Secretion refers to the process by which cells release various substances, such as hormones, enzymes, or other molecules, from within the cell to the extracellular environment.
This biological mechanism is essential for a wide range of physiological functions, including digestion, immune response, and signaling between cells.
Secretion involves the packaging of the desired substances into membrane-bound vesicles, which then fuse with the cell membrane to release their contents.
Defects or dysregulation in secretion pathways can contribute to various disease states, making it an important area of study in biomedical research.
PubCompare.ai's AI-driven platform can help optimize your secretion research protocols, allowing you to easily locate the best methods from literature, preprints, and patents, and identify the most effective approaches to advance your studies.
Streamline your secretion research with PubCompare.ai's one-stop solution for protocol optimization.
To account for proteins targeted to some of the common bacterial hyperstructures and host-destined SCLs, new subcategory localizations have been introduced in PSORTb 3.0, as listed in Table 1. This represents, to our knowledge, the first implementation of subcategories for primary SCL localizations, for an SCL predictor. These subcategory localizations for a protein were identified using the SCL-BLAST module, which infers localization by homology using criteria that are of measured high precision (Nair and Rost, 2002 (link)). Proteins detected to have a secondary localization are also predicted as one of the four main categories for Gram-positive bacteria or one of five main compartments for Gram-negative bacteria (or similarly for those bacteria with atypical cell structures). Any protein exported past the outer-most layer of the bacterial cell is considered as extracellular, whereas proteins localized to one of the membranes that are part of a hyperstructure (such as the flagellum) are identified both as an inner or outer membrane protein as well as a protein of that hyperstructure. The basal components of the flagellum are not annotated as such, since they are often homologous to proteins that are not part of the flagellar apparatus (for example, a general ATPase).
New subcategory SCLs predicted by PSORTb 3.0
SCL subcategories
Description
Host-associated
Any proteins destined to the host cell cytoplasm, cell membrane or nucleus by any of the bacterial secretion systems
Type III secretion
Components of the Type III secretion apparatus
Fimbrial
Components of a bacterial or archaeal fimbrium or pilus
Flagellar
Components of a bacterial or archaeal flagellum
Spore
Components of a spore
Yu N.Y., Wagner J.R., Laird M.R., Melli G., Rey S., Lo R., Dao P., Sahinalp S.C., Ester M., Foster L.J, & Brinkman F.S. (2010). PSORTb 3.0: improved protein subcellular localization prediction with refined localization subcategories and predictive capabilities for all prokaryotes. Bioinformatics, 26(13), 1608-1615.
Ideally, our positive data set should consist of a large number of proteins secreted via non-classical pathways. Unfortunately, it was not possible to obtain a sufficiently large data set as only a small number of proteins undergoing non-classical secretion are known. Since we are looking for features shared among extracellular proteins, the mechanism by which a protein is secreted should not be important. We therefore used for training the large number of proteins known to be secreted via the classical Sec-dependent secretion mediated mechanism. All sequence data was extracted from Swiss-Prot release 44.0. Two individual training sets were created for Firmicutes and Proteobacteria, respectively. A set of 690 extracellular proteins from Firmicutes (Gram-positive) and a set of 2185 extracellular proteins from Proteobacteria (Gram-negative) were extracted from the Swiss-Prot database based on annotations in the feature table (FT) and comments line (CC) [52 (link)]. Partial sequences were excluded from the data set. As we wanted to train a predictor that works in the absence of signal peptides, the signal peptide part of each sequence was removed according to the Swiss-Prot annotation. These lists of secreted proteins formed our positive data sets. Negative training sets were constructed by extracting 1084 proteins for Firmicutes and 2098 proteins for Proteobacteria from Swiss-Prot, which were annotated as localised to the cytoplasm. After redundancy reduction of the data sets based on a structural similarity criteria [53 (link)], 152 and 350 extracellular sequences were left in the positive data sets for Firmicutes and Proteobacteria, respectively. In the negative data sets, 140 and 334 sequences remained for Firmicutes and Proteobacteria, respectively. For Gram-positive bacteria (Firmicutes and Actinobacteria) a set of non-classically secreted proteins was retrieved from Swiss-Prot based on literature searches (see Table 1). All data sets used are available as supplementary information from our website [37 ]. For identification of putative non-classically secreted proteins in E. coli and B. subtilis, we used the following accession numbers to extract the annotated and translated proteomes: [Genbank:NC_000913] for E. coli and [Genbank:NC_000964] for B. subtilis.
