Protocol full text hidden due to copyright restrictions
Open the protocol to access the free full text link
>
Phenomena
>
Laboratory or Test Result
>
Blot, Southern
Blot, Southern
Blot, Southern is a powerful technique used in molecular biology to detect and analyze specific DNA sequences within a complex mixture.
It involves the transfer of DNA fragments from a gel to a membrane, followed by hybridization with a labeled probe to visualize the target sequences.
This method is widely used in genomic research, genetic analysis, and disease diagnostics.
It provides researchers with a comprehensive understanding of DNA composition, gene expression, and genetic variations.
The Blot, Southern technique is an essential tool for advancing scientific discovery and understanding the underlying mechanisms of biological processes.
It involves the transfer of DNA fragments from a gel to a membrane, followed by hybridization with a labeled probe to visualize the target sequences.
This method is widely used in genomic research, genetic analysis, and disease diagnostics.
It provides researchers with a comprehensive understanding of DNA composition, gene expression, and genetic variations.
The Blot, Southern technique is an essential tool for advancing scientific discovery and understanding the underlying mechanisms of biological processes.
Most cited protocols related to «Blot, Southern»
Alleles
Blastocyst
Blot, Southern
Chimera
Clone Cells
Enhanced S-Cone Syndrome
Germ Line
Institutional Animal Care and Use Committees
Mice, Laboratory
Pregnant Women
Regulatory Sequences, Nucleic Acid
SOX2 Transcription Factor
Animals
Blastocyst
Blot, Southern
Common Cold
Embryonic Stem Cells
Females
Food
Genome
Luciferases
Males
Mice, Laboratory
Mice, Transgenic
Oligonucleotide Primers
Pellets, Drug
Short Hairpin RNA
3' Untranslated Regions
Adult
Alleles
Animals
Blastocyst
Blot, Southern
Cell Lines
Chimera
Diphtheria Toxin
Embryonic Stem Cells
LacZ Genes
Mus
Rosa
2-Mercaptoethanol
Alleles
Animals, Transgenic
antibiotic G 418
Blot, Southern
Cell Lines
Cells
Clone Cells
Culture Media
Deoxyribonuclease EcoRI
Embryonic Stem Cells
Ethanol
Exons
Feeder Cells
Fetal Bovine Serum
Gene, BRCA2
Genome
Glutamate
Hyperostosis, Diffuse Idiopathic Skeletal
Introns
Loss of Heterozygosity
Methylene Blue
Mouse Embryonic Stem Cells
Nucleotides
Penicillins
Reverse Transcriptase Polymerase Chain Reaction
Streptomycin
Western Blot
Linear targeting vector (100μg) was introduced into R1 ES cells by electroporation, and the genotype of colonies resistant to 350μg/ml of Geneticin (Gibco BRL) was determined by Southern blot (Fig. 1B ). Chimeric mice were generated by aggregation of ES cells with CD-1 morulae as described previously [10 (link)] and the modified allele was passed through the germline by breeding chimeras to CD1 mice. Gata6loxP/loxP mice were produced by breeding Gata6loxp(FRTneoFRT)/+ mice to B6;SJL-Tg(ACTFLPe)9205Dym/J mice [16 (link)] (Jackson Labs) to delete the FRTneoFRT cassette by Flp-mediated recombination in the germline. The ACTFLPe transgene was removed by breeding F1 Gata6loxP/loxP mice into CD-1 mice. Gata6+/del mice were generated by mating Gata6loxp(FRTneoFRT)/+ animals with B6.FVB-Tg(EIIa-cre)C5379Lmgd/J transgenic mice [17 (link)] (Jackson Labs) to allow Cre-mediate recombination between loxP elements in the germline. The EIIa-Cre transgene was removed by breeding Gata6+/del F1 mice with CD1 mice. The MCW IACUC committee approved all procedures using animals.
