> Phenomena > Natural Phenomenon or Process > Alpha Particles

Alpha Particles

Most cited protocols related to «Alpha Particles»

Quantifying Stray Radiation Dose in Proton Therapy

In this work, stray radiation was defined as the undesirable radiation produced from interactions between the proton beam and the components in the treatment unit or the patient. Secondary neutrons emanating from the treatment unit (or ‘external neutrons’) and within the patient (or ‘internal neutrons’) have been shown to be the primary contributor to absorbed dose from stray radiation (Agosteo et al 1998 (link), Fontenot et al 2008 (link), Zheng et al 2008 (link)). E, H_T and D_v were calculated separately for both external and internal neutrons. However, because the MCNPX code does not directly differentiate between the absorbed dose from external versus internal radiation, the following method was used to separate the absorbed dose from each of these two components.
To isolate the absorbed dose from external neutrons, D_v,ext, the Monte Carlo system was configured to track neutrons and protons throughout the entire geometry (mode n h; imp:h, n > 0). However, all proton trajectories were terminated immediately upstream of the patient by a proton stopping plane (imp:h = 0), modeled as very thin slab of air. Thus, in simulations with the stopping plane, only external neutrons were incident upon the patient. A type 3 mesh tally (keyword ‘total’) was used to calculate energy deposition in each anatomic voxel of the patient, and D_v,ext was calculated according to the methods described in section 2.3.
Isolating the contribution to absorbed dose from internal neutrons, D_v,int, required a slightly more complex procedure. The additional complexity was necessary because MCNPX tallies did not discriminate between therapeutic (primary) protons and protons that were liberated from inelastic nuclear reactions. First, the absorbed dose from primary protons was calculated by tracking only protons (and not neutrons) throughout the geometry (mode n h; imp:h > 0; imp:n = 0). In this case, secondary neutrons were generated, but their trajectories were immediately terminated at their points of origin. Absorbed dose was calculated in each voxel for primary protons, D_v[p1], using a type 1 mesh tally (keyword ‘pedep’). Second, a simulation was performed in which protons were tracked throughout the model but neutrons were tracked only within the patient (i.e. external neutrons were not allowed to contribute to absorbed dose). This model was identical to the previous one except that the secondary neutrons were tracked within the voxelized anatomy (imp:n > 0 in the phantom). Absorbed dose was calculated in each voxel separately for protons, D_v[p2], and neutrons, D_v[n], using type 1 rectangular mesh tallies (card ‘rmesh’, keyword ‘pedep’). In the MCNPX code, the type 1 mesh tally included energy deposition only from particles that were explicitly specified on the RMESH card (e.g. ‘rmesh21:n pedep’ for neutrons). Thus, the tally excluded the proportion of energy that was deposited by other particles that were being transported, where the list of particles transported was specified on the ‘mode’ card, for example recoil protons (Pelowitz 2005 ). Therefore, the absorbed dose from recoil protons that originated from interactions with internal neutrons was added to D_v[n] using the methods described by Taddei et al (2008) (link), which was based on the assumption that the ratio of neutron dose to secondary proton dose is constant throughout the body. An average of D_v [p2]/D_v [n] for all voxels outside the treatment field, A, was calculated, including contributions from all treatment fields. This average value was then used to estimate the contribution to absorbed dose from secondary protons for each voxel inside the treatment field, and this contribution was added to the absorbed dose from internal neutrons for that voxel,
D_v,int was calculated in terms of mGy from internal neutrons per therapeutic Gy according to the methods described in section 2.3.
Because of computer memory constraints, photons, alpha particles and other secondary particles were not tracked, and their energy was deposited locally at their points of origin. This was not a limitation of the study because in proton therapy equivalent dose from stray radiation is predominated by neutrons (Agosteo et al 1998 (link), Fontenot et al 2008 (link), Zheng et al 2008 (link)).

Taddei P.J., Mirkovic D., Fontenot J.D., Giebeler A., Zheng Y., Kornguth D., Mohan R, & Newhauser W.D. (2009). Stray radiation dose and second cancer risk for a pediatric patient receiving craniospinal irradiation with proton beams. Physics in medicine and biology, 54(8), 2259-2275.

