> Phenomena > Human-caused Phenomenon or Process > DNA Contamination

DNA Contamination

DNA contamination is an unwanted presence of exogenous DNA in a sample, which can interfere with downstream molecular analyses.
It can arise from various sources, such as sample handling, reagents, or environmental factors.
Accurate detection and prevention of DNA contamination is crucial to ensure the reliability and validity of genetic research and diagnostic tests.
Key strategies include implementing strict protocols, using certified reagents, and employing advanced analytical techniques like quantitative PCR and next-generation sequencing.
Effective management of DNA contamination is essential for producing high-quality data and avoiding misleading results in a wide range of biotechnology and medical applications.

Most cited protocols related to «DNA Contamination»

Efficient Sequence Read Alignment and QC

The first step of analysis with GotCloud is to align raw sequence reads (in FASTQ format) to the reference genome and post-process the aligned reads (in BAM format) to be ready for variant calling. GotCloud uses widely available alignment software, such as BWA (Li and Durbin 2009 (link)) and MOSAiK (Zhao et al. 2013 (link)), to generate initial BAM files. After the initial alignment, each BAM file is sorted by genomic coordinates and post-processed to remove duplicated reads and recalibrate base quality scores in a computationally and memory efficient manner using our bamUtil tool included in GotCloud. After these steps, several quality control metrics (such as the number of mapped reads, base-quality distribution, insert size distribution, GC bias profile, sample identity checks, and estimated DNA sample contamination) are produced and stored into summary files (Jun et al. 2012 (link); Li et al. 2013 (link)). These quality assessment steps provide a snapshot of data quality and help identify problems such as low library complexity, insufficient read depth, DNA sample swaps, and sample contamination. Removal of poor performing samples at early steps of the analysis chain helps improve the overall quality of study results.

Jun G., Wing M.K., Abecasis G.R, & Kang H.M. (2015). An efficient and scalable analysis framework for variant extraction and refinement from population-scale DNA sequence data. Genome Research, 25(6), 918-925.

Publication 2015

DNA Contamination DNA Library Genome Memory

Quantitative Analysis of Wolbachia Infection in Drosophila

Quantitative PCR (qPCR) was performed to characterize the relative Wolbachia infection level in the S2 cell lines and flies. The protocol was similar to prior qPCR amplification using the single-copy wsp and su(fk)C genes of bacterial and host origin, respectively [65 (link)]. S2 cells were quantified using a hemocytometer to obtain 10⁶cells. The S2 cells or DSR females were homogenized in 100 μl STE with 0.4 mg/ml proteinase K to extract DNA as previously described [66 (link)].
For qRT-PCR, RNA extractions were performed on groups of 10 ovaries or 10 testes dissected from one-day post eclosion infected and uninfected Drosophila adults using the RNeasy Mini Kit (Qiagen). DNA contamination was removed with RNase-Free DNase Set (Qiagen). RNA quality and quantity was checked with NanoDrop ND-100 spectrophotometer (NanoDrop Technologies, Inc.). Synthesis of cDNA was performed with Superscript II Reverse Transcriptase (Invitrogen) using specific primer for Ance (AnceQ F 5'-CGGTCACGTTCGATTGGTTG-3' and AnceQ R 5'-CTTCGGTTTCCACGTTGGTTC-3') and Actin gene (ActinQ F 5'-GCTGACCGTATGCAAAAGG-3' and ActinQ R 5'-GCTTGGAGATCCACATCTG-3'). Primers were designed based upon D. simulans genbank sequences for Ance and Actin (genbank accession number: NM_057696 and NM_079486, respectively]. qRT-PCR was performed separately with the AnceQ F/R and ActinQ F/R primer pairs using a Miniopticon system (BioRad) with a Platinum SYBR Green qPCR superMix (Invitrogen). qRT-PCR reactions were conducted using a 2 minute step at 50°C, 2 minute step at 95°C and 40 cycles of 15 seconds at 95°C and 30 seconds at 56°C. A fluorescence measurement was made at the end of each cycle. A melting curve analysis was performed at the end of the amplification program to examine for primer-dimers or nonspecific amplification. Assays were performed on two (D. simulans and D. melanogaster wild type) or three (D. melanogaster Ance mutants) independent experiment replicates for each sex and infection type. As an examination for variability, duplicate qRT-PCR reactions were performed for each set of ovaries or testes with both the Ance and Actin primers. Relative expression of Ance gene was calibrated against Actin using the ΔΔC_Tcalculation method [67 (link)] with:

Expression variation = 2^{- Δ Δ C_{T}}

For comparisons of males and females, the above was modified as follows:

Xi Z., Gavotte L., Xie Y, & Dobson S.L. (2008). Genome-wide analysis of the interaction between the endosymbiotic bacterium Wolbachia and its Drosophila host. BMC Genomics, 9, 1.