Bendtsen J.D., Kiemer L., Fausbøll A, & Brunak S. (2005). Non-classical protein secretion in bacteria. BMC Microbiology, 5, 58.
Actinomycetes Cytoplasm Escherichia coli Firmicutes Gram-Positive Bacteria Proteins Proteobacteria Proteome secretion SET protein, human Signal Peptides Staphylococcal Protein A
Mouse IL-1α and IL-1β cDNAs (32 (link), 33 (link)) were kindly given by Dr. Tetsuo Sudo (Toray Industry, Kanagawa, Japan), mouse cyclooxygenase (COX) 1 and -2 cDNAs (34 (link)) were from Dr. Shozo Yamamoto (Tokushima University School of Medicine, Tokushima, Japan), mouse IL-6 and TNF-α cDNAs (35 (link), 36 (link)) were from Dr. Takashi Yokota (Institute of Medical Science, University of Tokyo, Tokyo, Japan), and mouse β-actin cDNA (37 (link)) was from Dr. Tetsu Akiyama (Institute for Microbial Disease, Osaka University, Osaka, Japan). Mouse IL-1ra cDNA (38 (link)) and mouse IL-1ra 523-bp genomic DNA (39 (link)) were amplified from spleen and ES cells, respectively. The PCR primers used to amplify mouse IL-1ra cDNA were 5′-CCT CGG GAT GGA AAT CTG CTG-3′ and 5′-AGG CCT CGG CAG TAC TAT TGG-3′, and to amplify mouse IL-1ra genomic DNA were 5′-GAC TCG GAG TAC CTG TCA TGC-3′ and 5′-GCT CTG GAC ATA TGG CAT GTG-3′. PCR cycles were 94°C for 1 min, 60°C for 2 min, and 72°C for 3 min, over 40 cycles.
Horai R., Asano M., Sudo K., Kanuka H., Suzuki M., Nishihara M., Takahashi M, & Iwakura Y. (1998). Production of Mice Deficient in Genes for Interleukin (IL)-1α, IL-1β, IL-1α/β, and IL-1 Receptor Antagonist Shows that IL-1β Is Crucial in Turpentine-induced Fever Development and Glucocorticoid Secretion. The Journal of Experimental Medicine, 187(9), 1463-1475.
The three-promoter vector pTriEx2 (Novagen) was used as the basis for construction of the pOPIN series of expression vectors (Table 1). The In-Fusion™-ready vectors described here include fusion tags for N-His6 plus a 3C cleavage site (5 (link)), N-His6-Glutathione-S-Transferase (GST) plus a 3C cleavage site, N-His6-Maltose Binding Protein (MBP) plus a 3C cleavage site, a C-terminal Lys-His6 or a secretion leader sequence in combination with C-terminal LysHis6. All of the N-terminal fusion tags are removable with the use of 3C protease and the histidine residues of the C-terminal tags are removable by Carboxypeptidase A to leave only the C-terminal lysine (6 ).
Summary of In-Fusion™ site sequences and characteristics of the pOPIN vectors presented in this article
Vector
Fusion tag
Parent vector/ antibiotic resistance
Promoters/baculoviral recombination sites
Forward primer extension
Reverse primer extension
pOPINE
C-terminal … KHHHHHH
pTriEx2/ampicillin
T7lacO, CMV enhancer and β-actin promoter, p10 promoter/ lef-2 and 1629 baculo elements.
AGGAGATATACCATG†
GTGATGGTGATGTTT†
pOPINF*
N-terminal MAHHHHHHSSGLEVL FQGP …
pTriEx2/ampicillin
T7lacO, CMV enhancer and ββ-actin promoter, p10 promoter/ lef-2 and 1629 baculo elements.
