The genbank sequence for SARS-CoV-2 isolate 2019-nCoV/USA-WA1/2020, accession MN985325, was downloaded on January 24, 2020. In total, we annotated 29 possible open reading frames and proteolytically mature proteins encoded by SARS-CoV-21 (link),12 (link). Proteolytic products resulting from Nsp3 and Nsp5-mediated cleavage of the Orf1a / Orf1ab polyprotein were predicted based on the protease specificity of SARS-CoV proteases57 (link), and 16 predicted nonstructural proteins (Nsps) were subsequently cloned (Nsp1-Nsp16). For the Nsp5 protease (3Clike / 3CLpro), we also designed the catalytic mutant Nsp5 C145A 58 (link),59 (link). Open reading frames at the 3’ end of the viral genome annotated in the original genbank file included 4 structural proteins: S, E, M, N, and the additional open reading frames Orf3a, Orf6, Orf7a, Orf8, and Orf10. Based on analysis of open reading frames in the genome and comparisons with other annotated SARS-CoV open reading frames, we annotated a further four open reading frames: Orf3b, Orf7b, Orf9b, and Orf9c.
>
Phenomena
>
Natural Phenomenon or Process
>
Catalysis
Catalysis
Catalysis refers to the acceleration of a chemical reaction by a substance, known as a catalyst, which is not consumed or altered during the process.
Catalysts work by providing an alternative pathway with a lower activation energy, allowing the reaction to proceed more quickly and efficiently.
This is a fundamental concept in chemistry, with applications in numerous fields, including industrial processes, energy production, and the development of new materials.
Catalytic reactions play a crucial role in the synthesis of pharmaceuticals, the production of fuels and chemicals, and the mitigation of environmental pollutants.
Understading the mechnisms and optimizaiton of catalytic processes is an active area of research, with advances in areas such as heterogeneous catalysis, biocatalysis, and computational modelling driving innovation in this important field.
Catalysts work by providing an alternative pathway with a lower activation energy, allowing the reaction to proceed more quickly and efficiently.
This is a fundamental concept in chemistry, with applications in numerous fields, including industrial processes, energy production, and the development of new materials.
Catalytic reactions play a crucial role in the synthesis of pharmaceuticals, the production of fuels and chemicals, and the mitigation of environmental pollutants.
Understading the mechnisms and optimizaiton of catalytic processes is an active area of research, with advances in areas such as heterogeneous catalysis, biocatalysis, and computational modelling driving innovation in this important field.
Most cited protocols related to «Catalysis»
Catalysis
Cytokinesis
Genome
Open Reading Frames
Peptide Hydrolases
Polyproteins
Proteins
Proteolysis
SARS-CoV-2
Severe acute respiratory syndrome-related coronavirus
SH2D3A protein, human
Viral Genome
The sample data set (Table 1 ) used for the analysis came from the experiment described below. Arabidopsis thaliana (Col1) plants were grown in the growth chamber at 23°C with 14 hours of light for four weeks. Total RNA was isolated with RNeasy Plant Mini Kit (Qiagen, Inc.) from methyl-jasmonate treated Arabidopsis, alamethecin treated Arabidopsis and control plants, and DNA contamination was removed with an on-column DNase (Qiagen, Inc.) treatment. One microgram of total RNA was synthesized into first strand cDNA in a 20 μL reaction using iScript cDNA synthesis kit (BioRad Laboratories). cDNA was then diluted into 10 ng/μL, 2 ng/μL, 0.4 ng/μL and 0.08 ng/μL concentration series. Three replicates of real-time PCR experiments were performed for each concentration using an ABI 7000 Sequence Detection System from Applied Biosystems (Applied Biosystems). Ubiquitin was used as the reference gene, and the primer sequences for Arabidopsis ubiquitin gene were CACACTCCACTTGGTCTTGCG (F) and TGGTCTTTCCGGTGAGAGTCTTCA (R). The primers for target gene (MT_7) were designed by Primer Express software (Applied Biosystems) and the sequences were CCGCGGTACAAACCTTAATT (F) and TGGAACTCGATTCCCTCAAT (R). MT-7 gene is the Arabidopsis thaliana gene At3g44860 encoding a protein with high catalytic specificity for farnesoic acid [22 ]. Primer titration and dissociation experiments were performed so that no primer dimmers or false amplicons will interfere with the result. After the real-time PCR experiment, Ct number was extracted for both reference gene and target gene with auto baseline and manual threshold.
