Tobacco etch virus

The American Type Culture Collection (ATCC) provided the genomic DNA used to clone Acel_2062 (ATCC Number: ATCC 43068). Protein production and crystallization of the Acel_2062 protein was carried out by standard JCSG protocols
[8 (link)]. Clones were generated using the Polymerase Incomplete Primer Extension (PIPE) cloning method
[9 (link)]. The gene encoding Acel_2062 (GenBank: YP_873820[GenBank:YP_873820]; UniProtKB: A0LWM4[UniProtKB:A0LWM4]) was synthesized with codons optimized for Escherichia coli expression (Codon Devices, Cambridge, MA) and cloned into plasmid pSpeedET, which encodes an expression and purification tag followed by a tobacco etch virus (TEV) protease cleavage site (MGSDKIHHHHHHENLYFQ/G) at the amino terminus of the full-length protein. Escherichia coli GeneHogs (Invitrogen) competent cells were transformed and dispensed on selective LB-agar plates. The cloning junctions were confirmed by DNA sequencing. Expression was performed in a selenomethionine-containing medium at 37°C. Selenomethionine was incorporated via inhibition of methionine biosynthesis
[10 (link)], which does not require a methionine auxotrophic strain. At the end of fermentation, lysozyme was added to the culture to a final concentration of 250 μg/ml, and the cells were harvested and frozen. After one freeze/thaw cycle the cells were homogenized in lysis buffer [50 mM HEPES, 50 mM NaCl, 10 mM imidazole, 1 mM Tris(2-carboxyethyl)phosphine-HCl (TCEP), pH 8.0] and passed through a Microfluidizer (Microfluidics). The lysate was clarified by centrifugation at 32,500 x g for 30 minutes and loaded onto a nickel-chelating resin (GE Healthcare) pre-equilibrated with lysis buffer, the resin was washed with wash buffer [50 mM HEPES, 300 mM NaCl, 40 mM imidazole, 10% (v/v) glycerol, 1 mM TCEP, pH 8.0], and the protein was eluted with elution buffer [20 mM HEPES, 300 mM imidazole, 10% (v/v) glycerol, 1 mM TCEP, pH 8.0]. The eluate was buffer exchanged with TEV buffer [20 mM HEPES, 200 mM NaCl, 40 mM imidazole, 1 mM TCEP, pH 8.0] using a PD-10 column (GE Healthcare), and incubated with 1 mg of TEV protease per 15 mg of eluted protein for 2 hours at 20°–25°C followed by overnight at 4°C. The protease-treated eluate was passed over nickel-chelating resin (GE Healthcare) pre-equilibrated with HEPES crystallization buffer [20 mM HEPES, 200 mM NaCl, 40 mM imidazole, 1 mM TCEP, pH 8.0] and the resin was washed with the same buffer. The flow-through and wash fractions were combined and concentrated to 15.6 mg/ml by centrifugal ultrafiltration (Millipore) for crystallization trials.

mRNAs were transcribed from linearized plasmids encoding firefly Luc, codon-optimized mEPO, EGFP, or hiNOS using T7 RNA polymerase (MEGAscript T7 Transcription Kit, Thermo Fisher Scientific, Darmstadt, Germany). The mRNAs were transcribed to contain the 5′ UTR derived from the tobacco etch virus 5′ leader RNA (TEV).³⁴ (link) Further, a 100-nt-long poly(A) tail interrupted by a short linker (A30LA70) was transcribed from the corresponding DNA templates. For the generation of nucleoside-modified mRNAs, uridine 5’-triphosphate (UTP) was replaced with the triphosphate derivative of m1Ψ (m1ΨTP) in the transcription reaction. Capping of the IVT mRNAs was performed co-transcriptionally using the trinucleotide cap1 analog CleanCap (TriLink, San Diego, CA, USA). After DNase digestion, the synthesized mRNA was isolated from the reaction mix by precipitation with half volume of 8 M LiCl solution (Sigma-Aldrich, Hamburg, Germany), and finally the pellet was dissolved in nuclease-free water. The RNA concentration was determined using a Nanodrop 2000c spectrophotometer (Thermo Fisher Scientific). Aliquots of denatured IVT mRNAs were analyzed by electrophoresis in non-denaturing 1.4% agarose gels containing 0.005% (v/v) GelRed nucleic acid gel stain.³⁵ (link) RiboRuler High Range RNA Ladder (Thermo Fisher Scientific) was loaded as a molecular weight marker.