AAGTTCTGTTTCAGGGCCCG‡
ATGGTCTAGAAAGCTTTA‡
pOPING
N-terminal MGILPSPGMPALLSLV SLLSVLLMGCVAET G … cleavable secretion leader and C-terminal … KHHHHHH
pTriEx2/ampicillin
(T7lacO-not used), CMV enhancer and β-actin promoter, p10 promoter/lef-2 and 1629 baculo elements.
GCGTAGCTGAAACCGGC
GTGATGGTGATGTTT
pOPINJ*
N-terminal MAHHHHHHSSG-GST- LEVLFQÞGP …
pTriEx2/ampicillin
T7lacO, CMV enhancer and β-actin promoter, p10 promoter/lef-2 and 1629 baculo elements.
AAGTTCTGTTTCAGGGCCCG‡
ATGGTCTAGAAAGCTTTA‡
pOPINM*
N-terminal MAHHHHHHSSG-MBP- LEVLFQGP …
pTriEx2 ampicillin
T7lacO, CMV enhancer and β-actin promoter, p10 promoter/lef-2 and 1629 baculo elements.
AAGTTCTGTTTCAGGGCCCG‡
ATGGTCTAGAAAGCTTTA‡
-represents the point of cleavage by 3C protease or signal peptidase (as appropriate). Vectors marked ‡ use the same primer extensions, enabling the same PCR product to be cloned into all marked vectors. Underlined sequences represent methionine initiation or stop codons (as appropriate) and may be excluded from the gene-specific primers.
To enable blue/white screening of recombinant clones (blue colonies indicate the presence of non-linearized/non-recombinant parental vector) the lacZ insert from intact pDNR-Dual (Clontech–Takara Bio Europe) was amplified using KOD Hi-Fi polymerase according to the manufacturer's instructions (Novagen) and the following primer pairs: Efwd: 5′-GAGATATACCATGGCACACCATCACCACCATCACAGCAGCGGTACCGTCGACCCGACTG GAAAGCG-3′ versus Erev: 5′-ACTTAGTGATGGTGATGGTGATGTTTAAACTGGTCTAGAAAGCTTGGCGCC-3′ Ffwd: 5′-GAGATATACCATGGCACACCATCACCACCATCACAGCAGCGGTCTGGAAGTTCTGTTTCA GGGTACCGTCGACCCGACTGGAAAGCG-3′ versus Frev: 5′-ACTTAGTGATGGTGATGGTGATGTTTAAACTGGTCTAGAAAGCTTGGCGCC-3′. PCR products were purified by agarose gel electrophoresis and gel extraction (Geneclean–Bio101, Morgan Irvine, CA, US). Products E and F were extended 3′ by amplification versus MscIrev primer: 5′-ccacaccagccaccaccttctga-3′ with pTriEx2 as template. The extended products E and F were purified and digested with NcoI before ligation into NcoI/MscI cut pTriEx2. Ligation products were transformed into TAM1 cells (Activ Motif, Rixensart, Belgium) and screened for β-galactosidase activity on LB Agar plates supplemented with 50 µg/ml carbenicillin/0.2% w/v X-Gal and 1 mM IPTG. Colonies expressing β-galactosidase activity were picked, grown overnight in 1.5 ml LB supplemented with the appropriate antibiotic and the resulting plasmids extracted by standard methods. pOPINE was created by ligation of the NcoI-digested extended product E into NcoI/MscI-cut pTriEx2. pOPINF* was created by ligation of the NcoI-digested extended product F into NcoI/MscI-cut pTriEx2. pOPINF was then created by the deletion of the sequence encoding the C-terminal Lys-His6 tag from pOPINF* by the ligation of a phosphorylated primer duplex into PmeI/MscI-cut pOPINF*: TriEx-CH6fwd: 5′-GTGATTAACCTCAGGTGCAGGCTGCCTATCAGAAGGTGGTGGCTGGTGTGG-3′ TriEx-CH6rev: 5′-CCACACCAGCCACCACCTTCTGATAGGCAGCCTGCACCTGAGGTTAATCAC-3′. pOPINF was derived in order to increase the efficiency of cloning of N-His6-3C pOPINF* constructs by deletion of the sequence encoding the C-terminal Lys-His6 tag as, in a small number of In-Fusion™ reactions with pOPINF* a ‘fusion’ of the sequences encoding both N- and C-terminal His6 