Full text: Click here
Anabolism
Arabidopsis
Arabidopsis thalianas
Catalysis
Deoxyribonuclease I
DNA, Complementary
DNA Contamination
farnesoic acid
Genes
Light
methyl jasmonate
Oligonucleotide Primers
Plants
Real-Time Polymerase Chain Reaction
Staphylococcal Protein A
Titrimetry
Ubiquitin
All plasmids were constructed using the pEGFP-C1 or -N1 backbone (Takara Bio Inc.). When different fluors were used, EGFP was replaced with CFP, mTq2 (mTurquoise2; a gift from T. Gadella, University of Amsterdam, Amsterdam, Netherlands; Goedhart et al., 2012 (link)), mRFP (Campbell et al., 2002 (link)), mCherry (Shaner et al., 2004 (link)), or iRFP (Filonov et al., 2011 (link)).
The following cDNAs were amplified by PCR and subcloned into plasmids as follows: residues 546–647 from L. pneumophila SidM (available from GenBank under accession no.DQ845395 ), corresponding to the isolated P4M domain (Schoebel et al., 2010 (link)), were cloned into pEGFP-C1 (or spectral variants mCherry or iRFP) at BspEI and EcoRI sites. We also made a similar plasmid inserting the same P4M fragment at SalI and BamHI sites with a GGSASGLRS linker between GFP and the N terminus. This was used as a template to insert a second P4M insert at EcoRI and SalI sites with the same linker between GFP and the first P4M and a GGSAVDGGSASGLRS linker separating the tandem P4M domains. To generate FRB fused to canine Rab5 and Rab7 (a gift from R. Lodge, Institut de Recherches Cliniques de Montreal, Montreal, Quebec, Canada; Rojas et al., 2008 (link)), the entire coding regions were inserted at HindIII–KpnI sites of a modified piRFP-C1 vector containing the FRB domain (NCBI Nucleotide accession no. NM_004958 ; residues 2,021–2,113) flanked by GGAGA and GGSAGGSA linkers at the 5′ and 3′ ends, respectively, and inserted at BglII–HindIII sites. For pmCherry-C1-FKBP-MTM1, FKBP (NCBI Nucleotide accession no. NM_054014 ; residues 3–109) flanked by GAGGAARAAL and (SAGG)5PRAQASNSA linkers at the 5′ and 3′ ends were inserted at NotI–SalI sites and MTM1(NCBI Nucleotide accession no. NM_000252 ) at SalI–BamHI. Hepatitis C NS5A (Budhu et al., 2007 (link)) was obtained from Addgene and inserted at HindIII–KpnI sites in pmCherry-N1. piRFP-N1-TTC7B (isolated from an EST that misses L53-A85 from exon 2; GenBank accession no. BQ426031 ) was inserted at NheI–SalI sites with a C-terminal GGSAGGSA linker with the iRFP. Constructs are available through Addgene. PI4KAv1 (NCBI Nucleotide accession no. NM_058004 ) was inserted at EcoRI–SalI sites of pmTq2-C1, and PI4KBv2 (NCBI Nucleotide accession no. NM_001198773 ) was inserted at XhoI–KpnI sites in pEGFP-C1. pEGFP-N1-EFR3B (NCBI Nucleotide accession no. NM_014971 ) was inserted at NheI–AgeI sites. Murine Sacm1l (NCBI Nucleotide accession no. NM_030692 ) was inserted at BglII–SalI sites in pmCherry-N1. Additional plasmids were obtained as follows: pEGFP-N1-PH-PLCδ1 (Várnai and Balla, 1998 (link)); pEGFP-N1-PH-FAPP1 and pEGFP-C1-PH-OSBP (Balla et al., 2005 (link)); PJ, its catalytic mutants, and pECFP-N1-Lyn11-FRB (Hammond et al., 2012 (link)); pmRFP-FKBP-INPP5E (Várnai et al., 2006 (link)); pECFP-FRB-giantin3,140–3,269 (a gift from T. Inoue, Johns Hopkins University School of Medicine, Baltimore, MD; Komatsu et al., 2010 (link)) or a pmCherry variant; pECFP-C1-FKBP-PIP5K (Suh et al., 2006 (link)); pmCherry-C1-Rab5 and -Rab7 (Rojas et al., 2008 (link)); GFP-FYVE-EEA1 (Balla et al., 2000 (link)); pEGFP-N1-PI4K2A (Jović et al., 2012 (link)); pEGFP-N1-PI4K2B (Balla et al., 2002 (link)); and piRFP-C1-PH-PLCδ1 (a gift from P. De Camilli, Yale School of Medicine, New Haven, CT; Idevall-Hagren et al., 2012 (link)).
