> Physiology > Cell Function > Transport, Nucleocytoplasmic

Uniport →

Transport, Nucleocytoplasmic

Transport and nucleocytoplasmic processes are essential for cellular function and communication.
Nucleocytoplasmic transport involves the movement of molecules, such as proteins and RNA, between the nucleus and cytoplasm, regulating gene expression and cellular signaling.
Transport mechanisms, including diffusion, active transport, and vesicular trafficking, facilitate the movement of substances across membranes and between cellular compartments.
Disruptions in these transport pathways can lead to various disease states.
Reasearchers studying transport and nucleocytoplasmic processes can leverage PubComapre.ai's AI-driven protocol optimization to streamline their research and find the optimal solutions for their work, revolutionizing their approach to this critical area of biology.

Most cited protocols related to «Transport, Nucleocytoplasmic»

Efficient Gene Editing in Primary Human T Cells

Cited 19 times

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2016

BLOOD Buffers CD4 Positive T Lymphocytes Cells Centrifugation Clustered Regularly Interspaced Short Palindromic Repeats CRISPR-Associated Protein 9 crRNA, Transactivating Electroporation Ficoll Genes Glycerin HEPES Homo sapiens Infection Muromonab-CD3 Nuclear Localization Signals phosphine Potassium Chloride Proteins Recombinant Proteins RNA, CRISPR Guide Stem Cells T-Lymphocyte Tissue, Membrane Transport, Nucleocytoplasmic tris(2-carboxyethyl)phosphine Tromethamine

SABRE-SHEATH Hyperpolarization of 15N-Labeled Compounds

Cited 7 times

The circuit (Figure 2a) employs 120–240 VAC power mains as a source of alternating current. Three thermistors (9 Ω each) are placed in parallel to boost the current carrying capacity of the circuit during the charging phase. When the switch is activated, the “charging” phase is initiated. During this phase, the current increases causing the thermistors to warm up, thus resulting in an increase of their resistance by ~4–5 orders of magnitude. As a result, in a few hundred milliseconds, the current begins to decay adiabatically due to increasing resistance of the thermistors. The current decay is completed in less than 2 seconds, i.e. the thermistors ensure the mains power is no longer supplied after this relatively short period of time. In practice, we employed a push-button switch, which is un-pressed after approximately 1 second. A diode is added in series with resistors to ensure the flow of power from the mains to the degaussing inductor is unidirectional. The diode output is connected to capacitor (470 μF) and degaussing inductor, see Figure 2. In practice, we have successfully tested a wide range of degaussing inductors made in house (40.4 mH) and also supplied by the vendor for the following shields ZG-203 (4.8 mH), ZG-206 (18.1 mH), ZG-209 (105.8 mH), Magnetic Shield Corp., Bensenville, IL USA. We have also added a LED indicator to inform the user that the circuit was truly energized (light ON) and that the process was completed (dimming light). An ~0.7 kΩ resistor is added in series to protect the LED and to also modulate the decay rate of the electromagnetic field in the LC circuit. The complete list of part numbers, manufacturers’, vendors’ information, and technical drawings can be found in Supporting Information (SI). The cost of construction was $73 – note that some components were purchased in bulk.
¹⁵N SABRE-SHEATH experiments were performed as described previously.^{[43 –45 (link)]} Briefly, Ir-IMes pre-catalyst^{[46 (link)]} and [¹⁵N₃]metronidazole were dissolved in CD₃OD. The prepared 0.6 mL solution contained approximately 2 mM pre-catalyst and 40 mM [¹⁵N₃]metronidazole. The solution was placed in an economy 5 mm NMR tube jacketed with 0.25 in. (~6.35 mm) OD Teflon extension. The solution was then purged with ultra-high purity argon gas for approximately 2 minutes before connecting it to our p-H₂ bubbling setup via Teflon extension described in Figure 3 and Figure S1. Once the tube was connected to the manifold, the catalyst was activated for approximately 1 h using 20 standard cubic centimetres per minute (sccm) flow rate of p-H₂ (~98%^{[47 (link)]}) at 100 PSI (~690 kPa) overpressure. After catalyst activation, the formation of the polarization transfer complex (PTC) allows for efficient polarization transfer of nuclear spin polarization from p-H₂-derived hydrides to ¹⁵N nuclei in [¹⁵N₃]metronidazole. The details of spin-relayed polarization transfer to all three ¹⁵N sites are thoroughly reviewed elsewhere.^{[43 –45 (link)]} For SABRE-SHEATH hyperpolarization, we have employed 70 sccm flow rate for p-H2 bubbling and ZG-203 shield equipped with degaussing solenoid coil. The coil was connected to the degaussing circuit shown in Figure 2, and degaussing was performed using 120 VAC mains. The degaussing circuit was then disconnected and the RF solenoid coil was connected to 5 VDC power supply and current attenuation resistor bank. A residual field of less than 20 nT was measured repeatedly by a three-axis fluxgate magnetometer (Bartington Instruments, Oxford, U.K.) with 10 nT resolution.
For ¹⁵N SABRE-SHEATH experiments, p-H₂ was bubbled in the shield at B_LAC (created by the RF solenoid inside the shield) for ~1 min at room temperature, 70 sccm and 100 PSI (690 kPa) overpressure. Next, p-H₂ flow was ceased via opening the bypass valve, and the sample was quickly transferred for ¹⁵N detection in 1.4 T bench-top NMR spectrometer (Nanalysis, Canada). The total delay from p-H₂ cessation to ¹⁵N NMR acquisition was less than 5 seconds. ¹⁵N signal enhancement and polarization levels were computed by employing external signal reference (12.4 M [¹⁵N]pyridine, Figure 4b) as described in detail previously.^{[43 ]}