tags was observed (data not shown). pOPING was generated by amplification of the µ-phosphatase secretion leader sequence from pHLsec (7 (link)) using sigpepfwd: 5′-CAAGCTTGCCACCATGGGGATC-3′ and sigpeprev: 5′-CGGGGTACCGGTTTCAGCTACGCAAC-3′ primers. The resulting 113 bp PCR product was gel purified, digested with NcoI and KpnI enzymes and ligated into NcoI and KpnI-cut, and purified, pOPINE (this digest removes the N-His6 site insert from pOPINE). This vector encodes the MGILPSPGMPALLSLVSLLSVLLMGCVAETG secretion leader sequence (where indicates the cleavage site for the eukaryotic signal peptidase enzyme). pOPINJ was generated by amplification of the N-His GST sequence from pDESTH6N15 (derived from the Gateway™ GST vector, pDEST15, Berrow unpublished data) using the following primers: pOPIN-GST-fwd: 5′ GAATTCCATGGCACATCACCATCACCATCACATGTCCCCT 3′ pOPIN-GST-rev: 5′ CGACGGTACCCTGAAACAGAACTTCCAGACCGCTGCTCAGATCCGATTTTGGAGGATG 3′ The resulting ∼700 bp PCR product was gel purified, digested with NcoI and KpnI, re-purified and ligated into NcoI and KpnI-cut pOPINE to produce pOPINJ. This vector encodes an N-terminal His6-GST-3C cleavable tag: MAHHHHHHSSG-GST-SSGLEVLFQGP … (where indicates the cleavage sites for 3C protease). Similarly pOPINM was generated by amplification of the MBP sequence from pMAL2c (NEB, Hitchin, Hertfordshire, UK) using the following primer pairs MBPinffwd: 5′ ACCATCACAGCAGCGGCATGAAAATCGAAGAAGGTAAACTGG 3′ and MBP SSG 3C rev: 5′ GTCGACGGTACCCTGAAACAGAACTTCCAGACCGCTGCTAGTCTGCGCGTCTTTCAGGGC 3′ The resulting ∼1200 bp PCR product was gel purified and then extended 3′ by PCR using pOPINE as template and LACZ + 3′INF REV: 5′ CTGGTCTAGAAAGCTTGGCGCCATTCGCCATTCAG 3′ as the reverse primer. The resulting ∼1500 bp PCR product was then gel purified and In-Fused into NcoI and HindIII-cut pOPINE (normal NcoI-KpnI cloning of this fragment was not thought possible due to the presence of an internal NcoI site, although recent checking of the pOPINM sequencing data reveals that the NcoI site has been previously removed c.f. the sequence available at NEB). This vector encodes an N-terminal His6-MBP-3C cleavable tag: MAHHHHHHSSG-MBP-SSGLEVLFQGP … (where indicates the cleavage sites for 3C protease). For full details of the fusion tags contributed by these vectors see Table 1, for a summary of the construction of these vectors see Figure 1.
Vector derivations and maps. Derivation of the pOPIN vectors from pTriEx2. PCR fragments were prepared as described in the Materials and methods section and either ligated into the pTriEx2 vector or inserted by In-Fusion™. In cases where the pOPIN vector is not directly derivatized from pTriEx2, the intermediate vector is also shown. Features of the pTriEx2 vector retained in the pOPIN vector suite are: T7/lacO promoter/operator and terminator for inducible expression in E. coli harbouring the λ (DE3) prophage, CMV Enhancer/Chicken β-actin promoter and rabbit β-globin polyA site for efficient expression in mammalian hosts, p10 baculoviral promoter and 5′ UTR/ORF603 and ORF 1629 for efficient expression from/recombination into baculovirus respectively. The high-copy pUC origin of replication and β-lactamase (Ampicillin resistance marker) gene allow high-copy production of the vector in E. coli.