Full text: Click here

Publication 2008

A(2)C Actins Adult Anabolism Base Sequence Biological Assay Cells Deoxyribonucleases Diptera DNA, Complementary DNA Contamination Drosophila Drosophila melanogaster Endopeptidase K Endoribonucleases Females Fluorescence Gene Expression Genes Genes, Bacterial Infection Males Neoplasm Metastasis Oligonucleotide Primers Ovary Platinum RNA-Directed DNA Polymerase SYBR Green I Testis Wolbachia

Extraction and RT-PCR Analysis of Total RNA

Total RNA was extracted from approximately 200 mg of freshly sampled leaf tissue using TRIzol reagent (Invitrogen, Carlsbad, CA, USA), according to the manufacturer’s instructions. Any genomic contamination was removed before cDNA synthesis using RNase-free DNase I (TaKaRa, Dalian, China), and according to the manufacturer’s protocols. Nucleic acid quality was estimated by visual analysis on 1.2% agarose gel electrophoresis, according to standard procedures [93] . RNA concentrations were measured using a Nanodrop ND-1000 spectrophotometer (Nanodrop Technologies, Rockland, DE, USA) and only RNA samples with an A260/A280 ratio in the range 1.8–2.0 were used, in order to minimise the effects of PCR inhibitors. All RNA samples were stored at −80°C.
The first strand of cDNA was synthesised from 1.5 µg total RNA with the M-MLV reverse transcriptase and oligo (dT)₁₅ primer (Promega, Madison, WI, USA) according to user instructions. In brief, total RNA samples were denatured at 95°C for 3 minutes in the presence of 10 pM oligo (dT)₁₅ primer and then quickly cooled on ice. M-MLV reverse transcriptase and other reaction components were added to the samples. These were then incubated for 10 minutes at 37°C (primer annealing), followed by 90 minutes at 42°C and finally 10 minutes at 70°C to inactivate the enzyme. Reverse transcription (RT) negative controls, without the inclusion of the reverse transcriptase enzyme, were performed in parallel to test for the presence of genomic DNA contamination in RNA samples. Amplification was then conducted for all genes using RT-PCR, followed by assessment on a 4% agarose gel. No visible amplification was detected in any of the control samples (Figure S4B).

Liu D., Shi L., Han C., Yu J., Li D, & Zhang Y. (2012). Validation of Reference Genes for Gene Expression Studies in Virus-Infected Nicotiana benthamiana Using Quantitative Real-Time PCR. PLoS ONE, 7(9), e46451.

Full text: Click here

Publication 2012

Anabolism Deoxyribonucleases DNA, Complementary DNA Contamination Electrophoresis, Agar Gel Enzymes Genes Genetic Profile Genome inhibitors Nucleic Acids Oligonucleotide Primers Oligonucleotides Plant Leaves Promega Reverse Transcription Ribonuclease, Pancreatic RNA-Directed DNA Polymerase Sepharose Tissues trizol

Gene Expression Analysis of Arabidopsis thaliana

The sample data set (Table 1) used for the analysis came from the experiment described below. Arabidopsis thaliana (Col1) plants were grown in the growth chamber at 23°C with 14 hours of light for four weeks. Total RNA was isolated with RNeasy Plant Mini Kit (Qiagen, Inc.) from methyl-jasmonate treated Arabidopsis, alamethecin treated Arabidopsis and control plants, and DNA contamination was removed with an on-column DNase (Qiagen, Inc.) treatment. One microgram of total RNA was synthesized into first strand cDNA in a 20 μL reaction using iScript cDNA synthesis kit (BioRad Laboratories). cDNA was then diluted into 10 ng/μL, 2 ng/μL, 0.4 ng/μL and 0.08 ng/μL concentration series. Three replicates of real-time PCR experiments were performed for each concentration using an ABI 7000 Sequence Detection System from Applied Biosystems (Applied Biosystems). Ubiquitin was used as the reference gene, and the primer sequences for Arabidopsis ubiquitin gene were CACACTCCACTTGGTCTTGCG (F) and TGGTCTTTCCGGTGAGAGTCTTCA (R). The primers for target gene (MT_7) were designed by Primer Express software (Applied Biosystems) and the sequences were CCGCGGTACAAACCTTAATT (F) and TGGAACTCGATTCCCTCAAT (R). MT-7 gene is the Arabidopsis thaliana gene At3g44860 encoding a protein with high catalytic specificity for farnesoic acid [22 ]. Primer titration and dissociation experiments were performed so that no primer dimmers or false amplicons will interfere with the result. After the real-time PCR experiment, Ct number was extracted for both reference gene and target gene with auto baseline and manual threshold.