The following cDNAs were amplified by PCR and subcloned into plasmids as follows: residues 546–647 from L. pneumophila SidM (available from GenBank under accession no.
Canis familiaris
Catalysis
Cloning Vectors
Deoxyribonuclease EcoRI
DNA, Complementary
Exons
Hepatitis C
Mus
Nucleotides
Plasmids
Tacrolimus Binding Proteins
Vertebral Column
X-Linked Centronuclear Myopathy
The PhosphoBase (6 (link)) consists of 1883 experimentally verified phosphorylation sites within 597 protein entries. The number of serine, threonine and tyrosine sites is 984, 246 and 653, respectively. Swiss-Prot (7 (link)) (release 45 of October 2004) maintains 163 500 protein entries, of which 3614 have phosphorylation annotation. Among these entries, the number of serine, threonine and tyrosine sites was 1005, 281 and 321, respectively. Generally, the serine, threonine and tyrosine, which are not annotated as phosphorylation residues, within the experimentally validated phosphorylated proteins, are selected as negative sets, i.e. the non-phosphorylated sites. Therefore, two negative (non-phosphorylated) datasets were obtained from the PhosphoBase and Swiss-Prot based on the phosphorylation annotation. Because of the absence of good negative dataset exists for non-phosphorylated sites, the residues that had not been previously annotated as phosphorylated in phosphorylation annotated proteins were chosen as a reflection of more general non-phosphorylated sites. Supplementary Table S1 summarizes the statistics of kinase-specific phosphorylated sites used for learning models in the proposed application. This work confirms the existence of two major protein kinases phosphorylating either at serine/threonine residues or at tyrosine residues.
Figure 1 depicts a flowchart of the proposed method. Phosphorylated sites were first extracted as positive sets; non-phosphorylated sites were extracted as negative sets, and the catalytic kinase annotations were obtained from PhosphoBase and Swiss-Prot. The positive sets were then categorized by catalytic kinases. Alternatively, in larger positive groups, the sequences of the phosphorylated sites can be clustered into subgroups by maximal dependence decomposition (MDD) (8 (link)). The MDD was first applied in nucleotides and is a recursive process to divide a sequence set into tree-like subgroups based on the positional dependency of the sequences. Here, we applied the MDD to group protein phosphorylation substrates into subgroups. As the example given in Figure 1 , 232 phosphorylation serine substrates are grouped into subgroups. When applying MDD to cluster the sequences of a positive set, a parameter, i.e. the minimum-cluster-size, should be set. If the size of a subgroup is less than the minimum-cluster-size, the subgroup is terminated to be divided. The MDD process terminates until all the subgroup sizes are less than the minimum-cluster-size.
Thereupon, the concept of the profile HMM was adopted to learn computational models from positive sets of phosphorylation sites. To evaluate the learned models, k-fold cross-validation and leave-one-out cross-validation were performed on them. After evaluating the models, the model with highest accuracy in each dataset was chosen.
For each kinase-specific positive set of the phosphorylated sites, the best performed model is selected and used to identify the phosphorylation sites within the input protein sequences by HMMsearch (9 (link)). To search the hits of a model, HMMER returns both a HMMER bit score and an expectation value (E-value). The HMMER bit score is used as the criterion to define a HMM match. We select the HMMER score as the criterion to define a HMM match. A search of a model with the HMMER score greater than the threshold t is defined as a positive prediction, i.e. a HMM recognizes a phosphorylation site. The threshold t of each model is decided by maximizing the accuracy measure during a variety of cross-validations with the HMM bit score value range from 0 to −10. For example, Supplementary Figure S1 depicts the optimization of the threshold of the HMM bit scores in the S_PKA model. The threshold of the S_PKA model is set to −4.5 to maximize the accuracy measure of the model.
When considering a MDD-clustered dataset, for example, MDD-clustered PKA catalytic serine (S_PKA), the HMMs are trained separately from the subgroups of the phosphorylated sites resulted by MDD. Each model is used to search in the given protein sequences for the phosphorylated sites. A positive prediction of a model group is defined by at least one of the models that makes a positive prediction, whereas a negative prediction is defined as all the models that make negative predictions.