Full text: Click here
Alleles
Animals
Blot, Southern
Cell Aggregation
Chimera
Cloning Vectors
Electroporation Therapy
Embryonic Stem Cells
Geneticin
Genotype
Germ Line
Institutional Animal Care and Use Committees
Mice, Laboratory
Mice, Transgenic
Morula
Recombination, Genetic
Transgenes
Most recents protocols related to «Blot, Southern»
All animal procedures were performed in accordance with the regulations and protocols of the University of Arizona Institutional Animal Care and Use Committee. On embryonic day 17, pregnant mice were euthanized using CO2 asphyxiation. EVL knockout mouse strain was a gift from Frank Gertler (Massachusetts Institute of Technology, Cambridge, MA, USA), generated as described (Kwiatkowski et al., 2007 (link)). In brief, a targeting vector disrupting exon 2 and 3 of Evl was electroporated into R1 embryonic stem cells for homologous recombination, and a germline clone was isolated (confirmed by Southern blot and Western blot [Kwiatkowski et al., 2007 (link)]). EVL knockout strains were backcrossed six times with C57B/6J to increase congenic status. Wild-type and EVL knockout parents for generating embryonic primary cortical neuron cultures were derived from littermates from heterozygous crossings.
Full text: Click here
Animals
Asphyxia
Blot, Southern
CARE protocol
Clone Cells
Cloning Vectors
Cortex, Cerebral
Embryo
Embryonic Stem Cells
Exons
Germ Line
Heterozygote
Homologous Recombination
Mice, Knockout
Mus
Neurons
Parent
Strains
Western Blotting
Rosa26 targeting by a knock-in strategy was performed based on the pROSA26–1 plasmid59 (link). Murine Snail cDNA (Snai1 cDNA; Library: IRAV MGC Mouse verified full length amplified cDNA; Clone: IRAVp968A0443D6, German Science Centre for Genome Research) was cloned into the targeting vector 3´ of a loxP-flanked transcriptional and translational stop element (loxP-stop-loxP, LSL) with a neomycin resistance cassette (Supplementary Fig. S1a ). The targeting vector was linearized, electroporated into W4/129S6 embryonic stem cells, selection with 250 µg/ml geneticin imposed, and correctly targeted cell clones identified by PCR59 (link). Gene targeting was verified by Southern blot with an external 32P-labeled 5´ probe and EcoRV digested genomic DNA (Supplementary Fig. S1b ). The Southern blot images were processed with an Amersham automatic Hyperprocessor (Amersham Biosciences). Two verified cell clones were injected into C57BL/6 J blastocysts (Polygene). Germ-line transmission was achieved in 2/2 clones harbouring the targeted allele. The mice were genotyped using a 3-primer PCR strategy (ref. 59 (link), Table 1 and Supplementary Fig. S1c ).
Recombination PCR primers for LSL-Rosa26Snail allele
| Name of PCR | Name of primer | Sequence (5’ – 3’) |
|---|---|---|
| LSL-Rosa26Snail recombination | R26-GT forward | AAAGTCGCTCTGAGTTGTTAT |
| R26-Stop cassette reverse | TGAATAGTTAATTGGAGCGGCCGCAATA | |
| Snail-cds reverse | GCGCTCCTTCCTGGT |
Full text: Click here
Alleles
Blastocyst
Blot, Southern
cDNA Library
Clone Cells
Cloning Vectors
DNA, Complementary
Embryonic Stem Cells
Geneticin
Genome
Germ Line
Helix (Snails)
Mus
Neomycin
Oligonucleotide Primers
Protein Biosynthesis
Transcription, Genetic
Transmission, Communicable Disease
A total of 138 participants aged 1–67 years were enrolled in this study (Table 1 ). The Cincinnati Fragile X Research and Treatment Center recruited participants with Fragile X Syndrome (FXS) (55 male, 22 female), premutation carriers (PMCs) (2 male, 27 female), and typically developing controls (TDCs) (26 male, 6 female). Rush University completed clinical southern blot (SB) and/or polymerase chain reaction (PCR) testing on 105 participants (76 with FXS, 26 PMCs, and 3 TDCs) to confirm diagnosis and to evaluate repeat and/or methylation mosaicism status. Only one out of 77 FXS participants did not have clinical testing at the time of this study. In these tests, 26 of the 76 participants with FXS were classified as repeat and/or methylation mosaics. TDCs were recruited through online advertisement and did not have a history of developmental or neuropsychiatric disorders. All participants or legal guardians gave written or verbal assent. The CCHMC Institutional Review Board approved this project. Human subject work followed all relevant regulations and was in accordance with the Declaration of Helsinki.