Yuan J.S., Reed A., Chen F, & Stewart CN J.r. (2006). Statistical analysis of real-time PCR data. BMC Bioinformatics, 7, 85.

Full text: Click here

Publication 2006

Anabolism Arabidopsis Arabidopsis thalianas Catalysis Deoxyribonuclease I DNA, Complementary DNA Contamination farnesoic acid Genes Light methyl jasmonate Oligonucleotide Primers Plants Real-Time Polymerase Chain Reaction Staphylococcal Protein A Titrimetry Ubiquitin

Plant Genomic DNA Extraction and Sequencing

For the Arabidopsis sample preparation, to minimize chloroplast DNA contamination, nuclei were isolated from leaf tissue as previous described^{36 (link)}. Genomic DNA was isolated using standard purification columns and protocols (Qiagen®). For grapevine DNA extraction, young leaves (~1 cm diameter) were collected from Vitis vinifera cv. Cabernet Sauvignon clone 08 at Foundation Plant Services (UC Davis, Davis, CA). Plant tissue (1 g) was ground to a powder in a mortar containing liquid nitrogen. Ten mL of pre-warmed (65 °C) extraction buffer (300 mM Tris-HCl pH 8.0, 25 mM EDTA pH 8.0, 2 M NaCl, 2% (w/v) soluble PVP (MW 40000), 2% CTAB, 2% 2-mercaptoethanol) was added and the suspension was homogenized by inversion and incubated (65 °C) for 30 min in a water bath, mixing by inversion (every 5 min). Plant debris was removed by centrifugation (5000 rpm) for 5 min at room temperature and the supernatant was transferred into a new tube. Equal volume of chloroform:isoamyl alcohol (CIA, 24:1 v/v) was added and mixed by inversion for 5 min. Aqueous phase was segregated by 10 min centrifugation (5000 rpm) at room temperature and transferred gently into a new tube. RNase A was added to the sample (2 μg) and was incubated (37°C) for 30 min. After RNAse treatment, equal volume of CIA was added and centrifuged as above. 0.1 volume of 3 M NaOAc pH 5.2 and an equal volume of isopropanol were added for DNA precipitation, sample was mixed by inversion and then incubated (− 80 °C) for 30 min. DNA was collected by centrifugation (5000 rpm) for 30 min and the pellet was washed twice with 3 mL of 70 % ethanol. After 10 min centrifugation (5000 rpm), DNA pellet was air-dried at room temperature and resuspended in 500 μl of nuclease-free water. DNA quality was evaluated by pulse-gel electrophoresis, and quantity was determined using the Qubit fluorometer.
Shearing of the DNA was performed either with G-tubes (Covaris®) or by passage through a small bore needle³⁷ to average size of 15 kbp to 40 kbp. The needle method was used during an evaluation of shearing techniques. However, both shearing methods produced libraries of comparable quality and sequencing performance. Sheared DNA was enzymatically repaired and converted into SMRTbell™ libraries prepared as described by the manufacturer (Pacific Biosciences). Non SMRTbell DNA was removed by exonuclease treatment. Finally, a BluePippin™ preparative electrophoresis purification step was performed (Sage Sciences) on the library to select insert sizes ranging from 7 to 50 kbp or from 15 to 50 kbp depending on the sequencing experiment. These size-selected libraries were used in subsequent sequencing steps.

Chin C.S., Peluso P., Sedlazeck F.J., Nattestad M., Concepcion G.T., Clum A., Dunn C., O’Malley R., Figueroa-Balderas R., Morales-Cruz A., Cramer G.R., Delledonne M., Luo C., Ecker J.R., Cantu D., Rank D.R, & Schatz M.C. (2016). Phased Diploid Genome Assembly with Single Molecule Real-Time Sequencing. Nature methods, 13(12), 1050-1054.