Thereupon, the concept of the profile HMM was adopted to learn computational models from positive sets of phosphorylation sites. To evaluate the learned models, k-fold cross-validation and leave-one-out cross-validation were performed on them. After evaluating the models, the model with highest accuracy in each dataset was chosen.
For each kinase-specific positive set of the phosphorylated sites, the best performed model is selected and used to identify the phosphorylation sites within the input protein sequences by HMMsearch (9 (link)). To search the hits of a model, HMMER returns both a HMMER bit score and an expectation value (E-value). The HMMER bit score is used as the criterion to define a HMM match. We select the HMMER score as the criterion to define a HMM match. A search of a model with the HMMER score greater than the threshold t is defined as a positive prediction, i.e. a HMM recognizes a phosphorylation site. The threshold t of each model is decided by maximizing the accuracy measure during a variety of cross-validations with the HMM bit score value range from 0 to −10. For example, Supplementary Figure S1 depicts the optimization of the threshold of the HMM bit scores in the S_PKA model. The threshold of the S_PKA model is set to −4.5 to maximize the accuracy measure of the model.
When considering a MDD-clustered dataset, for example, MDD-clustered PKA catalytic serine (S_PKA), the HMMs are trained separately from the subgroups of the phosphorylated sites resulted by MDD. Each model is used to search in the given protein sequences for the phosphorylated sites. A positive prediction of a model group is defined by at least one of the models that makes a positive prediction, whereas a negative prediction is defined as all the models that make negative predictions.
Amino Acid Sequence
Base Sequence
Catalysis
Exhaling
Hypertelorism, Severe, With Midface Prominence, Myopia, Mental Retardation, And Bone Fragility
Nucleotides
Phosphorylation
Phosphotransferases
Protein Kinases
Proteins
Reflex
Serine
Threonine
Trees
Tyrosine
The software package was implemented in R, following Bioconductor standards. Basic usage examples are provided in Supplementary Material and the package documentation. In principle, we encourage users to apply advanced data normalization, clustering and cell-type calling tools (12 (link),34 (link)), and to submit preprocessed count matrices to SingleCellSignalR to perform LR interaction inference and visualization. For convenience, we implemented simple data preparation steps enabling users to start from a raw read count matrix. We normalize individual cell transcriptomes according to their 99th read count percentile. In case a cell has its 99th percentile equal to zero, it is discarded. Normalized read counts (+1 to avoid zeros) are log-transformed. Clustering can be obtained either by chaining principal component analysis for dimension reduction and K-means (35 (link)), or by using the advanced SIMLR model (36 (link)). Cell-type calling is implemented based on a list of gene signatures following a format identical to PanglaoDB (37 ) exports such that users can easily add cell types from this rich source or provide their own. Our algorithm computes the average gene signature expression across all the cells and for all the signatures to obtain a signature cell matrix. This matrix is normalized and a threshold is iteratively adjusted to maximize the number of cells assigned to a single cell type. Full details and an example are in Supplementary Material.
It is possible to infer paracrine or autocrine only interactions, or both types (Supplementary Figure S1 ); details in Supplementary Material. For annotation purposes, differentially expressed genes between each cluster and all the other clusters pooled, are successively searched with edgeR functions glmFit and glmRT (38 (link)). LR interactions with both the ligand and the receptor significantly enriched in their respective cell types are labeled ‘specific’ (Supplementary Figure S1 ).
In order to relate receptors to intracellular signaling, we make use of Reactome and KEGG (39 (link)) interactions downloaded from Pathway Commons. Interactions are assigned to several types that we simplified to facilitate the display of networks afterward. Interaction types ‘interacts-with’ and ‘in-complex-with’ were assigned to the simplified type ‘complex.’ The interaction types ‘chemical-affects,’ ‘consumption-controlled-by,’ ‘controls-expression-of,’ ‘controls-phosphorylation-of,’ ‘controls-production-of,’ ‘controls-state-change-of,’ ‘controls-transport-of’ and ‘controls-transport-of-chemical’ were simplified as ‘control.’ The interaction types ‘catalysis-precedes,’ ‘reacts-with’ and ‘used-to-produce’ were simplified as ‘reaction.’ The simplified type ‘control’ was considered directional whereas ‘complex,’ and ‘reaction’ were considered undirected.