Full text: Click here
Blot, Southern
Diagnosis
Ethics Committees, Research
Females
Fragile X Syndrome
Legal Guardians
Males
Methylation
Mosaicism
Polymerase Chain Reaction
WT‐RCMV‐E has previously been described (Ettinger et al, 2012 (link)). ΔE27‐RCMV‐E was generated by CRISPR/Cas9‐mediated genome editing. REF were transduced with a mixture of four CRISPR/Cas9 lentiviral vectors carrying sgRNAs that target viral genome up and downstream of the E27 gene (see Table EV3 ). Successfully transduced cells were selected with 2.5 μg/ml puromycin prior to infection with WT‐RCMV‐E. This resulted in an E27‐knockout virus (ΔE27) with a complete deletion of the 1970‐bp E27 gene. E27 deletion was verified by PCR and sequencing. Mutant virus was screened by limiting dilution and was double plaque‐purified. WT‐MCMV was reconstituted from the BAC described in (Jordan et al, 2011 (link)). ΔM27‐MCMV has been described previously (Le‐Trilling et al, 2018 (link)). The M27AxAxxA mutant was generated according to previously published procedures (Wagner et al, 2002 (link); Tischer et al, 2006 (link)) using the primers MCMV‐M27‐QC1‐3_1 and MCMV‐M27‐QC1‐3_2 (Table EV4 ). For the construction of the ΔM27‐E27HA virus, a DNA fragment harbouring one frt site, the ZeoR gene, the EF1 promoter and E27HA was introduced into the ΔM27‐MCMV‐BAC (harbouring an frt site instead of the M27) by FLP‐mediated homologous recombination in E. coli DH10B using the FLP‐expressing plasmid pCP20. Correct mutagenesis was confirmed by restriction digest analysis, Southern blot and PCR analysis. MCMV mutants were reconstituted by transfection of BAC DNA into permissive cells. Viral titres were determined by standard plaque titration on primary MEF, REF or MNC.
Blot, Southern
Cells
Cloning Vectors
Clustered Regularly Interspaced Short Palindromic Repeats
Deletion Mutation
Dental Plaque
DNA, A-Form
Escherichia coli
Gene Deletion
Genes
Homologous Recombination
Infection
Mutagenesis
Oligonucleotide Primers
Plasmids
Puromycin
Technique, Dilution
Titrimetry
Transfection
Viral Genome
Virus
We searched for the predicted F. graminearum AP1 complex proteins using S. cerevisiae AP1 complex proteins (Aps1p, Apm1p, Apl2p, and Apl4p) as a reference to perform a BLAST search against the available fungal genome and identified FGSG_10034, FGSG_17141, FGSG_06317, and FGSG_01893 genetic loci encoding the homologues of AP1 complex proteins in F. graminearum. For convenience, we named these genes FgAP1σ, FgAP1u, FgAP1β, and FgAP1γ, respectively.
F. graminearum protoplast preparation and fungal transformation were conducted as described previously [52 (link)]. Deletions of FgAP1σ (FGSG_10034) genes were achieved using a split-marker approach [53 (link)].Table S2 presents all the primers used for gene deletion. The FgAP1σ knockout mutants were successfully generated and further verified by Southern blot. For complementation assay, green fluorescent protein (GFP) fragment was tagged at the C-terminus of the FgAP1σ gene sequence. We amplified the FgAP1σ coding sequence under the control of its native promoter. The GFP fragment that was fused with the FgAP1σ gene sequence was inserted into a pKNT plasmid to generate FgAP1σ-GFP vector using the Cloning Kit (Vazyme Biotech Co., Ltd., Nanjing, China). The resulting FgAP1σ-GFP construct was amplified using specific primer pairs and sequenced to verify its successful insertion into the plasmid. Finally, the FgAP1σ-GFP vector was transformed into the ΔFgap1σ mutant protoplasts to generate the complemented strain which was phenotypically similar to the PH-1.
F. graminearum protoplast preparation and fungal transformation were conducted as described previously [52 (link)]. Deletions of FgAP1σ (FGSG_10034) genes were achieved using a split-marker approach [53 (link)].