Publication 2009

Alpha Particles Birth Brachytherapy Human Body Memory Patients Protons Proton Therapy Radiotherapy Therapeutics

Irradiation-induced gene expression

RNA was extracted using the E.Z.N.A. Total RNA Kit I (Omega Bio-tek) from isolated PBMCs after 2 Gy irradiation of X-rays, alpha particles and mixed beams following different time points incubation (4h, 24h and 48h). The method of PBMCs isolation was described above. cDNA was synthesised from 250 ng RNA using the High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) with random hexamer primers. Primers, cDNA and PowerUp^™ SYBR^™ Green Master Mix (Thermo Fisher Scientific) were mixed and real time PCR reactions were performed in duplicate on a LightCycler^® 480, starting at 50°C for 2 min and 95°C for 2 min, followed by 40 cycles of 95°C for 15 s, 60°C for 15 s and 72°C for 1 min. No template control reactions were used to identify PCR contamination. The 2^−ΔΔCt method was used for calculation of relative expression and melting curve analysis was used for testing primer specificity. Primers used were: BBC3 for: TACGAGCGGCGGAGACAAGA, BBC3 rev: GCAGGAGTCCCATGATGAGATTGTAC; FDXR for: TGGATGTGCCAGGCCTCTAC, FDXR rev: TGAGGAAGCTGTCAGTCATGGTT; GADD45a for: ACTGCGTGCTGGTGACGAAT, GADD45a rev: GTTGACTTAAGGCAGGATCCTTCCA; XPC for: GCTTGGAGAAGTACCCTACAAGATGGT, XPC rev: GGCTTTCCGAGCACGGTTAGA; MDM2 for: TATCAGGCAGGGGAGAGTGATACA, MDM2 rev: CCAACATCTGTTGCAATGTGATGGAA; CDKN1A for: CCTGGAGACTCTCAGGGTCGAAA, CDKN1A rev: GCGTTTGGAGTGGTAGAAATCTGTCA. For 18S, sequences are given in [27 (link)].

Cheng L., Brzozowska B., Sollazzo A., Lundholm L., Lisowska H., Haghdoost S, & Wojcik A. (2018). Simultaneous induction of dispersed and clustered DNA lesions compromises DNA damage response in human peripheral blood lymphocytes. PLoS ONE, 13(10), e0204068.

Full text: Click here

Publication 2018

Alpha Particles CDKN1A protein, human DNA, Complementary isolation MDM2 protein, human Oligonucleotide Primers Reverse Transcription RNA I Roentgen Rays SYBR Green I

Modeling Radiation-Induced Changes in Poly(HEMA)

Ionizing radiations induce changes in the mechanical properties of the poly(HEMA)

^{10}

B samples. In fact, poly(HEMA)

^{10}

B samples irradiated with neutrons undergo nuclear reactions, like neutron capture in

^{10}

B, thus nuclear fragments and prompt gamma are produced as residuals. Effects on the poly(HEMA)

^{10}

B mechanical properties due to indirect ionizing radiations may not be significant, but high linear energy transfer (LET) projectiles like

^{7}

Li and

^{4}

He, or alpha particle, may actually produce non-negligible effects on the polymeric network structure.
The proposed approach consists on assessing the volume that may be affected by the high LET radiations. Thereby, FLUKA simulations were carried out considering 0.84 MeV

^{7}

Li and 1.47 MeV

^{4}

He projectiles emitted in the positions of the neutron capture reactions, previously determined by means of MCNP simulations. Spatial distributions of those high LET particles, deposited energy and charge produced were obtained by FLUKA simulations, accounting for particle range and lateral extension of the deposited energy or charge produced around the track. The volume directly affected for each particle was approximated to a cone, with height and base corresponding to the range and lateral extension, respectively. Hence, the net affected volume was obtained by adding the volumes of such cones.

Vedelago J., Mattea F., Triviño S., Montesinos M.D., Keil W., Valente M, & Romero M. (2021). Smart material based on boron crosslinked polymers with potential applications in cancer radiation therapy. Scientific Reports, 11, 12269.

