scientific

Sourced in United States, United Kingdom, Germany, China, France, Canada, Japan, Australia, Switzerland, Italy, Israel, Belgium, Austria, Spain, Brazil, Netherlands, Gabon, Denmark, Poland, Ireland, New Zealand, Sweden, Argentina, India, Macao, Uruguay, Portugal, Holy See (Vatican City State), Czechia, Singapore, Panama, Thailand, Moldova, Republic of, Finland, Morocco

Penicillin is a type of antibiotic used in laboratory settings. It is a broad-spectrum antimicrobial agent effective against a variety of bacteria. Penicillin functions by disrupting the bacterial cell wall, leading to cell death.

Rpmi 1640 by Thermo Fisher Scientific

Sourced in United States, China, United Kingdom, Germany, France, Canada, Japan, Australia, Italy, Switzerland, Belgium, New Zealand, Austria, Netherlands, Israel, Sweden, Denmark, India, Ireland, Spain, Brazil, Norway, Argentina, Macao, Poland, Holy See (Vatican City State), Mexico, Hong Kong, Portugal, Cameroon

RPMI 1640 is a common cell culture medium used for the in vitro cultivation of a variety of cells, including human and animal cells. It provides a balanced salt solution and a source of essential nutrients and growth factors to support cell growth and proliferation.

Luciferase assay system by Promega

Sourced in United States, Germany, United Kingdom, Australia, Switzerland, Japan, China, France, Sweden, Italy, Spain, Austria, Finland

The Luciferase Assay System is a laboratory tool designed to measure the activity of the luciferase enzyme. Luciferase is an enzyme that catalyzes a bioluminescent reaction, producing light. The Luciferase Assay System provides the necessary reagents to quantify the level of luciferase activity in samples, enabling researchers to study biological processes and gene expression.

Retrotek htlv p19 antigen elisa by ZeptoMetrix

Sourced in United States

The RETROtek HTLV p19 Antigen ELISA is a laboratory equipment product used for the detection of the p19 antigen, a component of the human T-cell leukemia virus (HTLV). This enzyme-linked immunosorbent assay (ELISA) kit is designed to provide quantitative measurement of the p19 antigen in biological samples.

What are the different types of T-Cell Leukemia Viruses that infect humans?

The two main types of T-Cell Leukemia Viruses that infect humans are HTLV-1 (Human T-Cell Leukemia Virus type 1) and HTLV-2 (Human T-Cell Leukemia Virus type 2). These retroviruses primarily target and transform T lymphocytes, leading to various forms of T-cell leukemia and lymphoma. Understanding the unique characteristics and differences between these virus types is crucial for accurately diagnosing and developing effective treatments for the resulting hematological malignancies.

How can PubCompare.ai help with T-Cell Leukemia Virus research?

PubCompare.ai's AI-powered platform can revolutionize T-Cell Leukemia Virus research in several ways: 1. Screen protocol literature more efficiently: The platform allows researchers to quickly identify and compare the most relevant protocols from the literature, preprints, and patents related to T-Cell Leukemia Viruses. 2. Leverage AI to pinpoint Critical Insights: PubCompare.ai's intelligent analysis can highlight key differences in protocol effectiveness, enabling researchers to choose the best options for reproducibility and accuracy in their work. 3. Accelerate scientific breakthroughs: By streamlining the identification of optimal protocols, PubCompare.ai helps researchers spend more time on innovating and less time on tedious manual literature reviews, ultimately driving faster progress in understanding and treating T-Cell Leukemia Virus-related cancers.

What are some common challenges in working with T-Cell Leukemia Viruses?

Some of the key challenges in working with T-Cell Leukemia Viruses include: 1. Complexity of the viruses: T-Cell Leukemia Viruses are complex retroviruses that can have diverse effects on the host T lymphocytes, leading to a range of leukemic and lymphomatous conditions. 2. Genetic variability: The viruses can exhibit genetic variability, which can complicate the development of universal diagnostic tests and treatments. 3. Latency and chronic infection: T-Cell Leukemia Viruses can establish lifelong, chronic infections in the host, making it difficult to eradicate the viruses once established. 4. Limited treatment options: Current treatment options for T-Cell Leukemia Virus-related cancers are often limited and have varying degrees of effectiveness, highlighting the need for more research and innovation in this field.

How do T-Cell Leukemia Viruses contribute to the development of hematological malignancies?

T-Cell Leukemia Viruses, such as HTLV-1 and HTLV-2, play a crucial role in the development of certain hematological malignancies. These viruses primarily infect and transform T lymphocytes, leading to the proliferation and transformation of these cells. This can result in the development of various forms of T-cell leukemia and lymphoma, including Adult T-Cell Leukemia/Lymphoma (ATLL) and other aggressive cancers. Understanding the pathogenesis of these viruses is essential for developing effective treatments and improving outcomes for patients affected by T-Cell Leukemia Virus-related hematological malignancies.

More about "T-Cell Leukemia Viruses, Human"

T-Cell Leukemia Viruses, also known as Human T-Cell Leukemia Viruses (HTLVs), are a group of retroviruses that primarily infect and transform T lymphocytes, leading to various forms of T-cell leukemia and lymphoma.
These viruses, including HTLV-1 and HTLV-2, play a crucial role in the development of certain hematological malignancies.
Research on T-Cell Leukemia Viruses is essential for understanding the pathogenesis, epidemiology, and potential treatments for these complex and often aggressive cancers.
Techniques such as RPMI 1640 medium, FBS, Penicillin/streptomycin, and the Luciferase Assay System are commonly used in this field of study.
The PubCompare.ai platform can help accelerate this critical research by streamlining the identification of optimal protocols from the literature, preprints, and patents, enhancing reproducibility and driving scientific breakthroughs.
The platform utilizes advanced AI-powered comparisons to locate the most relevant and effective protocols, aiding researchers in their quest to unravel the mysteries of T-Cell Leukemia Viruses and develop more effective treatments.
Addtionally, tools such as the FilterMax F5 Multi-Mode Microplate Reader and the QIAamp DNA Mini Kit can be leveraged to support research efforts, providing researchers with the necessary tools and techniques to study these complex viruses and their impact on human health.
By harnessing the power of these technologies and the insights gained from the literature, the scientific community can make significant strides in understanding and combating T-Cell Leukemia Viruses.