Spermatogenesis

Twenty male white mice, aged 16 months and 20-23g
in weight were purchased from Iran Pasteur Institute
and housed in a temperature-controlled room at 23 ±
2℃. Animals had access to food and water. They were
cared for in accordance with the Principals and Guidelines
of the Research Center at Tehran University of
Medical Sciences. Mice were randomly divided into
control and experimental groups with 10 animals per
group. The experimental group received intraperitoneal
injections of a daily single dose of 10 mg/kg melatonin (Sigma Chemical Co., USA) dissolved in saline for 14
days. The control group received only saline. Six days
after the last injection all mice were sacrificed under
ether anesthesia and the testes were excised, cut into
small pieces and fixed in 10% formalin. Next, testes
were dehydrated in an alcohol series, cleared in xylene,
infiltrated with paraffin and embedded in paraffin. Paraffin
blocks were cut into 5 µ thick sections and stained
with hematoxylin and eosin. About 30 sections of seminiferous
tubules that were round or nearly round were
chosen randomly and measured for each group. The
tubular diameter and height of the seminiferous tubule
epithelium was measured at ×200 and ×400 magnifications
using image analyzer Leica (DMLB) and
Leica Qwin software. The diameter of the seminiferous
tubule was measured across the minor and major
axes, and the mean diameter obtained. We measured
testicular interstitial and epithelium by the point counting
method (10 (link), 11 (link)). Testis tubules were evaluated for
their modified spermatogenesis index (SI) by Johnson’s
score (12 (link)). In Johnson’s score a grade from 1 to
10 was given to each tubule cross section according to
the range from no cells to complete spermatogenesis.

Isolated cells: Enzymatically isolated testicular cells and developed cells from in-vitro cultures were mixed with 250 μL of lysis buffer and 2-mercaptoethanol mixture (GenElute Total RNA Miniprep Kit; Sigma, St. Louis, USA). The lysates were frozen at −80 °C for later RNA extraction. The cDNA synthesis was performed according to the qScript cDNA Synthesis Kit (Quantabio, Beverly, MA 01915, USA), using random hexamers, and qPCR was performed using specific primers for each examined spermatogenesis marker: gfr-α (forward:CAGTTTTCGTCTGCTGAGGTTG; reverse: TTCTGCTCAAAGTGGCTCCAT; product size, 141 bp), VASA (forward: AGTATTCATGGTGATCGGGAGCAG; reverse: GCAACAAGAACTGGGCACTTTCCA; product size, 83 bp), CREM-1 (forward:TTCTTTCACGAAGACCCTCA; reverse: TGTTAGGTGGTGTCCCTTCT; product size, 138 bp), BOULE (forward: AACCCAACAAGTGGCCCAAGATAC; reverse: CTTTGGACACTCCAGCTCTGTCAT; product size, 163 bp), protamine (forward: TCCATCAAAACTCCTGCGTGA; reverse: AGGTGGCATTGTTCCTTAGCA; product size, 114 bp), ACROSIN (forward: TGTCCGTGGTTGCCAAGGATAACA; reverse: AATCCGGGTACCTGCTTGTGAGTT; product size, 149 bp), and the calibrator gene GAPDH (forward: ACCACAGTCCATGCCATCAC; reverse: CACCACCCTGTTGCTGTAGCC; product size, 450 bp). The qPCR reaction was performed following the 2 × qPCRBIO SyGreen Blue Mix Hi-ROX (PCR Biosystems Ltd., Aztec House, 397–405 Archway Road, London, UK) protocol and was performed using the LightCycler 96 real-time PCR machine (Roche, Roche Diagnostics Corporation, Roche CustomBiotech, Indianapolis, IN, USA). According to the manufacturer introductions for the SYBR Green dye, we ran a PCR profile including a three-step amplification program and subsequent melting, described as follows: preincubation 10 min at 95 °C, 40 cycles of 15 s at 95 °C, 15 s at 60 °C (all the primers were designed with this specific annealing temperature), and 10 s at 72 °C. Melting cycle: 10 s at 95 °C, 60 s at 65 °C, and 1 s at 97 °C. The PCR products were identified and distinguished using the generated melting curve. The “threshold cycle” (Ct) values, representing the cycle number at which the sample fluorescence rises statistically above the background and crossing points (CP) for each transcript were defined. The relative quantity of the gene expression was analyzed using the 2^−ΔΔCt method. The results were expressed as the fold of increase related to the GAPDH of the same examined sample.
The microscopy samples were observed with an Olympus IX70 microscope (Olympus, Novato, CA, USA). The digital images and signal intensity charts were prepared using Image-Pro Plus (Media Cybernetics, Bethesda, MD, USA), Microsoft Excel, and Adobe Photoshop 7.0 software.

PAS staining was used for spermatogenic staging and evaluation of the development of seminiferous tubules. Fresh mice testicular tissues were fixed with modified Davidson’s fluid fixation fluid at room temperature for 48 hr, embedded with paraffin, and sliced into sections. Slides were then dewaxed with xylene at 37°C for 30 min, rehydrated by descending concentrations of ethanol, dyed with PAS (Solarbio, Beijing, China) and hematoxylin in sequence, dehydrated with ascending concentrations of ethanol, and sealed with neutral balsam for observation. Images were taken with a Zeiss Axio Skop plus2 microscope (ZEISS, Oberkochen, Germany).

The sections were evaluated according to the following morphological criteria [14 (link)]:

Absence of seminiferous tubules (tubular sclerosis);

Absence of germ cells (Sertoli cell only syndrome);

Maturation arrest – spermatogenesis arrested at different stages (spermatogonia, spermatocytes, or spermatids);

Hypospermatogenesis – all cell types up to spermatozoa are present, but there is a distinct decline in reproducing spermatogonia;

Mixed atrophy can be global (present in all tubules) or focal, with a variable percentage of tubules displaying various stages of qualitatively and quantitatively limited spermatogenesis.

Spermatogenesis was assessed using Johnsen's score. The Johnsen criteria convert the cell profile found along the seminiferous tubules into a ten-point score system for assessing spermatogenesis. Johnsen scores range from 1 to 10, with 1 representing the complete absence of germ cells and 10 representing maximum spermatogenesis activity.