Quasispecies

We used stored plasma samples (stored at −80°C) from HEV-infected patients consecutively tested for HEV RNA between 2005 and 2016 in the laboratory of Virology at Toulouse University Hospital, National Reference Center for HEV, where French laboratories can send samples for diagnosis and genotyping. These patients were acutely (HEV replication persisting for less than 3 months) or chronically HEV-infected (HEV replication persisting for more than 3 months). We selected 114 samples containing high HEV virus loads (>100,000 copies/ml) for PacBio SMRT sequencing. The HEV RNA concentrations were determined using a validated real-time polymerase chain reaction (Abravanel et al., 2012 (link)). This non-interventional study was supported by Toulouse University Hospital Center. The samples used were part of a collection identified by the French authorities (AC-2015-2518).
The positive control for PacBio SMRT sequencing was the strain VHP6 (passage 6 of TLS-09/M48 virus from the feces of an HEV-infected patient) cultured on HepG2/C3A cells (Lhomme et al., 2014 (link)), with two different human genome insertions in the PPR: a fragment of the L-arginine/glycine amidinotransferase (GATM) gene and a fragment of phosphatidylethanolamine binding protein 1 (PEBP1), each variant representing 50% of the quasispecies. Both were characterized by shot-gun deep sequencing (454 GS Junior system). Briefly, six overlapping amplicons were generated. For the library preparation, amplicons were nebulized according to 454 shotgun protocol (Roche/454-Life sciences) and the purified fragmented DNA was further processed according to 454 GS Junior Library construction protocol (Roche/454-Life sciences). The sequencing run was carried out on a Genome Sequencer Junior according to manufacturer instructions (Roche-454 LifeSciences). Data analysis was done with GS de Novo Assembler and GS Reference Mapper software.

The inference and cloning of T/F Envs and IMCs from SGA-derived viral sequences has been described (Figure S1) [10] (link), [12] (link), [13] (link), [25] (link), [37] (link). To ensure efficient expression of cloned subtype C Envs for pseudotyping, the sense primer used for amplification of the corresponding rev1-vpu-env cassette lacked the rev initiation codon (underlined) (5′-CACCGGCTTAGGCATCTCCTATAGCAGGAAGAA-3′) [39] (link).
Since chronic HIV-1 infections represent complex quasispecies of genetic variants, it is impossible to predict, based on sequence analysis alone, which members of this quasispecies are functional and which are defective or partially defective. To generate biologically relevant chronic controls, we thus targeted viral variants for both Env and IMC construction that exhibited evidence of a recent clonal expansion. Viral RNA was extracted from the plasma of chronically infected individuals and subjected to SGA and direct amplicon sequencing as described [12] (link), [13] (link), with the following modifications: 5′ half genome amplification: 1^st round sense primer 2010ForRC 5′- GTCTCTCTAGGTRGACCAGAT -3′, 1^st round antisense primer 2010Rev1C 5′- AAGCAGTTTTAGGYTGRCTTCCTGGATG -3′, 2^nd round sense primer 2010R1C 5′- TAGGTRGACCAGATYWGAGCC -3′ and 2^nd round antisense primer 2010Rev2C 5′- CTTCTTCCTGCCATAGGAAAT -3′; 3′ half genome: 1^st round sense primer 07For7 5′- CAAATTAYAAAAATTCAAAATTTTCGGGTTTATTACAG -3′, 1^st round antisense primer 2.R3.B6R 5′- TGAAGCACTCAAGGCAAGCTTTATTGAGGC-3′, 2^nd round sense primer VIF1 5′- GGGTTTATTACAGGGACAGCAGAG -3′ and 2^nd round antisense primer Low2C 5′- TGAGGCTTAAGCAGTGGGTTCC -3′. Thermal cycling conditions were identical to [13] (link) except that 60°C was used for primer annealing. Sequences were then aligned using ClustalW [81] (link) and subjected to phylogenetic analysis using PhyML [82] (link). Phylogenetic trees were inspected for clusters of closely related viruses, or “rakes”, which are indicative of a recent clonal expansion. (Figures 1, S2 and S3). In five subjects (Table 1), at least one env amplicon was identical in sequence to the inferred “rake” consensus and thus selected for cloning using the pcDNA3.1 Directional Topo Expression kit (Invitrogen). In two subjects, observable “rakes” were limited to only two closely related sequences, which encoded Env proteins that differed by a single amino acid. In these cases, the amplicon that matched the within patient consensus at this ambiguous site was cloned. In the remaining six subjects, the consensus sequences of the clonal expansion “rakes” were chemically synthesized and cloned (designated .synR1 in Table 1). IMCs from chronically infected subjects (CH256, CH432, CH457, and CH534) were generated using the same approach. 3′ and 5′ half-genome SGA was performed using viral RNA from subjects with evidence of clonal expansion as determined by env sequencing. 3′ and 5′ half genome sequences were used to construct neighbor joining trees (Figure S3), and clusters of closely related sequences were selected for further analysis. A consensus sequence of the members of such “rakes” was generated using Consensus Maker (hiv.lanl.gov). 3′ and 5′ half genome sequences were confirmed to be identical in their 1,040 bp overlapping regions, chemically synthesized in fragments bordered by unique restriction enzymes, and ligated together to construct infectious proviral clones.