Full text: Click here

Publication 2021

Alpha Particles Gamma Rays Linear Energy Transfer N-acetyl-S-(2-hydroxyethyl)cysteine Plant Cone Poly A Polymers Radiation Radiation, Ionizing Retinal Cone

Structural and Photophysical Characterization of Chiral Organic Semiconductors

Single-crystal X-ray diffraction (XRD) was performed at 298 K on a Rigaku XtaLAB Synergy-S diffractometer (Mo-K

α

radiation, λ = 0.710 Å; X-ray tube operating at 50 kV and 30 mA) for the chiral R- and S-NPB and S-MBPI single crystals and on a Bruker APEX II CCD diffractometer (Mo-K

α

radiation, λ = 0.710 Å; X-ray tube operating at 50 kV and 30 mA) for the racemic-NPB and S-NPI. For S-MBPI, X-ray diffraction data were collected subsequently at 298, 200, and 100 K using an Oxford Cryosystem for temperature control. Structure solutions were obtained by SHELXS direct methods and refined using SHELXL least-squares method within the Olex² crystallographic package. A post-refinement analysis for missing symmetry has been carried out for both full structures and isolated inorganic frameworks (i.e., after manually deleting the organic component) using the ADDSYM tool implemented in the PLATON program. Powder XRD was carried out for thin films using a PANalytical Empyrean powder X-ray diffractometer (CuKα radiation) operating at 45 kV and 40 mA. Room-temperature circular dichroism (CD) spectra were measured for thin films (on glass substrates) of R/S/racemic-NPB using an AVIV 420 CD spectrophotometer with 1 nm s⁻¹ scan speed. UV–Vis absorption spectra for thin films were obtained at room temperature using a Shimadzu UV-3600 UV–Vis-NIR spectrophotometer. For low-temperature absorption measurements, thin films of R-, S- and racemic-NPB deposited on sapphire substrates were transferred into a He Cryostat and cooled down to low temperatures using a closed-cycle refrigerator. An incandescent light source from a Xenon lamp dispersed through a monochromator was focused on the sample and detected by an ultraviolet-enhanced silicon photodetector. Transmission spectra were measured using a lock-in amplifier, and optical densities were subsequently calculated. The PL emission from single crystals was recorded at room temperature on a Horiba Jobin Yvon LabRam ARAMIS spectrophotometer using a HeCd (325 nm) laser as an excitation source, 1800 gr/min diffraction grating, and an InGaAs detector. For 7 K PL measurements on single crystals, a solid-state laser operating at 266 nm was used as the pump excitation with an oblique incidence angle of 45°, and the PL emission was collected in reflection geometry and measured with a fiber spectrometer (Ocean Optics USB4000). Thin crystals of NPB were cooled down in a cryostat with optical windows (Cryocooler Model SRDK-205).

Jana M.K., Song R., Liu H., Khanal D.R., Janke S.M., Zhao R., Liu C., Valy Vardeny Z., Blum V, & Mitzi D.B. (2020). Organic-to-inorganic structural chirality transfer in a 2D hybrid perovskite and impact on Rashba-Dresselhaus spin-orbit coupling. Nature Communications, 11, 4699.

Full text: Click here

Publication 2020

A Fibers Alpha Particles Circular Dichroism Cold Temperature Crystallography Crystallography, X-Ray Eye Fever Incandescence Light Powder Radiation Radiography Radionuclide Imaging Sapphire Silicon Transmission, Communicable Disease Vision X-Ray Diffraction Xenon