Full text: Click here
Biological Assay
Blot, Southern
Cloning Vectors
Gene Deletion
Genes
Genes, Reporter
Genetic Loci
Genome, Fungal
Green Fluorescent Proteins
Oligonucleotide Primers
Open Reading Frames
Plasmids
Protoplasts
Saccharomyces cerevisiae Proteins
Strains
Transcription Factor AP-1
Top products related to «Blot, Southern»
Sourced in Germany, Switzerland, United States, China, Italy, United Kingdom
The PCR DIG Probe Synthesis Kit is a laboratory equipment product designed for the synthesis of digoxigenin (DIG)-labeled DNA probes using the polymerase chain reaction (PCR) technique. The kit provides the necessary reagents and protocols to generate labeled probes for various applications, such as DNA hybridization and detection.
Sourced in Germany, United States, Switzerland, France, China, Canada
The DIG DNA Labeling and Detection Kit is a product designed for the labeling and detection of DNA. The kit provides the necessary reagents and protocols to incorporate a digoxigenin (DIG) label into DNA samples, which can then be detected using anti-DIG antibodies. The core function of this kit is to enable the labeling and subsequent identification of DNA molecules.
Sourced in Germany, Switzerland, United States, China
The DIG High Prime DNA Labeling and Detection Starter Kit II is a laboratory equipment product designed for the labeling and detection of nucleic acids. It provides the necessary components to perform non-radioactive DNA labeling and subsequent detection using the digoxigenin (DIG) system.
Sourced in Germany, United States, Spain, Netherlands, Canada, China, United Kingdom
The Gentra Puregene Blood Kit is a laboratory equipment product designed for the extraction and purification of genomic DNA from whole blood samples. It provides a reliable and efficient method for isolating DNA for various downstream applications, such as PCR, sequencing, and genotyping.
Sourced in United States, China, United Kingdom, Germany, Japan, Canada
EcoRI is a type II restriction endonuclease enzyme isolated from the bacterium Escherichia coli. It recognizes and cleaves the DNA sequence 5'-GAATTC-3' and its reverse complement 5'-CTTAAG-3'.
Sourced in Germany, United States, China
The DIG High Prime DNA Labeling and Detection Starter Kit is a laboratory tool used to label and detect DNA sequences. It contains the necessary reagents and components to perform DNA labeling and detection procedures.
Sourced in United States, China, Japan, Germany, United Kingdom, Canada, France, Italy, Australia, Spain, Switzerland, Netherlands, Belgium, Lithuania, Denmark, Singapore, New Zealand, India, Brazil, Argentina, Sweden, Norway, Austria, Poland, Finland, Israel, Hong Kong, Cameroon, Sao Tome and Principe, Macao, Taiwan, Province of China, Thailand
TRIzol reagent is a monophasic solution of phenol, guanidine isothiocyanate, and other proprietary components designed for the isolation of total RNA, DNA, and proteins from a variety of biological samples. The reagent maintains the integrity of the RNA while disrupting cells and dissolving cell components.
Sourced in United Kingdom, United States, Sweden, Germany, Japan, Canada
Hybond-N+ membrane is a nylon-based membrane used for nucleic acid transfer and immobilization in molecular biology applications. It provides a stable surface for the binding and detection of DNA, RNA, and other nucleic acid samples. The membrane is designed to offer high binding capacity and efficient capillary transfer of nucleic acids.
Sourced in United States, Germany, United Kingdom, France, Canada
The Gene Pulser is a laboratory equipment designed for electroporation, a technique used to introduce genetic material into cells. It generates an electrical pulse that temporarily increases the permeability of cell membranes, allowing for the uptake of DNA, RNA, or other molecules. The core function of the Gene Pulser is to facilitate this electroporation process in a controlled and reliable manner.
Sourced in Germany, Switzerland, United States, China, Spain
The DIG High Prime DNA Labeling and Detection Starter Kit is a laboratory tool used for the labeling and detection of DNA molecules. It provides the necessary reagents and components to enable the incorporation of digoxigenin-labeled nucleotides into DNA sequences, facilitating their subsequent identification and analysis.
More about "Blot, Southern"
Blot, Southern is a powerful molecular biology technique used to detect and analyze specific DNA sequences within a complex sample.