It is possible to infer paracrine or autocrine only interactions, or both types (
In order to relate receptors to intracellular signaling, we make use of Reactome and KEGG (39 (link)) interactions downloaded from Pathway Commons. Interactions are assigned to several types that we simplified to facilitate the display of networks afterward. Interaction types ‘interacts-with’ and ‘in-complex-with’ were assigned to the simplified type ‘complex.’ The interaction types ‘chemical-affects,’ ‘consumption-controlled-by,’ ‘controls-expression-of,’ ‘controls-phosphorylation-of,’ ‘controls-production-of,’ ‘controls-state-change-of,’ ‘controls-transport-of’ and ‘controls-transport-of-chemical’ were simplified as ‘control.’ The interaction types ‘catalysis-precedes,’ ‘reacts-with’ and ‘used-to-produce’ were simplified as ‘reaction.’ The simplified type ‘control’ was considered directional whereas ‘complex,’ and ‘reaction’ were considered undirected.
Full text: Click here
Catalysis
Cells
Cytosol
Gene Clusters
Genes
Ligands
Phosphorylation
Protoplasm
Transcriptome
Most recents protocols related to «Catalysis»
Example 5
A solution of Compound C (160 mg, 0.28 mmol) and NEt3 (798 μL, 2.8 mmol) in DCM (2 mL) was treated with phosgene solution (906 μL, 1.4 mmol, 0.5 M in toluene) at 0° C., and the resulting mixture was stirred at 0° C. for 0.5 hr under nitrogen. The reaction mixture was then added to MeOH (2 mL) at 0° C. and stirred for an additional 1 hr. The solvent was removed, and the residue was purified by silica gel chromatography. The THP-protected methylcarbonate was dissolved in MeOH (4 mL), treated with PPTS (catalytic) and stirred at 50° C. for 2 hr. The reaction mixture was concentrated, and the residue was dissolved in MTBE (20 mL) and washed with water and then brine to yield crude THP-deprotected methylcarbonate. The crude product was taken in dioxane (5 mL) along with 10% Pd/C (28 mg) and hydrogenated under a hydrogen atmosphere to yield crude Compound Ia-10 (83 mg) as an oil. MS: m/z 471 [M+Na]+
The following compound was synthesized using similar procedures as above:
Full text: Click here
Acetic Acid
Anabolism
Atmosphere
brine
Catalysis
Chromatography
dioxane
fluoromethyl 2,2-difluoro-1-(trifluoromethyl)vinyl ether
Gel Chromatography
Hydrogen
methyl tert-butyl ether
Nitrogen
Phosgene
Podofilox
Silica Gel
Silicon Dioxide
Solvents
Toluene
Example 4
The catalytic effect of several other reagents having a thiocarbonyl functional group was examined on the leaching of synthetic chalcopyrite, covellite, bornite, and enargite. Experiments were carried out in stirred reactors containing 40 mM ferric sulfate solution at pH 1.8. 1 g of chalcopyrite or covellite was added to the reactors along with an initial concentration of 2 mM of various thiocarbonyl reagents including Tu, TA, SDDC, ETC and TSCA. The Cu extraction curves for chalcopyrite, covellite, bornite, and enargite using all or a subset of the above reagents are shown in
From
Full text: Click here
bornite
Carbon disulfide
Catalysis
chalcopyrite
cupric sulfide
enargite
ferric sulfate
Urea
Example 39
Generally, pharmacophores for FAAH inhibitors, urea and non-urea based, interact by either carbamoylating or forming transition-state mimics with the catalytic serine residue. However, since a large number of hydrolases utilize a similar catalytic serine residue, many FAAH inhibitors have suffered from poor selectivity. Therefore, the potency of t-TUCB, A-14 and A-21 on several other serine hydrolases was tested. Included in this panel were carboxylesterases, hydrolases involved in xenobiotic detoxification, and paraoxonases and esterases involved in the regulation of arterosclerosis. As is shown in Table 5 below, none of these serine hydrolases were inhibited by t-TUCB, A-14, or A-21.