Time-of-Flight Photocurrent Measurement Protocol

ToF method is based on measurement of the current response in a planar semiconductor device with an external stimulation (such as an alpha particle, electron, short light pulse, etc.). In this experimental setup, the external stimulus is an above bandgap (450 nm) laser pulse (1 μs) with an intensity power of 0.03 μW. The attenuation depth of the optical photons is estimated to be 1 μm. The optical pulse generates electron-hole pairs near the illuminated electrode. By applying an electric field, the electron-hole pairs are separated. Free holes drift toward the cathode and generate a current according to the Shockley-Ramo theorem. The anode immediately collects free electrons; therefore, only free holes drifting in the material generates CWFs signal. In these measurements, the CWFs are recorded by a synchronous triggering derived from the laser pulse. This setup results a much better signal-to-noise ratio as compare to untriggered sources such as alpha particles. Often, the enhanced continuous DC biasing (tens of voltage) in an OMHP device results in dynamic degradation of the sample, which makes the reliable record of CWF impossible. To overcome this detrimental effect, we apply a synchronized pulsed biasing. A light source with a photon energy of 2.8 eV (450 nm) is used to generate free carriers at the anode. The above-bandgap light pulse is preferably absorbed in less than 1-μm-thick layer below the contact electrode. A positive bias, U, is applied between the two electrodes to collect free charge carriers. The current signal is detected using an oscilloscope synchronized with laser and voltage pulses. Using this pulse photoexcitation allows us an accumulation and averaging of multiple CWFs, resulting in a high signal-to-noise ratio. The additional description can be found in the Supplementary Materials (fig. S1).

Musiienko A., Pipek J., Praus P., Brynza M., Belas E., Dryzhakov B., Du M.H., Ahmadi M, & Grill R. (2020). Deciphering the effect of traps on electronic charge transport properties of methylammonium lead tribromide perovskite. Science Advances, 6(37), eabb6393.

Publication 2020

Alpha Particles Electricity Electrons Light Medical Devices Pulse Rate Pulses Toxic Epidermal Necrolysis Vision

Most recents protocols related to «Alpha Particles»

Characterization of Perovskite Solar Cells

XRD diffraction pattern was recorded by Empyrean (D8 Advance, Bruker) with Cu K-alpha radiation (λ = 0.15406 nm) with a scan step size of 0.03°. Morphology was assessed by a scanning electron microscope (Jsm-6510; JEOL Ltd., Japan). The time-resolved photoluminescence (TR-PL) of perovskite films was characterized by the Edinburgh Instruments FLS 980 fluorescence spectrometer. The performance parameters were measured under AM 1.5 G (1000 W m⁻²) using 1000 W xenon as the light source (VS-0851A; Yamashita Denso Co., Ltd, Japan), while a Keithley-2460 source meter was used for data collection. The light intensity was calibrated using an AvaSolar simulator system (Fluotime 300, picoquant). The J–V curve was performed from 1.8 V to −0.1 V at step −0.02 V for each point. EQE spectrum response for sub-cells was recorded on an EQE system (QE-R, Enli Technology Co., Ltd.), and the wavelength range of 300–800 nm & 500–1200 nm for top and bottom cells respectively. Similarly, the excitation light intensity is calibrated by a Si photodiode. A square shape mask with an area of 1.21 cm² was used during the J–V measurement.

He Y., Tang Z., He B., Han C., Ding L., Gu X., Zhang Y., Yan H, & Xu X. (2023). Composition engineering of perovskite absorber assisted efficient textured monolithic perovskite/silicon heterojunction tandem solar cells. RSC Advances, 13(12), 7886-7896.

Publication 2023

Alpha Particles Cells Fluorescence Light perovskite Radionuclide Imaging Scanning Electron Microscopy Xenon

BJAM Printing of Mo-Mn-C Alloy Powders

WA low-alloy steel powders (Rio Tinto Metal Powder, Sorel-Tracy, QC) were used in this study. The chemical composition which was determined by inductively coupled plasma optical emission spectroscopy was given in Table 1. The volume percentile powder size distribution (PSD) and sphericity were analyzed using a particle size and shape analyzer (Camsizer X2, RETSCH). The surface morphology was observed using scanning electron microscopy (SEM) (Vega3, Tescan).Table 1

Chemical composition of the powders studied.