The pTriEx2 vector contains the hybrid CMV and Chicken β-actin promoter/enhancer combination (CAG) promoter that has been reported to give higher expression levels when compared to those vectors (e.g. pTriEx4) using CMV-derived promoter and enhancer (8 (link)). In addition this vector contains a Kozak consensus sequence (9 (link)) for efficient initiation of translation in eukaryotic hosts. The presence of the p10 baculoviral promoter and the flanking lef2 (ORF 603) and ORF1629 baculoviral recombination sites allow the construction of recombinant baculoviruses and, finally, a T7 polymerase promoter with lacO operator offers high level inducible expression in E.coli harbouring the λ (DE3) prophage (10 (link)). The integrity of all the vectors was verified by sequencing (MWG Biotech, London, UK) before large-scale plasmid preparations were performed. Prior to their use in In-Fusion™ reactions, pOPINF, pOPINJ and pOPINM vectors were prepared by digestion with KpnI and HindIII, pOPINE by digestion with NcoI and PmeI and pOPING by digestion with KpnI and PmeI. All restriction digests were followed by agarose gel electrophoresis, gel extraction and purification before elution in 10 mM Tris pH 8.0 buffer. Linearized vectors were stored at −20°C in 10 µg aliquots (equivalent to one 96-well plate of In-Fusion™ reactions). For full details of the fusion tags contributed by the pOPIN vectors see Table 1, for a summary of the construction of these vectors see Figure 1. and the Genbank Accession Numbers for these vectors are as follows … EF372394 (pOPING), EF372395, (pOPINJ), EF372396 (pOPINM), EF372397 (pOPINE), EF372398 (pOPINF).
Berrow N.S., Alderton D., Sainsbury S., Nettleship J., Assenberg R., Rahman N., Stuart D.I, & Owens R.J. (2007). A versatile ligation-independent cloning method suitable for high-throughput expression screening applications. Nucleic Acids Research, 35(6), e45.
Secretion of NPY-mRFP was measured as previously described [25 (link),30 (link)]. Briefly, after three washes in Tyrode’s buffer (10 mM HEPES [pH 7.4], 130 mM NaCl, 5 mM KCl, 1.4 mM CaCl2, 1 mM MgCl2, 5.6 mM glucose, and 0.1% BSA), the cells were either left untreated or triggered with 1 μg/mL c48/80 or 10 μM SP for 30 min in Tyrode’s buffer at 37 °C. In experiments that involved the macropinocytosis inhibitor EIPA, the cells were preincubated with 50 μM EIPA for 30 min, after which the cells were incubated with the triggers in the presence of EIPA for another 30 min. Fluorescence of cell supernatants and cell lysates (200 μL) was measured by using a fluorescence microplate reader (BioTek Synergy H1 Multimode Reader, Agilent, Santa Clara, CA, USA) with excitation at 579 nm and emission at 616 nm. Release of NPY-mRFP is presented as percentage of control. Release is defined as percent secretion untreated subtracted from percent secretion with trigger.
Lazki-Hagenbach P., Kleeblatt E., Fukuda M., Ali H, & Sagi-Eisenberg R. (2024). The Underlying Rab Network of MRGPRX2-Stimulated Secretion Unveils the Impact of Receptor Trafficking on Secretory Granule Biogenesis and Secretion. Cells, 13(1), 93.