Joalland B., Nantogma S., Chowdhury M.R., Nikolaou P, & Chekmenev E.Y. (2021). Magnetic Shielding of Parahydrogen Hyperpolarization Experiments for the Masses. Magnetic resonance in chemistry : MRC, 59(12), 1180-1186.

Publication 2021

Argon Cell Nucleus Cuboid Bone Dietary Fiber Electromagnetic Fields Epistropheus Light Metronidazole Neoplasm Metastasis Pyridines Teflon Transport, Nucleocytoplasmic

Engineered Retroviral and Lentiviral Vectors

Cited 6 times

All retroviral constructs were based on a modified SFG-ECT2-luc SIN-vector (Lindemann et al, 1997 (link)). Modifications of this backbone include: (i) Removal of the MuLV pol/env region harboring the native splice acceptor (SA); (ii) introduction of FLP-recombinase recognition sites (FRT) into the Bgl II (Fn) or BspEI (F5) site of SFG-ECT2-Luc vector as double stranded oligonucleotides, that will allow retargeting of the tagged locus (Seibler and Bode, 1997 (link)). Given here is only the sense-strand for Fn: 5′-GATCCGAAGTTCCTATTCCGAAGTTCCTATTCTTCAAAAGGTATAGGAACTTCAGATC, and F5: 5′-GGATCCGAAGTTCCTATTCCGAAGTTCCTATTCTTCAAAAGGTATAGGAACTTCAGATCTAAGCTTTTCCATGG; (iii) introduction of a modified SV40 late polyadenylation signal (pA) to precisely terminate the antisense orientated transcription. The modifications belong to the SV40 pA-early signals on the opposite strand that were eliminated by point mutations; (iv) the constitutive transport element (cte) of simian retro virus-1 (SRV-1) for optimization of the nucleo/cytoplasmic transport process of unspliced transcripts (Saavedra et al, 1997 (link)). The resulting vector was termed S2f-(lMCg), we occasionally refer to as the “standard vector” (Figure 1C).
The restriction sites of all Tet system components were adjusted via PCR, cloned into pBluescript SK II+ vector (Stratagene) and verified by sequencing. Tet operators, minimal promoters (Figure 1A and 1B) and reporter genes were sub-cloned into pUHR plasmid backbones providing a suitable multiple cloning site for the construction of bidirectional expression cassettes prior to their transfer to the retroviral vectors.
The MuLV backbone variants S2 and S2s (Figure 1D) were obtained by insertion of a suitable polylinker into the BglII and BamHI sites of the SFG-ECT2 Luc vector, thereby removing the viral pol/env fragment together with the luciferase open reading frame. For construction of the S2-backbone the pA/cte-element was inserted into the BglII site of the SFG-intermediate. The S2s backbone was constructed by re-insertion of the MuLV pol/env fragment as 5′-BamHI/BglII-3′ fragment into the BglII digested SFG-intermediate, thereby retaining the BglII restriction site into which the pA/cte-element was inserted as 5′-BclI/BglII-3′ fragment. The final vectors S2-lMCg and S2s-lMCg were obtained after insertion of the bidirectional response unit containing P_tetbi-3, released as BamHI/NotI fragment from the standard vector.
For construction of the lentiviral SIN-vector the WPRE-element was removed from the parental plasmid (pRRL.sin.ppt.hPGK.EGFP.pre; Follenzi et al, 2000 (link)). The remaining vector obtained the pA/cte-element as XhoI/BamHI fragment and subsequently the bi-directional response unit as 5′-BamHI/blunt-3′ fragment, resulting in the HS-(lMCg) lentiviral SIN-vector. Detailed sequence information of the constructs shown in Figure 1 will be supplied upon request.