All analyses were performed using R software (version 4.0.1) [57 ].
The data obtained from host acceptability bioassays were analyzed using a generalized linear model (GLM) with quasi-Poisson distribution considering parasitoid species and host infection status as fixed factors. Data from the host suitability (parasitoid and fly emergence as well as parasitoid mortality) bioassay and the parasitoid progeny fitness trait (sex ratio, developmental time, body size, fecundity, and longevity) bioassay were analyzed separately for each parasitoid species. Since they were collected from the same batch of host fly lines, parasitoid and fly emergence, as well as parasitoid mortality data, were analyzed using multivariate analysis of variance (MANOVA), with host infection status as a fixed factor. In cases in which a significant effect of host infection status was detected, a univariate one-way analysis of variance (ANOVA) was conducted to check for significant differences within the response variables (parasitoid emergence, fly emergence, and parasitoid death), and this was followed by Student–Neuman–Keuls (SNK) post hoc multiple comparisons tests.
The sex ratios of D. longicaudata and F. arisanus F1 progeny were analyzed using a GLM with a binomial error distribution, considering host infection status as a fixed factor. Parasitoid progeny developmental time was analyzed using a GLM assuming a Gamma error distribution with host infection status as a fixed factor. Parasitoid progeny body size (hind tibia length) was analyzed using a linear mixed-effect model from the ‘lme4’ package (version 1.1.27.1) [58 (link)], considering host infection status and the sex of the parasitoid progeny as fixed and random factors, respectively. A generalized, linear mixed-effect model (using the ‘glmer’ function from the ‘lme4’ package [58 (link)]), with a Gamma error distribution, was fitted to analyze the fecundity of the female parasitoid progeny of F. arisanus and D. longicaudata, considering host infection status and replicate population as fixed and random factors, respectively. A Cox proportional hazards model using the “coxme” function from the “survival” package (version 3.2.13) [59 ] was fitted to determine the effect of bacterial symbionts on the longevity of the F1 progeny of both parasitoid species. In the model, both host infection status and replicate population were included as fixed and random factors, respectively. The significance of all these models was determined using analysis of deviance with chi-square tests, and mean separation was determined using Tukey’s multiple comparison tests at α ≤ 0.05.

The viral quasi-species inferred from the NGS runs were used to analyze the distribution and evolution of the intrahost diversity. Among the individuals sampled, two consecutive quasi-species were available for five of them. For every viral quasi-species, the nucleotide frequencies per position obtained in the fourth step of the NGS procedure described in section 2.3 were summarized. The analyses focused on positions with high diversity, arbitrarily defined as those where the frequencies of the mutations present were larger than 10%. Finally, the positions identified were located within the genome.

To facilitate comparisons between CHB-derived consensus sequences and to identify the most genetically similar consensus to the HBV quasispecies of each sample, we estimated the Mash distance between each consensus and the subsampled HBV sequencing data which aligned to the best performing reference (linear or graph-based) for each sample. We also performed de novo HBV strain-level assembly using SAVAGE and VG-Flow to identify the viral haplotypes comprising each CHB infection.^{69 (link),70 (link)} For each sample, the best-performing linear reference was added to the SAVAGE output for VG-Flow to improve strain-level contiguity and assembly. The set of sample-specific viral haplotypes with frequencies >1% were included in all pairwise genetic distance comparisons. The consensus sequence with the lowest estimated genetic distance with the HBV-specific high throughput sequencing data can be inferred to be the most accurate and genetically representative consensus sequence for each sample.