Publication 2016

2-Mercaptoethanol Arabidopsis Bath Buffers Cell Nucleus Centrifugation Cetrimonium Bromide Chloroform Chloroplasts Clone Cells DNA Contamination DNA Library Edetic Acid Electrophoresis Ethanol Exonuclease Genome Inversion, Chromosome isopentyl alcohol Isopropyl Alcohol Needles Nitrogen Plants Powder Pulse Rate Ribonucleases Sodium Chloride Tissues Tromethamine Vitis

Most recents protocols related to «DNA Contamination»

Genome Sequencing of the Asian Vine Snake

To generate a reference genome sequence of the Asian vine snake, muscle tissue from a male green snake (ID: CIB119038) from Xishuangbanna, Yunnan Province, China, was collected. High molecular weight genomic DNA was prepared using the CTAB method, followed by purification using a QIAGEN® Genomic kit (QIAGEN, Valencia, CA, USA) for sequencing according to the standard procedures provided by the manufacturer.
For genome sequencing, DNA was extracted using the SDS method. DNA degradation and extracted DNA contamination were monitored using 1% agarose gels. DNA purity was then detected using a NanoDrop™ One UV-Vis Spectrophotometer (Thermo Fisher Scientific, USA), with OD 260/280 ranging from 1.8 to 2.0 and OD 260/230 ranging from 2.0 to 2.2. Lastly, the DNA concentration was further measured using a Qubit® 4.0 Fluorometer (Invitrogen, USA). In total, 3–4 μg of DNA per sample was used as input material for the ONT library preparations. After the sample was qualified, size selection of long DNA fragments was performed using the PippinHT system (Sage Science, USA). The DNA fragments ends were then repaired, and A-ligation reaction was conducted using a NEBNext Ultra II End Repair/dA-tailing Kit (Cat# E7546). The adapter in SQK-LSK109 (Oxford Nanopore Technologies, UK) was used for further ligation reactions and the DNA library was measured using a Qubit® 4.0 Fluorometer (Invitrogen, USA). A DNA library (700 ng) was constructed and long-read sequencing was performed on a Nanopore PromethION sequencer (Oxford Nanopore Technologies, UK).
For short-read sequencing, a paired-end library was conducted with an insert size of 300 bp and 100 bp paired-end reads, then sequenced using the MGISEQ-2000 platform following the manufacturer’s standard protocols.
For Hi-C sequencing, muscle cells from the Asian vine snake were fixed with formaldehyde, followed by restriction enzyme digestion. Nuclei were extracted by lysing the cross-linked tissue. The cohesive ends were filled in by adding biotinylated nucleotides, and the free blunt ends were ligated. The cross-linking was reversed, and DNA was purified to remove proteins. The purified DNA was then sheared to a length of ∼400 bp and point ligation junctions were pulled down. The Hi-C libraries were sequenced using the Illumina HiSeq platform with PE150 short reads.

Tang C.Y., Zhang X., Xu X., Sun S., Peng C., Song M.H., Yan C., Sun H., Liu M., Xie L., Luo S.J, & Li J.T. (2023). Genetic mapping and molecular mechanism behind color variation in the Asian vine snake. Genome Biology, 24, 46.

Full text: Click here

Publication 2023

Asian Persons BP 400 Cell Nucleus Cetrimonium Bromide Digestion DNA, A-Form DNA Contamination DNA Library DNA Restriction Enzymes Formaldehyde Gels Genome Ligation Males Muscle Cells Muscle Tissue Nucleotides Proteins Sepharose Snakes Tissues

Leaf Transcriptome Profiling by RNA-seq

Mature leaf tissue was collected from four plants per treatment in one replicate and ground in liquid nitrogen. The PureLink RNA Mini on-column kit with TRIzol (ThermoFisher Scientific, Inc., USA) was used to extract total RNA. An on-column DNAse treatment with additional off-column DNAse I treatments were used to remove DNA contamination. The mRNA library preparation and sequencing were performed by BGI Genomics Co., Ltd. (Shenzhen, China) with polyA selection by an oligo dT library. All 32 samples were multiplexed, pooled and loaded together. Sequencing was conducted on a DNBSEQ™ Technology Platform.

Charles M., Edwards B., Ravishankar E., Calero J., Henry R., Rech J., Saravitz C., You W., Ade H., O’Connor B, & Sederoff H. (2023). Emergent molecular traits of lettuce and tomato grown under wavelength-selective solar cells. Frontiers in Plant Science, 14, 1087707.