The duplicated CaMV 35S promoter, the Tobacco etch virus (TEV) 5' non-translated leader sequence, a short polylinker containing an XbaI site, and the polyA/terminator sequences from pRTL2 [30 (link)] were cloned as a PstI fragment into PstI cut binary vector pCB301 [16 (link)] to generate pJL3. Using inverse PCR a PacI restriction endonuclease site was generated immediately downstream of the TEV leader sequence. The gfp or p19 genes were cloned into the PacI and XbaI sites of the vector to generate pCB35SGFP and pJL3:P19, respectively. The "cycle 3" mutant version of gfp [31 (link)] in p30BGFP [11 (link)] was used as the source of the gfp gene. The coding sequence for the p19 gene from TBSV was amplified from a cDNA sample (a kind gift from H. Scholthof).
The NotI restriction endonuclease site in the pCB301 backbone of pCB35S:GFP was destroyed by digesting with NotI, treatment with T4 DNA polymerase and dNTPs followed by religation to generate pCB 35SGFP ΔN. Inverse PCR of pCB 35SGFP ΔN was used to generate a unique StuI restriction site at the 35S promoter transcription start site as described in Dessens and Lomonossoff [32 (link)]. The resulting plasmid was named pJL 22.
The TMV expression vector in p30B [11 (link)] contains a T7 driven cDNA of the U1 strain of TMV, an additional viral subgenomic promoter for expression of foreign gene inserts, and a ribozyme sequence following the end of the viral cDNA (Figure 1). Using standard cloning procedures the cDNA version of the TMV expression vector and ribozyme sequence from p30B (obtained from Large Scale Biology Corporation, Vacaville, CA) was cloned into StuI-XbaI cut pJL 22. This plasmid was then modified to generate pJL36 and pJL43. In pJL36 the multiple cloning site (seq ttaattaacggcctagggcggccgc) was inserted downstream of the additional TMV subgenomic promoter. pJL36, (Figure 1) has unique PacI, AvrII and NotI restriction endonuclease sites for cloning.
To construct pJL43 (Figure 1) the ds DNA cassette [top stand seq (CGAGGCCAGAAGAGCAACCTTTACGTACTTGCTCTTCAGCTTGAAGGTAAGCCTATCCCTAACCCTCTCCTCGGTCTCGATTCTACGCGTACCGGTCATCATCACCATCACCATTGAC)] containing the coding sequence for two SapI restriction endonuclease sites (gctcttc), the V5 epitope (amino acid sequence GKPIPNPLLGLD) and a hexa-histidine (His6) tag coding sequence was inserted downstream of the additional TMV subgenomic promoter.

The panel of 14 recombinant T-antigens used to characterize antibody reactivity has been previously described [18 (link), 29 (link)]. All T-antigens were expressed in Escherichia coli BL21 (DE3) cells, and N-terminal His₆-tags were removed using recombinant tobacco etch virus (rTEV) prior to use in immunoassays.
The recombinant T18.1 dimer was constructed by inserting the coding sequence for tee18.1 into pProExHTA in tandem such that the vector encoded expression of two T18.1 antigens in which the C-terminal sortase motif of the first monomer is linked to the N-terminus of the following monomer, via a flexible (glycine)₃ linker. The first five N-terminal residues from the second T18.1 monomer (ETAGV) were removed to allow the positioning of the sortase motif of the first monomer near the sortase motif peptide “binding” cleft in the second monomer. Expression and purification of the T18.1 dimer followed published protocols for T-antigen monomers [18 (link)]. Briefly, E. coli BL21 (DE3) cells transformed with the expression plasmid were induced with 0.3 mM isopropyl-β-D-1-thiogalactopyranoside (IPTG) and grown at 18°C for 16 h. Cell pellets were resuspended in lysis buffer (50 mM Tris-Cl [pH 8.0], 300 mM NaCl, 10 mM imidazole), lysed using a cell disruptor (Constant Cell Disruption Systems) and the protein enriched from the soluble phase using Ni²⁺-NTA affinity purification. The His₆ affinity tag was cleaved with recombinant tobacco etch virus (rTEV) protease and rTEV-His₆ protease, and uncleaved protein was removed by subtractive immobilized-metal affinity chromatography (IMAC). The unbound protein fraction containing recombinant T-antigen was further purified by size exclusion chromatography on a Superdex S200 10/300 column (GE Healthcare) in crystallization buffer (10 mM Tris-Cl [pH 8.0], 100 mM NaCl).
For generation of biotinylated recombinant T18.1, the tee18.1 sequence [18 (link)] was re-cloned into a pProExHTA vector modified to encode for an N-terminal His-tag and a C-terminal Avi-tag. E. coli BL21 (DE3) were co-transformed with pProExHTA-tee18.1-Avitag and pACYC184BirA, and expression media were supplemented with 20 uM D-Biotin for in cell biotinylation. The biotinylated T18.1 was purified using Ni²⁺-NTA affinity chromatography, the His₆-tag removed using rTEV, and final purification was performed using size exclusion chromatography as described above [18 (link)]. Successful biotin labelling was confirmed by immunoaffinity pulldown with streptavidin-coupled M-280 Dynabeads (Thermofisher) following by SDS-PAGE.
The T18.1 peptide library was designed to cover the entirety of the mature T18.1 monomer. The N-terminal signal sequence was excluded, and the library ended at the conserved threonine residue of the Sortase C recognition site (QVPTG). The tiled peptide library comprised 2915-mer peptides overlapping by five residues (Supplementary Table S1). The peptides were synthesized (GenScript) and purified to >85%.

Mouse EFhd1 ΔNTD (residues 69−240) and the human EFhd2 core domain (residues 70−184) were amplified from full-length mouse EFhd1 (residues 1−240) and human EFhd2 (residues 1−240), respectively, using polymerase chain reaction (PCR). The amplified EFhd1 ΔNTD was cloned into a modified pET28a vector (Novagen) containing an N-terminal His₆ tag and a tobacco etch virus (TEV) protease cleavage site (Glu–Asn–Leu–Tyr–Phe–Gln/Gly). The amplified EFhd2 core domain was cloned into a modified pET41a vector containing gluta­thione S-transferase (GST) with a TEV protease cleavage site. Full-length EFhd1 was cloned into a modified pET28a vector (Novagen) with an N-terminal His₆-TEV tag. Full-length EFhd2 was cloned into a modified pET28a vector carrying an N-terminal His₆ tag.