Full text: Click here
Aryldialkylphosphatase
Carboxylic Ester Hydrolases
Catalysis
Enzymes
Esterases
Genetic Selection
Hydrolase
inhibitors
Metabolic Detoxication, Drug
PON1 protein, human
PON2 protein, human
Serine
Urea
Xenobiotics
Example 5
The catalytic effect of leaching solutions prepared with FDS on chalcopyrite, bornite, covellite, and chalcocite leaching was determined in stirred reactor tests. All reactors contained 1.9 L of ferric sulfate solution at pH 1.8 and total iron concentration of 40 mM. 1 g of mineral samples was used in each reactor test. An initial FDS concentration of 1 mM or an initial Tu concentration of 2 mM Tu was used.
The results from stirred reactor tests shown in
Full text: Click here
bornite
Catalysis
chalcopyrite
cupric sulfide
ferric sulfate
Figs
Iron
Minerals
Example 3
A solution of Compound C (90 mg, 0.15 mmol), NEt3 (70 μL, 0.5 mmol) and 4-dimethylaminopyridine (DMAP) (1 crystal) in DCM (2 mL) was treated with methoxyacetyl chloride (21 μL, 0.22 mmol) and stirred at RT for 12 hr under nitrogen. The reaction mixture was diluted with MTBE and washed with water and then brine, dried over sodium sulfate and concentrated under vacuum. The residue was purified by silica gel chromatography. The THP-protected methoxyacetate was dissolved in MeOH (4 mL), treated with pyridinium para-toluene-sulfonate (PPTS) (catalytic) and stirred at 50° C. for 2 hr. The reaction mixture was concentrated, and the residue was dissolved in MTBE (20 mL) and washed with water and then brine to yield crude THP-deprotected methoxyacetate. The crude product was taken in dioxane (5 mL) along with 10% Pd/C (18 mg) and hydrogenated under a hydrogen atmosphere to yield crude Compound Ia-8 (64 mg) as an oil. MS: m/z 485 [M+Na]+
The following compounds were synthesized using similar procedures as above:
Full text: Click here
4-dimethylaminopyridine
4-toluene sulfonate
Acetic Acid
Anabolism
Atmosphere
brine
Catalysis
Chlorides
Chromatography
dioxane
fluoromethyl 2,2-difluoro-1-(trifluoromethyl)vinyl ether
Gel Chromatography
Hydrogen
methoxyacetate
methyl tert-butyl ether
Nitrogen
Silica Gel
Silicon Dioxide
sodium sulfate
Vacuum
Top products related to «Catalysis»
Sourced in United States, United Kingdom, Canada, China, Germany, Japan, Belgium, Israel, Lao People's Democratic Republic, Italy, France, Austria, Sweden, Switzerland, Ireland, Finland
Prism 6 is a data analysis and graphing software developed by GraphPad. It provides tools for curve fitting, statistical analysis, and data visualization.
Sourced in Japan, United States, Germany, United Kingdom, China, Netherlands
The GC-2014 is a gas chromatograph designed for laboratory use. It is capable of analyzing a wide range of volatile and semi-volatile organic compounds. The GC-2014 features a programmable temperature control system, a choice of detectors, and advanced data analysis software.
Sourced in United States, Germany, United Kingdom, Israel, Canada, Austria, Belgium, Poland, Lao People's Democratic Republic, Japan, China, France, Brazil, New Zealand, Switzerland, Sweden, Australia
GraphPad Prism 5 is a data analysis and graphing software. It provides tools for data organization, statistical analysis, and visual representation of results.
Sourced in United States, Canada, Germany, United Kingdom
PyMOL is a molecular visualization software package for rendering and animating 3D molecular structures. It allows users to display, analyze, and manipulate molecular models, providing a powerful tool for research in fields such as biochemistry, structural biology, and drug design.
Sourced in United States
Maestro is a computational modeling software developed by Schrödinger. It is designed to assist researchers in visualizing and analyzing molecular structures and interactions. The core function of Maestro is to provide a comprehensive platform for molecular modeling and simulation.
Sourced in United States, Germany, United Kingdom, India, Australia, Switzerland, China, Brazil, Sao Tome and Principe, France, Ireland, Italy, Macao, Poland, Malaysia, Portugal
Xylene is a common laboratory solvent used for various applications in scientific research and analysis. It is a clear, colorless liquid with a distinctive aromatic odor. Xylene's primary function is as a dehydrating agent and clearing agent in histological and microscopy sample preparation, where it is used to replace water and prepare samples for embedding in paraffin or resin.