Full text: Click here

Publication 2023

Deoxyribonuclease I Deoxyribonucleases DNA Contamination DNA Library DNA Replication Nitrogen oligo (dT) Plant Leaves Plants Poly A RNA, Messenger Tissues trizol

Metagenomic Profiling of Microbial Communities

Total microbial DNA were extracted using the QIAamp PowerFecal Pro DNA Kit (Cat#51804, QIAGEN). DNA concentration was measured. 1 μg DNA per sample was used as input. Sequencing libraries were generated using NEBNext® Ultra™ DNA Library Prep Kit (Cat# E7370L, NEB). DNA samples were fragmented by sonication to 350 bp, which were end-polished, A-tailed, and ligated. PCR products were purified. The clustering of the index-coded samples was performed on a cBot Cluster Generation System, and then sequenced on an Illumina Novaseq 6000 platform by Novogene (Novogene Tianjin, China).
QC process including trimming of low-quality bases, masking of human DNA contamination, and removal of duplicated reads were performed by using kneaddata (version v0.6.1). Human DNA contamination was identified by aligning all raw reads to the human reference genome (hg19) using bowtie2 (version 2.3.5.1). Taxonomic annotation of metagenome and the abundance quantification were performed by MetaPhlAn (version 2.0). Relative abundance of each clade was calculated at six levels (L2: phylum, L3: class, L4: order, L5: family, L6: genus, L7: species). Functional annotations were performed by using the data files from the HMP Unified Metabolic Analysis Network 3.0 (HUMAnN 3.0)^{74 (link)}. The clean paired-end sequencing data were merged into a single fastq file. The HUMAnN 3.0 toolkit was run by using the “humann–input myseq*.fq–output humann3/–threads 32–memory-use maximum -r -v” command, which calls Bowtie2^{75 (link)} to compare nucleic acid sequence and calls DIAMOND^{76 (link)} to compare protein sequences to complete gene and protein function annotation to obtain KEGG pathway annotation. Differences in bacterial abundance and functional pathway were analyzed using MaAslin2^{77 (link)}. Richness indices were calculated using the R Community Ecology Package vegan. Weighted Unifrac distance was calculated using Metaphlan3 R script “Unifrac_distance.r” and root-tree file “mpa_v30_CHOCOPhlAn_201901_species_tree.nwk”. The PCoA results were calculated and visualized using R build-in functions and the plot3D R package. The ANOSIM test was used to calculate the significance of dissimilarity using the R Community Ecology Package vegan. Pearson correlation and P values were evaluated using the rcorr function in the Hmisc R package.

Tang B., Tang L., Li S., Liu S., He J., Li P., Wang S., Yang M., Zhang L., Lei Y., Tu D., Tang X., Hu H., Ouyang Q., Chen X, & Yang S. (2023). Gut microbiota alters host bile acid metabolism to contribute to intrahepatic cholestasis of pregnancy. Nature Communications, 14, 1305.

Full text: Click here

Publication 2023

Amino Acid Sequence Bacteria Base Sequence DNA Contamination DNA Library Genes Genome, Human Homo sapiens Memory Metabolic Networks Metagenome Plant Roots Protein Annotation Trees Vegan

Algal Epiphytic Bacteria Study Using Metagenomics

In the past, studies on the effects of different stresses on algal epiphytic bacteria were mostly conducted in aseptic systems and isolation cultures and tried to identify epiphytic bacteria related to macroalgae. However, because sterile experimental systems are difficult to obtain and culturable bacteria constitute less than 1% of the bacteria present in nature, in actual algal environments, bacteria do not exist in isolation^{61 (link)}; thus, these methods are cumbersome, and the information obtained is not accurate or comprehensive. In this paper, high-throughput sequencing, which is relatively fast and has a relatively low cost and workload^{23 (link)}, was used to extract DNA samples directly from algae.
On the ultra-clean platform, the bacterial suspension obtained in was filtered through sterile gauze to remove any impurities, and then the bacteria were filtered and collected on a 0.22 µm filter membrane using a vacuum filtration device. DNA was extracted from these membranes using an E.Z.N.A. Stool DNA Kit (Omega Bio-tek, USA) following the manufacturer’s instructions. At the same time, a negative control was used to determine the contamination from the DNA Kit. The 16S rDNA V3-V4 region was amplified via PCR using 341F (5′-CCTACGGGNGGCWGCAG-3′) and 806R (5′-GGACTACHVGGGTATCTAAT-3′) primers. The purified amplicons were subsequently sequenced (PE250) on the Illumina Hiseq 2500 platform according to standard protocols by Guangzhou Genedenovo Biotechnology Co., Ltd.