Table 1

Items	Mn	Mo	C	O	S	P
Content/wt.%	0.20	0.80	0.60	0.074	0.01	≤0.01

The BJAM process was carried out in an BJAM system (M-Flex, ExOne) printer with the following processing parameters: 85 μm layer thickness, recoating speed of 300 mm/s, roller speed of 350 rpm, binder saturation of 35%, drying speed of 15 mm/s, and emitter power of 60%. Green parts were printed into a cuboidal shape of 10 × 10 × 10 mm³. For each printing batch, 16 replicates were printed. After printing, the samples were cured at 180 °C for 12 h in a curing oven (CT-333, JPW) under flowing argon, followed by the depowering step.
Thereafter, the specimens were subjected to the debinding and sintering treatments in a tube furnace (GSL-1600X, MTI Corp.) under a 5% H₂–95% N₂ atmosphere. The specimens were oriented during sintering in the furnace similarly to the as-printed orientation, with the x-y printing surface coinciding with the horizontal plane and with the z-printing direction aligned with the vertical orientation. Debinding was performed at 400 °C for 2 h (h), while sintering was conducted using two distinct thermal profiles, namely, direct-sintering and step-sintering. Schematic illustrations of the direct-sintering and step-sintering profiles are shown in Fig. 1(a) and (b), respectively. After ramping up to 1000 °C at 10 °C/min, direct-sintering treatment was achieved by gradually heating up to temperatures ranging from 1405 to 1452 °C (i.e., approximate SLPS region) with a ramp rate of 1, 3, or 5 °C/min, hold for up to 4 h, followed by furnace cooling. On the other hand, step-sintering treatment entails three consecutive stages: 1) The samples were firstly heated from 1000 to 1405 °C at 1, 3, or 5 °C/min; 2) after holding for 2 h, the samples were then heated to a temperature between 1432 and 1452 °C at 1, 3, or 5 °C/min; 3) after holding for up to 4 h, the samples were furnace cooled to room temperature.Fig. 1

Schematic illustrations of the two applied sintering schedules, with the debinding and sintering under 5% H₂–95% N2: (a) direct-sintering schedule, and (b) step-sintering schedule.

Fig. 1

Characterization of the samples was carried out in both the green and sintered states. The oxygen contents in the green and sintered samples were determined through LECO oxygen analysis (O-836, LECO corporation) conducted at Rio Tinto Metal Powder according to the ASTM E1019. The bulk green density was assessed by measuring the sample volume and mass using a caliper (Digimatic Caliper, Mitutoyo) and precision balance (Secura 225D, Sartorius) with 0.0001 g accuracy, respectively. The sintered density was measured and calculated using the Archimedes method according to ISO 5017 and details were given in Ref. [27 (link)]. Phase of selected sintered samples were characterized by X-ray diffraction (XRD) (D8 Diffractometer, Bruker) with Co–K

α

radiation (λ = 1.79026 Å) operating at 40 kV and 45 mA. The as-sintered samples were polished and etched using 2% Nital for metallographic examination. Imaging of sample cross-sections was conducted with a digital microscope (VHX-700, Keyence). Quantitative measurements of grain size for selected sintered samples were undertaken according to ASTM E112-13. At least 200 grains were measured for each sample. The microstructure and chemical composition of powders in as-received, printed and cured, and sintered states were evaluated using a field-emission SEM (FE-SEM) (Leo 1530, Zeiss) equipped with an energy dispersive X-ray spectroscopy (EDX) detector (Oxford Inc).
DSC and TGA were performed (STA 449 Jupiter® instrument, NETZSCH) on the as-received powders and green parts. The experiments were performed under 95% N₂–5% H₂ gas flow to simulate the actual sintering atmosphere used in the tube furnace. The temperature program consisted of a heating stage up to 1500 °C with 5 °C/min and a controlled cooling rate of 5 °C/min down to room temperature. The melting point of the as-received powder (with 0.60 wt% C) was estimated using Thermo-calc software with TCFE 10 database.

Yang M., Keshavarz M.K., Vlasea M., Molavi-Kakhki A, & Laher M. (2023). Supersolidus liquid phase sintering of water-atomized low-alloy steel in binder jetting additive manufacturing. Heliyon, 9(3), e13882.