The microneme secretion assay was conducted following a previously established protocol [23] . In brief, 1×10 8 puri ed tachyzoites from both Nc1 and Δncgra41 strains were suspended in 1 mL DMEM containing 1 µM A23187. The mixture was incubated at 37°C in a water bath for 30 min. Subsequently, the mixture was centrifuged at 1300×g for 15 min at 4°C to separate the supernatant and precipitation. The precipitation was then combined with 98 µL RIPA and 2 µL Cocktail, followed by a 30 min incubation on ice. The supernatants and lysate were processed using SDS-PAGE followed by a western blot protocol to detect the secretion and expression of NcMICs. The primary antibodies used included mouse anti-NcActin monoclonal antibody (1:4 000), mouse anti-NcMIC1 polyclonal antibody (1:300), mouse anti-NcMIC4 polyclonal antibody (1:300), and mouse anti-NcMIC8 polyclonal antibody (1:1 000). The secondary antibody used was an HRP labeled goat anti-mouse lgG monoclonal antibody (1:5 000).
Yang J., Pei Y., Wang X., Ying Z., Zhu Z., Liu Q., & Liu J. (2024). Role of GRA41 in Neospora caninum pathogenicity: insights into tachyzoite egress and microneme secretion.
Insulin secretion was quantified as the cumulative insulin release across each treatment period. The INS-1E β-cells and rat primary β-cells were prepared in 12-well plates (Corning) and exposed to KREBS solution containing 2.8 mM glucose for 30 minutes as the preincubation condition. Subsequently, the cells were incubated: (i) for 30 minutes under 2.8 mM glucose, (ii) for 5 minutes under 16.7 mM glucose, and (iii) for 30 minutes under 16.7 mM glucose conditions, respectively. The supernatant was aspirated at the respective end time point for each condition. Each sampling well was treated as an independent sample. After the supernatant was removed, cells were washed with 1xPBS once and detached by trypsin. Following centrifuge at 1000 rpm for 3 minutes, cells were resuspended in 1 mL of complete culture medium and then counted. Insulin levels in the supernatant were measured using an insulin ELISA kit (Mercodia). The protein content was subsequently evaluated using Flexstation 3.0 (Molecular Devices) with SoftMax Pro (v5.4.5.000, Molecular Devices). Finally, insulin secretion data were analyzed using GraphPad Prism (v9.4.1, GraphPad Software).
Li W., Li A., Yu B., Zhang X., Liu X., White K.L., Stevens R.C., Baumeister W., Sali A., Jasnin M, & Sun L. (2024). In situ structure of actin remodeling during glucose-stimulated insulin secretion using cryo-electron tomography. Nature Communications, 15, 1311.
IL-2 concentrations in the supernatant were measured by enzyme-linked immunosorbent assay (ELISA) from BioLegend. For the CRISPR screen, IL-2 cytokine secretion assay (MACS) was used to label the cells and detect cytokine release.
Straube J., Bukhari S., Lerrer S., Winchester R.J., Gartshteyn Y., Henick B.S., Dragovich M.A, & Mor A. (2024). PD-1 signaling uncovers a pathogenic subset of T cells in inflammatory arthritis. Arthritis Research & Therapy, 26, 32.
Pups of approximately 10 days old were separated from their mothers (wild-type (n = 10) and Abcg2−/− (n = 11) female mice) 3 h before beginning the experiment. Milk secretion experiments were performed as previously described [9 (link)]. Nitroxynil solution was prepared by diluting Distomicide® (250 mg/mL) commercial solution in saline and administered at a dose of 150 μL/30 g bw into the tail vein under anesthesia with isoflurane. An amount of 200 μL oxytocin (1 IU/mL) was administrated subcutaneously 10 min before milk collection. Blood and milk samples were collected from retro-orbital sinus and mammary gland, respectively, 30 min after nitroxynil administration.
Álvarez-Fernández L., Blanco-Paniagua E, & Merino G. (2024). ABCG2 Transports the Flukicide Nitroxynil and Affects Its Biodistribution and Secretion into Milk. Pharmaceutics, 16(4), 558.