Wang J., Yang Z., Lu P., Sun Y., Xue S., Tang X, & Xiao H. (2023). Effects of UV-B radiation on epiphytic bacterial communities on male and female Sargassum thunbergii. Scientific Reports, 13, 3985.

Full text: Click here

Publication 2023

Asepsis Bacteria DNA, Ribosomal DNA Contamination Epiphyses Feces Filtration isolation Medical Devices Oligonucleotide Primers Seaweed Sterility, Reproductive Tissue, Membrane Vacuum

Quantitative Analysis of Schistosoma mansoni Transcripts

Seven days after dsRNA exposure, 1,000 schistosomula were separated for RNA extraction and relative expression analysis by quantitative real-time PCR (RT-qPCR). Schistosoma mansoni cytochrome C oxidase I gene (SmcoxI—Smp_900000) was used as the internal control gene. RNA extractions were performed using the TRIzol Reagent method followed by purification with the RNeasy Mini Kit (Qiagen), according to the manufacturer’s guidelines. RNA samples were treated with the TURBO DNA-free kit (Ambion) to remove residual genomic DNA, quantified using the Nanodrop Spectrometer ND-1000, and stored at −70°C.
For adults, for 7 days, two worm pairs per day were removed and macerated with TRIzol Reagent for RNA extraction as described previously. Experiments were performed in four biological replicates.
The cDNAs were synthesized with equal amounts of the extracted RNAs using the SuperScript II Reverse Transcriptase (Invitrogen), with oligo(dT)18 following the manufacturer’s protocol. Primers for qPCR analysis were designed using the Primer 3 program.³ Primer efficiencies were estimated by titration analysis to be 100 ± 5% (data not shown), and the specificity was verified by the melting curve. qPCR reactions were performed on 7500 Real-Time PCR System (Applied Biosystems) with SYBR Green PCR Master Mix (Applied Biosystems) and 200 nM of each primer in a final volume of 25 μl. Internal controls to evaluate genomic DNA contaminations (RNA samples) and reagent purity (no cDNA) were included in all analyses. The 2^−ΔΔCt method (Livak and Schmittgen, 2001 (link)) was used for relative quantification and normalized with SmcoxI. Transcript levels were expressed as a percentage of difference relative to the unspecific (GFP) or negative control.

Coelho F.S., Gava S.G., Andrade L.F., Geraldo J.A., Tavares N.C., Lunkes F.M., Neves R.H., Machado-Silva J.R., Pierce R.J., Oliveira G, & Mourão M.M. (2023). Schistosoma mansoni coactivator associated arginine methyltransferase 1 (SmCARM1) effect on parasite reproduction. Frontiers in Microbiology, 14, 1079855.

Full text: Click here

Publication 2023

Adult Biopharmaceuticals DNA, Complementary DNA Contamination Gene Expression Regulation Genes Genome Helminths Oligonucleotide Primers Oligonucleotides Oxidase, Cytochrome-c Quantitative Real-Time Polymerase Chain Reaction RNA, Double-Stranded RNA-Directed DNA Polymerase Schistosoma mansoni SYBR Green I Titrimetry trizol

Top products related to «DNA Contamination»

Trizol reagent by Thermo Fisher Scientific

Sourced in United States, China, Japan, Germany, United Kingdom, Canada, France, Italy, Australia, Spain, Switzerland, Netherlands, Belgium, Lithuania, Denmark, Singapore, New Zealand, India, Brazil, Argentina, Sweden, Norway, Austria, Poland, Finland, Israel, Hong Kong, Cameroon, Sao Tome and Principe, Macao, Taiwan, Province of China, Thailand

TRIzol reagent is a monophasic solution of phenol, guanidine isothiocyanate, and other proprietary components designed for the isolation of total RNA, DNA, and proteins from a variety of biological samples. The reagent maintains the integrity of the RNA while disrupting cells and dissolving cell components.

Rneasy mini kit by Qiagen

Sourced in Germany, United States, United Kingdom, Netherlands, Spain, Japan, Canada, France, China, Australia, Italy, Switzerland, Sweden, Belgium, Denmark, India, Jamaica, Singapore, Poland, Lithuania, Brazil, New Zealand, Austria, Hong Kong, Portugal, Romania, Cameroon, Norway

The RNeasy Mini Kit is a laboratory equipment designed for the purification of total RNA from a variety of sample types, including animal cells, tissues, and other biological materials. The kit utilizes a silica-based membrane technology to selectively bind and isolate RNA molecules, allowing for efficient extraction and recovery of high-quality RNA.