Full text: Click here

Publication 2023

Alloys Alpha Particles Argon Atmosphere Cereals chemical composition Cuboid Bone Dietary Fiber Metals Microscopy Oxygen Plasma Powder Scanning Electron Microscopy Spectrum Analysis Steel Vision X-Ray Diffraction

Photocatalytic Hydrogen Production

All reagents and solvents
were purchased commercially and used without further purification.
TiO₂ (P25; 97%), SnCl₂·2H₂O
(99.8%), K₂CO₃ (>99.0%), Li₂CO₃ (>99.0%), HCl (>37%), gold(III) chloride trihydrate
(>49%),
C₂H₅OH, and NH₃BH₃ were
purchased from Sigma-Aldrich. Ultrapure water (≥18.2 MΩ·cm)
was used throughout the experiments. X-ray diffraction (XRD) patterns
were collected by using a powder X-ray diffractometer (Bruker D2 Phaser
X-ray Diffractometer) with Cu Kα radiation with a 10 kV beam
voltage and a 30 mA current. UV–visible spectroscopy measurements
were performed using a Shimadzu UV-3600 UV–vis-NIR spectrophotometer
with the reflection mode. It was converted to the absorption spectra
by Kubelka–Munk transformation. Raman spectroscopy measurements
were done by using Renishaw inVia Raman Microscope with the 633 nm
excitation laser source. X-ray photoelectron spectroscopy (XPS) measurements
were conducted using a Thermo K-alpha spectrometer system with Al
Kα radiation (hυ = 1486.7 eV) as the
excitation source. Binding energies for the XPS spectra were corrected
by setting C 1s binding energy to 284.5 eV. Photoluminescence (PL)
emission and lifetime measurements were performed using an Edinburgh
Instruments FLS1000 spectrometer. Scanning electron microscopy (SEM)
images were recorded by a Zeiss Ultra Plus microscope with an accelerating
potential of 20 kV. Transmission electron microscopy (TEM) images
were obtained by a 200 kV aberration-corrected TEM/STEM Hitachi HF5000
equipment. Photocatalytic activity measurements were performed using
an LCS-100 solar simulator with 1.0 SUN AM 1.5G output from a 100
W xenon lamp. The quantification of H₂ was done by a gas
chromatograph (7820A, GC-System, Agilent) equipped with a thermal
conductivity detector (TCD) and flame ionization detector (FID).

Üstünel T., Ide Y., Kaya S, & Doustkhah E. (2023). Single-Atom Sn-Loaded Exfoliated Layered Titanate Revealing Enhanced Photocatalytic Activity in Hydrogen Generation. ACS Sustainable Chemistry & Engineering, 11(8), 3306-3315.

Full text: Click here

Publication 2023

Alpha Particles Chlorides Flame Ionization Gas Chromatography Gold Laser Microscopy lysosomal-associated membrane protein 1, human Microscopy potassium carbonate Powder Radiation Reflex Roentgen Rays Scanning Electron Microscopy Spectrum Analysis Spectrum Analysis, Raman Stem, Plant Transmission Electron Microscopy X-Ray Diffraction Xenon

Characterization of Nanostructured Films

For the
morphological and elemental characterization of the generated nanostructured
films, a Magellan 400L XHR SEM (FEI, Hillsboro, OR) instrument and
a Quanta 650 FEG ESEM (FEI, Hillsboro, OR) instrument were used for
scanning electron microscopy (SEM) and energy-dispersive X-ray spectroscopy
(EDX) analysis. The MNP size distribution (calculated on an average
number of 200 MNPs) was evaluated with “ImageJ, v.1.49.p”.
X-ray photoelectron spectroscopy (XPS) measurements were performed
using a SPECS PHOIBOS 150 hemispherical analyzer (SPECS GmbH, Berlin,
Germany), with a base pressure of 5 × 10^–10 mbar, using a monochromatic Al K-alpha radiation (1486.74 eV) as
the excitation source. The XPS spectral deconvolution and the identification
of the peaks were run—following the technique described by
Sen et al.^{31 (link)}—through the Gaussian–Lorentzian
fitting method,
after smoothing and subtraction of the Shirley-shaped background.
A confocal Raman spectrometer alpha300r (WITec, Ulm, German) equipped
with a 488 nm laser, using a 1.5 mW laser power, a grating 600 g/nm,
and objective 50×, was employed, using an exposure time of 10
s and three accumulations for each spectrum.