Sourced in United States, China, United Kingdom, Germany, Australia, Japan, Canada, Italy, France, Switzerland, New Zealand, Brazil, Belgium, India, Spain, Israel, Austria, Poland, Ireland, Sweden, Macao, Netherlands, Denmark, Cameroon, Singapore, Portugal, Argentina, Holy See (Vatican City State), Morocco, Uruguay, Mexico, Thailand, Sao Tome and Principe, Hungary, Panama, Hong Kong, Norway, United Arab Emirates, Czechia, Russian Federation, Chile, Moldova, Republic of, Gabon, Palestine, State of, Saudi Arabia, Senegal
Fetal Bovine Serum (FBS) is a cell culture supplement derived from the blood of bovine fetuses. FBS provides a source of proteins, growth factors, and other components that support the growth and maintenance of various cell types in in vitro cell culture applications.
Sourced in United States, China, Japan, Germany, United Kingdom, Canada, France, Italy, Australia, Spain, Switzerland, Netherlands, Belgium, Lithuania, Denmark, Singapore, New Zealand, India, Brazil, Argentina, Sweden, Norway, Austria, Poland, Finland, Israel, Hong Kong, Cameroon, Sao Tome and Principe, Macao, Taiwan, Province of China, Thailand
TRIzol reagent is a monophasic solution of phenol, guanidine isothiocyanate, and other proprietary components designed for the isolation of total RNA, DNA, and proteins from a variety of biological samples. The reagent maintains the integrity of the RNA while disrupting cells and dissolving cell components.
Sourced in United States, China, United Kingdom, Germany, France, Australia, Canada, Japan, Italy, Switzerland, Belgium, Austria, Spain, Israel, New Zealand, Ireland, Denmark, India, Poland, Sweden, Argentina, Netherlands, Brazil, Macao, Singapore, Sao Tome and Principe, Cameroon, Hong Kong, Portugal, Morocco, Hungary, Finland, Puerto Rico, Holy See (Vatican City State), Gabon, Bulgaria, Norway, Jamaica
DMEM (Dulbecco's Modified Eagle's Medium) is a cell culture medium formulated to support the growth and maintenance of a variety of cell types, including mammalian cells. It provides essential nutrients, amino acids, vitamins, and other components necessary for cell proliferation and survival in an in vitro environment.
Sourced in United States, Germany, United Kingdom, Israel, Canada, Austria, Belgium, Poland, Lao People's Democratic Republic, Japan, China, France, Brazil, New Zealand, Switzerland, Sweden, Australia
GraphPad Prism 5 is a data analysis and graphing software. It provides tools for data organization, statistical analysis, and visual representation of results.
Sourced in United States, Austria, Canada, Belgium, United Kingdom, Germany, China, Japan, Poland, Israel, Switzerland, New Zealand, Australia, Spain, Sweden
Prism 8 is a data analysis and graphing software developed by GraphPad. It is designed for researchers to visualize, analyze, and present scientific data.
Sourced in Germany, United States, United Kingdom, Netherlands, Spain, Japan, Canada, France, China, Australia, Italy, Switzerland, Sweden, Belgium, Denmark, India, Jamaica, Singapore, Poland, Lithuania, Brazil, New Zealand, Austria, Hong Kong, Portugal, Romania, Cameroon, Norway
The RNeasy Mini Kit is a laboratory equipment designed for the purification of total RNA from a variety of sample types, including animal cells, tissues, and other biological materials. The kit utilizes a silica-based membrane technology to selectively bind and isolate RNA molecules, allowing for efficient extraction and recovery of high-quality RNA.
Sourced in United States, China, Germany, United Kingdom, Canada, Japan, France, Italy, Switzerland, Australia, Spain, Belgium, Denmark, Singapore, India, Netherlands, Sweden, New Zealand, Portugal, Poland, Israel, Lithuania, Hong Kong, Argentina, Ireland, Austria, Czechia, Cameroon, Taiwan, Province of China, Morocco
Lipofectamine 2000 is a cationic lipid-based transfection reagent designed for efficient and reliable delivery of nucleic acids, such as plasmid DNA and small interfering RNA (siRNA), into a wide range of eukaryotic cell types. It facilitates the formation of complexes between the nucleic acid and the lipid components, which can then be introduced into cells to enable gene expression or gene silencing studies.