Dnase 1 by Thermo Fisher Scientific

Sourced in United States, Germany, Lithuania, Canada, United Kingdom, China, Japan, Switzerland, Italy, France, Spain, Australia, Belgium, Denmark, Argentina, Sao Tome and Principe, Singapore, Poland, Finland, Austria, India, Netherlands, Ireland, Viet Nam

DNase I is an enzyme used in molecular biology laboratories to degrade DNA. It catalyzes the hydrolytic cleavage of phosphodiester linkages in the DNA backbone, effectively breaking down DNA molecules. This enzyme is commonly used to remove contaminating DNA from RNA preparations, allowing for more accurate downstream analysis of RNA.

Trizol by Thermo Fisher Scientific

Sourced in United States, Germany, China, Japan, United Kingdom, Canada, France, Italy, Australia, Spain, Switzerland, Belgium, Denmark, Netherlands, India, Ireland, Lithuania, Singapore, Sweden, Norway, Austria, Brazil, Argentina, Hungary, Sao Tome and Principe, New Zealand, Hong Kong, Cameroon, Philippines

TRIzol is a monophasic solution of phenol and guanidine isothiocyanate that is used for the isolation of total RNA from various biological samples. It is a reagent designed to facilitate the disruption of cells and the subsequent isolation of RNA.

Agilent 2100 bioanalyzer by Agilent Technologies

Sourced in United States, Germany, Canada, China, France, United Kingdom, Japan, Netherlands, Italy, Spain, Australia, Belgium, Denmark, Switzerland, Singapore, Sweden, Ireland, Lithuania, Austria, Poland, Morocco, Hong Kong, India

The Agilent 2100 Bioanalyzer is a lab instrument that provides automated analysis of DNA, RNA, and protein samples. It uses microfluidic technology to separate and detect these biomolecules with high sensitivity and resolution.

Turbo dna free kit by Thermo Fisher Scientific

Sourced in United States, Germany, United Kingdom, Canada, Lithuania, Japan, France, Italy, Australia, Belgium, Ireland, Norway, Netherlands

The Turbo DNA-free kit is a laboratory product designed to remove DNA contamination from RNA samples. It effectively removes DNA without compromising the integrity of the RNA.

High capacity cdna reverse transcription kit by Thermo Fisher Scientific

Sourced in United States, Germany, United Kingdom, Japan, Lithuania, France, Italy, China, Spain, Canada, Switzerland, Poland, Australia, Belgium, Denmark, Sweden, Hungary, Austria, Ireland, Netherlands, Brazil, Macao, Israel, Singapore, Egypt, Morocco, Palestine, State of, Slovakia

The High-Capacity cDNA Reverse Transcription Kit is a laboratory tool used to convert RNA into complementary DNA (cDNA) molecules. It provides a reliable and efficient method for performing reverse transcription, a fundamental step in various molecular biology applications.

Iscript cdna synthesis kit by Bio-Rad

Sourced in United States, Germany, Italy, Canada, United Kingdom, France, Netherlands, Switzerland, Sweden, Belgium, Japan, Australia, China, India, Spain, Denmark, Austria, Norway

The IScript cDNA Synthesis Kit is a reagent kit used for the reverse transcription of RNA into complementary DNA (cDNA). The kit contains all the necessary components to perform this reaction, including a reverse transcriptase enzyme, reaction buffer, and oligo(dT) primers.

Rneasy plant mini kit by Qiagen

Sourced in Germany, United States, United Kingdom, Netherlands, China, Japan, Canada, Spain, France, Australia, Italy, India, Sweden

The RNeasy Plant Mini Kit is a laboratory equipment designed for the isolation and purification of total RNA from plant tissues and cells. It utilizes a silica-membrane-based technology to efficiently capture and purify RNA molecules, enabling subsequent analysis and downstream applications.

Rnase free dnase set by Qiagen

Sourced in Germany, United States, United Kingdom, Netherlands, France, Canada, Japan, Australia, Italy, China, Spain, Switzerland, Norway, Belgium, Sweden

The RNase-Free DNase Set is a laboratory equipment product designed for the removal of DNA contamination from RNA samples. It provides a convenient solution for the effective elimination of DNA from RNA preparations, ensuring the purity and integrity of RNA samples for downstream applications.

What is DNA contamination and why is it a concern?

DNA contamination refers to the unwanted presence of exogenous (foreign) DNA in a sample, which can interfere with downstream molecular analyses. It is a major concern in genetic research and diagnostic testing as it can lead to inaccurate or misleading results. Contamination can arise from various sources, such as improper sample handling, reagents, or environmental factors. Effective detection and prevention of DNA contamination is crucial to ensure the reliability and validity of scientific findings and medical applications.