Sourced in United States
The Protein Preparation Wizard is a laboratory tool designed to automate the process of preparing protein samples for analysis. It streamlines the various steps involved in protein preparation, including solubilization, purification, and buffer exchange, to ensure consistent and reliable results. The core function of the Protein Preparation Wizard is to simplify and standardize the protein preparation workflow, enabling researchers to focus on their core research objectives.
5-bromo-1-pentyne is a chemical compound used in various laboratory applications. It is a halogenated alkyne that can be used as a building block or a precursor in organic synthesis and other chemical reactions. The core function of this product is to serve as a versatile reagent for chemical transformations and modifications in a laboratory setting.
Sourced in United States, China, Germany, United Kingdom, Canada, Japan, France, Italy, Switzerland, Australia, Spain, Belgium, Denmark, Singapore, India, Netherlands, Sweden, New Zealand, Portugal, Poland, Lithuania, Hong Kong, Argentina, Ireland, Austria, Israel, Czechia, Cameroon, Taiwan, Province of China, Morocco
Lipofectamine 2000 is a cationic lipid-based transfection reagent designed for efficient and reliable delivery of nucleic acids, such as plasmid DNA and small interfering RNA (siRNA), into a wide range of eukaryotic cell types. It facilitates the formation of complexes between the nucleic acid and the lipid components, which can then be introduced into cells to enable gene expression or gene silencing studies.
Sourced in Japan, United States
The TOC-L is a Total Organic Carbon (TOC) analyzer designed for the measurement of organic carbon content in water samples. It provides accurate and reliable results, meeting the requirements of various regulatory standards.
More about "Catalysis"
Catalysis is a fundamental concept in chemistry that refers to the acceleration of a chemical reaction by a substance known as a catalyst.
Catalysts work by providing an alternative pathway with a lower activation energy, allowing the reaction to proceed more quickly and efficiently.
This process is crucial in numerous fields, including industrial processes, energy production, and the development of new materials.
Catalytic reactions play a vital role in the synthesis of pharmaceuticals, the production of fuels and chemicals, and the mitigation of environmental pollutants.
Understanding the mechanisms and optimization of catalytic processes is an active area of research, with advances in areas such as heterogeneous catalysis, biocatalysis, and computational modeling driving innovation in this important field.
Key subtopics in catalysis research include reaction kinetics, catalyst design and characterization, reaction optimization, and scale-up.
Commonly used tools and techniques in this field include Prism 6 for data analysis, GC-2014 for gas chromatography, GraphPad Prism 5 for statistical analysis, PyMOL for molecular visualization, Maestro for computational modeling, Xylene for organic synthesis, Protein Preparation Wizard for protein structure preparation, 5-bromo-1-pentyne as a common organic compound, and Lipofectamine 2000 for transfection experiments.
By leveraging these insights and tools, researchers can enhance the reproducibility and accuracy of their catalysis research workflow, leading to the development of more efficient and sustainable catalytic processes.
Whether you're working in the pharmaceutical, energy, or materials science industry, understanding the principles and applications of catalysis is crucial for driving innovation and addressing global challenges.
Catalysts work by providing an alternative pathway with a lower activation energy, allowing the reaction to proceed more quickly and efficiently.
This process is crucial in numerous fields, including industrial processes, energy production, and the development of new materials.
Catalytic reactions play a vital role in the synthesis of pharmaceuticals, the production of fuels and chemicals, and the mitigation of environmental pollutants.
Understanding the mechanisms and optimization of catalytic processes is an active area of research, with advances in areas such as heterogeneous catalysis, biocatalysis, and computational modeling driving innovation in this important field.
Key subtopics in catalysis research include reaction kinetics, catalyst design and characterization, reaction optimization, and scale-up.
Commonly used tools and techniques in this field include Prism 6 for data analysis, GC-2014 for gas chromatography, GraphPad Prism 5 for statistical analysis, PyMOL for molecular visualization, Maestro for computational modeling, Xylene for organic synthesis, Protein Preparation Wizard for protein structure preparation, 5-bromo-1-pentyne as a common organic compound, and Lipofectamine 2000 for transfection experiments.
By leveraging these insights and tools, researchers can enhance the reproducibility and accuracy of their catalysis research workflow, leading to the development of more efficient and sustainable catalytic processes.
Whether you're working in the pharmaceutical, energy, or materials science industry, understanding the principles and applications of catalysis is crucial for driving innovation and addressing global challenges.