Scroccarello A., Álvarez-Diduk R., Della Pelle F., de Carvalho Castro e Silva C., Idili A., Parolo C., Compagnone D, & Merkoçi A. (2023). One-Step Laser Nanostructuration of Reduced Graphene Oxide Films Embedding Metal Nanoparticles for Sensing Applications. ACS Sensors, 8(2), 598-609.

Publication 2023

Alpha Particles Electron Microscopy Pressure X-Ray Photoelectron Spectroscopy

Characterization of Cement Microstructure and Porosity

The set cements were characterized by X-ray diffraction (XRD) analysis to determine the crystalline phase composition by matching with standard database patterns. Micro-computed tomography (μCT) was used to analyse cement porosity (n = 4). The materials were ground with a pestle and sieved for X-ray diffraction analysis. The diffractometer (Siemens D5005, Siemens, Karlsruhe, Germany) was operated at 40 kV, Cu K-α radiation, 40 mA, step size of 0.02° over a range 10°–80° 2θ, with an acquisition time of 300 s per frame.
The scaffold architecture was investigated with μCT (SkyScan 1172, SkyScan Kontich, Belgium) with a resolution of 10.9 µm at 40 kV and an intensity of 250 µA (0.5 mm aluminium filter). The strut density of the scaffolds was determined using a helium pycnometer (Accupyc 1330, Micromeritics, UK). The global porosity was calculated as the ratio of the apparent density to the bulk density.
Cement microstructures were characterized by scanning electron microscopy (SEM), and porosity was measured by mercury porosimetry. The samples were placed on metallic stubs and gold-sputter-coated. SEM (Hitachi S-4700 FE-SEM; Tokyo, Japan) was used to capture microstructural images using an accelerating voltage of 20 kV. Mercury porosimetry (Micromeritics 9420) was used to determine the pore size distribution of the cements.

Ouhaddi Y., Charbonnier B., Porge J., Zhang Y.L., Garcia I., Gbureck U., Grover L., Gilardino M., Harvey E., Makhoul N, & Barralet J. (2023). Development of Neovasculature in Axially Vascularized Calcium Phosphate Cement Scaffolds. Journal of Functional Biomaterials, 14(2), 105.

Full text: Click here

Publication 2023

Alpha Particles Aluminum Dental Cements Dental Cementum Dietary Fiber Gold Helium Mercury Metals Reading Frames Scanning Electron Microscopy X-Ray Computed Tomography X-Ray Diffraction

Top products related to «Alpha Particles»

D8 advance by Bruker

Sourced in Germany, United States, Japan, United Kingdom, China, France, India, Greece, Switzerland, Italy

The D8 Advance is a versatile X-ray diffractometer (XRD) designed for phase identification, quantitative analysis, and structural characterization of a wide range of materials. It features advanced optics and a high-performance detector to provide accurate and reliable results.

Escalab 250xi by Thermo Fisher Scientific

Sourced in United States, United Kingdom, Japan, China, Germany, Netherlands, Switzerland, Portugal

The ESCALAB 250Xi is a high-performance X-ray photoelectron spectroscopy (XPS) system designed for surface analysis. It provides precise and reliable data for the characterization of materials at the nanoscale level.

Asap 2020 by Micromeritics

Sourced in United States, China, United Kingdom, Japan, Germany

The ASAP 2020 is a surface area and porosity analyzer from Micromeritics. It is designed to measure the specific surface area and pore size distribution of solid materials using the principles of gas adsorption.

Smartlab by Rigaku

Sourced in Japan, United States, Germany, United Kingdom, China

The SmartLab is a versatile X-ray diffractometer designed for materials analysis. It features automated alignment and data collection capabilities, providing efficient and reliable performance for a wide range of sample types and research applications.

X pert pro by Malvern Panalytical

Sourced in Netherlands, United Kingdom, United States, Japan, Germany, France, Spain, Austria

The X'Pert PRO is a versatile X-ray diffraction (XRD) system designed for materials characterization. It is capable of performing a range of XRD analyses, including phase identification, structural characterization, and thin-film analysis. The system features advanced optics and a high-performance X-ray source to deliver accurate and reliable results.