What are the key strategies for managing DNA contamination?

Some of the key strategies for managing DNA contamination include: - Implementing strict protocols and best practices for sample collection, handling, and processing - Using certified, high-quality reagents and equipment to minimize the risk of contamination - Employing advanced analytical techniques like quantitative PCR and next-generation sequencing to accurately detect and quantify contaminants - Maintaining a clean, controlled laboratory environment to prevent the introduction of exogenous DNA - Regularly monitoring and validating laboratory procedures to ensure the integrity of the data

How can PubCompare.ai help with DNA contamination detection and prevention?

PubCompare.ai can assist researchers in optimizing their DNA contamination detection and prevention strategies in several ways: 1. It allows you to screene protocol literature more efficiently by leveraging AI to identify the most effective protocols related to DNA contamination for your specific research goals. 2. The platform's AI-driven analysis can highlight key differences in protocol effectiveness, enabling you to choose the best option for reproducibility and accuracy. 3. By comparing a wide range of protocols and techniques from published literature, preprints, and patents, PubCompare.ai helps you identify the most up-to-date and innovative approaches to managing DNA contamination in your work.

What are some common types or variations of DNA contamination?

There are several different types or variations of DNA contamination that can occur, including: - Cross-contamination: Caused by the transfer of DNA from one sample to another during sample handling or processing - Reagent contamination: Introduced through the use of impure or contaminated reagents, such as buffers, primers, or enzymes - Environmental contamination: Arising from DNA present in the laboratory environment, such as from human skin cells, dust, or other sources - Sample-to-sample contamination: Occurs when DNA from one sample is inadvertently transferred to another sample, often during multiplex or high-throughput experiments - PCR carryover contamination: Caused by the unintentional transfer of amplified DNA from previous PCR reactions into new samples

In what applications is managing DNA contamination particularly critical?

Effective management of DNA contamination is crucial in a wide range of biotechnology and medical applications, including: - Genetic research: Accurate detection and quantification of target DNA sequences is essential for studies in fields like genomics, transcriptomics, and epigenetics. - Diagnostic testing: Contamination can lead to false-positive or false-negative results, compromising the reliability of genetic tests for diseases, infections, or genetic disorders. - Forensic DNA analysis: DNA evidence can be easily compromised by exogenous DNA, which can have serious implications in criminal investigations and court proceedings. - Ancient DNA (aDNA) studies: Contamination from modern DNA is a major challenge in the analysis of historical or archaeological samples, which often contain highly degraded DNA. - Microbiome research: Accurate profiling of microbial communities requires the elimination of contaminants from reagents, samples, or the environment.

More about "DNA Contamination"

Unraveling the Complexities of DNA Contamination: Strategies, Tools, and Techniques for Reliable Genetic Research and Diagnostics DNA contamination is a persistent challenge in the world of genetic research and diagnostics, where the presence of exogenous or unwanted DNA can significantly impact the accuracy and reliability of your findings.
This unwanted DNA can originate from various sources, such as sample handling, reagents, or environmental factors, and can interfere with downstream molecular analyses.
To ensure the integrity of your data, it is crucial to implement effective strategies for detecting and preventing DNA contamination.
Key techniques include the use of quantitative PCR (qPCR) and next-generation sequencing (NGS) to accurately identify and quantify contaminants.
Additionally, the employment of certified reagents, such as the TRIzol reagent, RNeasy Mini Kit, and Turbo DNA-free kit, can help minimize the risk of contamination.
Proper sample preparation and handling are also essential, with techniques like the use of DNase I and the RNeasy Plant Mini Kit playing a vital role in removing unwanted DNA.
Furthermore, the integration of advanced analytical tools, like the Agilent 2100 Bioanalyzer, can provide valuable insights into the quality and purity of your samples.
Effective cDNA synthesis, using kits like the High-Capacity cDNA Reverse Transcription Kit and the IScript cDNA synthesis kit, can also contribute to the prevention of DNA contamination by ensuring the accurate conversion of RNA to complementary DNA.
By staying up-to-date with the latest advancements in DNA contamination management and leveraging a combination of proven techniques and cutting-edge tools, you can optimize your research protocols, streamline your workflow, and produce high-quality data that withstands scrutiny.
Remember, the proper management of DNA contamination is essential for reliable genetic research and diagnostic tests, ultimately leading to more accurate and meaningful insights.