Also known as Southern blotting, this method involves transferring DNA fragments from a gel to a membrane, followed by hybridization with a labeled probe to visualize the target sequences.
This technique is widely used in genomic research, genetic analysis, and disease diagnostics, providing researchers with a comprehensive understanding of DNA composition, gene expression, and genetic variations.
The Blot, Southern technique is an essential tool for advancing scientific discovery and understanding the underlying mechanisms of biological processes.
It is often used in conjunction with other molecular biology techniques, such as PCR (Polymerase Chain Reaction) and DNA labeling kits (e.g., PCR DIG Probe Synthesis Kit, DIG DNA Labeling and Detection Kit, DIG High Prime DNA Labeling and Detection Starter Kit II) to enhance the sensitivity and specificity of the analysis.
Sample preparation is a crucial step in Blot, Southern analysis, and the Gentra Puregene Blood Kit is often used to extract high-quality DNA from various sample types.
The DNA is then digested with restriction enzymes, such as EcoRI, to generate the fragment patterns necessary for the analysis.
Membrane transfer and hybridization are critical steps in the Blot, Southern technique.
The Hybond-N+ membrane is commonly used for its high-binding capacity and durability.
Labeling the DNA probe with DIG (Digoxigenin) using the DIG High Prime DNA Labeling and Detection Starter Kit allows for sensitive and specific detection of the target sequences.
Visualization of the hybridized DNA fragments is typically achieved using the DIG High Prime DNA Labeling and Detection Starter Kit or the DIG High Prime DNA Labeling and Detection Starter Kit I, which employ colorimetric or chemiluminescent detection methods.
The Gene Pulser system may also be used for efficient DNA transfer during the blotting process.
In addition to DNA analysis, the Blot, Southern technique can be adapted for the detection and quantification of RNA molecules using the TRIzol reagent for effective RNA extraction and purification.
By understanding the nuances of the Blot, Southern technique and leveraging complementary molecular biology tools, researchers can optimize their experimental protocols, enhance reproducibility, and gain deeper insights into the genetic and genomic landscapes of their areas of study.
Also known as Southern blotting, this method involves transferring DNA fragments from a gel to a membrane, followed by hybridization with a labeled probe to visualize the target sequences.
This technique is widely used in genomic research, genetic analysis, and disease diagnostics, providing researchers with a comprehensive understanding of DNA composition, gene expression, and genetic variations.
The Blot, Southern technique is an essential tool for advancing scientific discovery and understanding the underlying mechanisms of biological processes.
It is often used in conjunction with other molecular biology techniques, such as PCR (Polymerase Chain Reaction) and DNA labeling kits (e.g., PCR DIG Probe Synthesis Kit, DIG DNA Labeling and Detection Kit, DIG High Prime DNA Labeling and Detection Starter Kit II) to enhance the sensitivity and specificity of the analysis.
Sample preparation is a crucial step in Blot, Southern analysis, and the Gentra Puregene Blood Kit is often used to extract high-quality DNA from various sample types.
The DNA is then digested with restriction enzymes, such as EcoRI, to generate the fragment patterns necessary for the analysis.
Membrane transfer and hybridization are critical steps in the Blot, Southern technique.
The Hybond-N+ membrane is commonly used for its high-binding capacity and durability.
Labeling the DNA probe with DIG (Digoxigenin) using the DIG High Prime DNA Labeling and Detection Starter Kit allows for sensitive and specific detection of the target sequences.
Visualization of the hybridized DNA fragments is typically achieved using the DIG High Prime DNA Labeling and Detection Starter Kit or the DIG High Prime DNA Labeling and Detection Starter Kit I, which employ colorimetric or chemiluminescent detection methods.
The Gene Pulser system may also be used for efficient DNA transfer during the blotting process.
In addition to DNA analysis, the Blot, Southern technique can be adapted for the detection and quantification of RNA molecules using the TRIzol reagent for effective RNA extraction and purification.
By understanding the nuances of the Blot, Southern technique and leveraging complementary molecular biology tools, researchers can optimize their experimental protocols, enhance reproducibility, and gain deeper insights into the genetic and genomic landscapes of their areas of study.