Sourced in United States, Germany, United Kingdom, China, Canada, France, Japan, Australia, Switzerland, Israel, Italy, Belgium, Austria, Spain, Gabon, Ireland, New Zealand, Sweden, Netherlands, Denmark, Brazil, Macao, India, Singapore, Poland, Argentina, Cameroon, Uruguay, Morocco, Panama, Colombia, Holy See (Vatican City State), Hungary, Norway, Portugal, Mexico, Thailand, Palestine, State of, Finland, Moldova, Republic of, Jamaica, Czechia
Penicillin/streptomycin is a commonly used antibiotic solution for cell culture applications. It contains a combination of penicillin and streptomycin, which are broad-spectrum antibiotics that inhibit the growth of both Gram-positive and Gram-negative bacteria.
Sourced in United States, United Kingdom, Canada, China, Germany, Japan, Belgium, Israel, Lao People's Democratic Republic, Italy, France, Austria, Sweden, Switzerland, Ireland, Finland
Prism 6 is a data analysis and graphing software developed by GraphPad. It provides tools for curve fitting, statistical analysis, and data visualization.
Secretion refers to the process by which cells release various substances, such as hormones, enzymes, or other molecules, from within the cell to the extracellular environment. This biological mechanism is essential for a wide range of physiological functions, including digestion, immune response, and signaling between cells. Proper secretion is crucial for maintaining normal bodily functions, and defects or dysregulation in secretion pathways can contribute to various disease states.
Secretion involves the packaging of the desired substances into membrane-bound vesicles, which then fuse with the cell membrane to release their contents. This process allows cells to selectively transport and export specific molecules to the extracellular space, where they can exert their intended effects.
There are several types of secretion, including exocytosis (the release of substances from within the cell to the extracellular space), merocrine secretion (the release of substances without the cell membrane being destroyed), and holocrine secretion (the release of substances along with the destruction of the cell itself). The specific type of secretion can vary depending on the cell type and the substance being secreted.
PubCompare.ai allows you to screen protocol literature more efficiently and leverage AI to pinpoint critical insights. The platform's AI-driven analysis can help researchers identify the most effective protocols related to Secretion for their specific research goals, highlighting key differences in protocol effectiveness and enabling them to choose the best option for reproducibility and accuracy. This can streamline the secretion research process and help advance studies in this important area of biomedical research.
Secretion research has a wide range of applications in the biomedical field. It is crucial for understanding the underlying mechanisms of various physiological processes, such as digestion, hormone regulation, and immune function. Additionally, studying secretion pathways can provide insights into disease states, as defects or dysregulation in secretion can contribute to conditions like endocrine disorders, inflammatory diseases, and neurological disorders. Optimizing secretion research protocols using tools like PubCompare.ai can help researchers make important advancements in these areas.
More about "Secretion"
Secretion is a fundamental biological process in which cells release various substances, such as hormones, enzymes, or other molecules, into the extracellular environment.
This mechanism is crucial for a wide range of physiological functions, including digestion, immune response, and cell-to-cell signaling.
The secretion process involves the packaging of desired substances into membrane-bound vesicles, which then fuse with the cell membrane to release their contents.
Defects or dysregulation in secretion pathways can contribute to various disease states, making it an important area of study in biomedical research.
Researchers can optimize their secretion studies by utilizing tools like FBS (Fetal Bovine Serum), TRIzol reagent, and DMEM (Dulbecco's Modified Eagle Medium) to culture and analyze cells.
Statistical analysis software like GraphPad Prism 5, Prism 6, and Prism 8 can help researchers interpret their data and identify the most effective protocols.
To streamline their secretion research, scientists can also leverage RNA extraction kits like the RNeasy Mini Kit and transfection reagents such as Lipofectamine 2000.
Additionally, the use of antibiotics like Penicillin/Streptomycin can help maintain cell cultures and prevent contamination.
PubCompare.ai's AI-driven platform can assist researchers in optimizing their secretion research protocols by helping them easily locate the best methods from literature, preprints, and patents.
This one-stop solution allows researchers to identify the most effective approaches and products to advance their studies on this crucial biological process.