K alpha by Thermo Fisher Scientific

Sourced in United States, United Kingdom, China, Japan, Germany, Canada, Hong Kong

The K-Alpha is a high-performance X-ray photoelectron spectroscopy (XPS) system designed for surface analysis. It provides detailed information about the chemical composition and bonding of materials at the surface. The K-Alpha system features advanced technology to deliver accurate and reproducible data for a wide range of sample types and applications.

Tecnai g2 20 by Thermo Fisher Scientific

Sourced in United States, Netherlands, United Kingdom, Germany, Canada

The Tecnai G2 20 is a high-performance transmission electron microscope (TEM) designed for advanced materials analysis and research. It features a 200 kV electron beam with high-resolution imaging capabilities. The core function of the Tecnai G2 20 is to provide detailed structural and compositional information about a wide range of materials at the nanoscale level.

Jen 1230 by JEOL

Sourced in Japan

The JEN-1230 is a high-performance scanning electron microscope (SEM) designed for advanced materials analysis. It features a stable electron optical system and high-resolution imaging capabilities.

Jem 2100 by JEOL

Sourced in Japan, United States, Germany, United Kingdom, China, France

The JEM-2100 is a transmission electron microscope (TEM) manufactured by JEOL. It is designed to provide high-quality imaging and analysis of a wide range of materials at the nanoscale level. The instrument is equipped with a LaB6 electron source and can operate at accelerating voltages up to 200 kV, allowing for the investigation of a variety of samples.

S 4800 by Hitachi

Sourced in Japan, United States, China, Germany, United Kingdom, Spain, Canada, Czechia

The S-4800 is a high-resolution scanning electron microscope (SEM) manufactured by Hitachi. It provides a range of imaging and analytical capabilities for various applications. The S-4800 utilizes a field emission electron gun to generate high-quality, high-resolution images of samples.

What are Alpha Particles?

What are the common applications of Alpha Particles?

Alpha particles have a variety of applications across different fields. In nuclear physics, they are used in particle accelerators and for studying radioactive decay processes. In medical imaging, alpha-emitting radionuclides are employed in targeted alpha therapy to treat certain types of cancer. In radiation biology, researchers investigate the biological effects of alpha particle interactions to understand their impact on living organisms.

What are the challenges in working with Alpha Particles?

One of the main challenges in working with alpha particles is their relatively short range in matter. This means that alpha particles can only travel a few centimeters in air and can be easily shielded by thin layers of material, such as a sheet of paper or the outer layer of skin. Researchers must be mindful of this property when handling or studying alpha particles to ensure proper safety protocols are followed.

How can PubCompare.ai help with Alpha Particle research?

PubCompare.ai is an AI-driven platform that can assist researchers working with alpha particles in several ways. First, it allows you to screen protocol literature more efficiently, helping you quickly identify the most relevant studies and techniques. Secondly, the platform's AI-powered analysis can pinpoint critical insights, such as key differences in protocol effectiveness, enabling you to choose the best option for reproducibility and accuaracy in your alpha particle studies.

More about "Alpha Particles"

Alpha particles are a type of ionizing radiation emitted during the radioactive decay of certain unstable atomic nuclei.
These heavy, positively charged particles consist of two protons and two neutrons, and have a relatively short range in matter.
Alpha particle research is of interest in various fields, including nuclear physics, medical imaging, and radiation biology.
Researchers studying alpha particle interactions and applications can optimize their work by utilizing AI-driven platforms like PubCompare.ai.
This tool helps locate and compare protocols from the literature, preprints, and patents, identifying the best protocols and products to improve reproducibility and accuracy in alpha particle studies.
Specific analytical instruments like the D8 Advance, ESCALAB 250Xi, ASAP 2020, SmartLab, X'Pert PRO, K-Alpha, Tecnai G2 20, JEN-1230, JEM-2100, and S-4800 can be used to conduct various alpha particle-related analyses and experiments.
These instruments provide advanced capabilities for material characterization, surface analysis, and imaging, which are crucial in understanding alpha particle behavior and interactions.
By leveraging the insights gained from PubCompare.ai and utilizing state-of-the-art analytical equipment, researchers can optimize their alpha particle studies, enhance reproducibility, and drive advancements in nuclear physics, medical imaging, and radiation biology.