Loew R., Vigna E., Lindemann D., Naldini L, & Bujard H. (2006). Retroviral vectors containing Tet-controlled bidirectional transcription units for simultaneous regulation of two gene activities. Journal of molecular and genetic medicine : an international journal of biomedical research, 2(1), 107-118.

Publication 2006

Cloning Vectors FLP recombinase Genes, Reporter Luciferases Murine Leukemia Virus Oligonucleotides Parent Plasmids Point Mutation Polyadenylation Retroviridae RNA Polymerase I Simian virus 40 Surgical Replantation Transcription, Genetic Transport, Nucleocytoplasmic Vertebral Column Viral Components

Porcine Oocyte Maturation for Nuclear Transfer

Cited 5 times

In vitro-matured porcine oocytes were used as nuclear transfer recipients and prepared according to methods described previously (Liu et al. 2014 (link); Zhu et al. 2016 (link)). Briefly, cumulus-oocyte complexes (COCs) were aspirated from the follicles with sizes of 3–8 mm, and washed twice in PVA-TL-HEPES medium. The COCs were transferred into 200 µL drops of preheated maturation medium (bicarbonate-buffered TCM-199 supplemented with 0.1 % [w/v] polyvinyl alcohol [PVA], 3.05 mM d-glucose, 0.91 mM sodium pyruvate, 0.57 mM cysteine, 10 ng/mL epidermal growth factor [EGF], 0.5 µg/mL follicle-stimulating hormone [FSH], 0.5 µg/mL luteinizing hormone [LH], 0.0750 g/L penicillin G, 0.0500 g/L streptomycin and 10 % [v/v] porcine follicular fluid [PFF]; pH = 7.3), covered with mineral oil, and then incubated for 20–22 h at 38.5 °C in a Forma Series II water jacketed incubator (Thermo Scientific, Marietta, OH, USA) with humidified atmosphere of 5 % (v/v) CO₂ in air. Then, the COCs were cultured for an additional 20 h in the same medium without the gonadotropins. Following maturation, expanded cumulus cells were removed from the oocytes by vigorous pipetting in the presence of 0.1 % (w/v) hyaluronidase. Oocytes with an evenly granulated ooplasm and an extruded first polar body were selected and placed into the micromanipulation medium drop (containing donor cells and 7.5 µg/mL cytochalasin B) on a 60-mm cell culture dish (NUNC) covered with mineral oil for using as nuclear transfer recipients.

Nie J.Y., Zhu X.X., Xie B.K., Nong S.Q., Ma Q.Y., Xu H.Y., Yang X.G., Lu Y.Q., Lu K.H., Liao Y.Y, & Lu S.S. (2016). Successful cloning of an adult breeding boar from the novel Chinese Guike No. 1 swine specialized strain. 3 Biotech, 6(2), 218.

Publication 2016

Atmosphere Bicarbonates Cell Culture Techniques Cells Cumulus Cells Cysteine Cytochalasin B Epidermal growth factor Follicular Fluid Glucose Gonadotropins Hair Follicle HEPES Human Follicle Stimulating Hormone Hyaluronidase Hyperostosis, Diffuse Idiopathic Skeletal Luteinizing hormone Micromanipulation Oil, Mineral Oocytes Penicillin G Pigs Polar Bodies Polyvinyl Alcohol Pyruvate Sodium Streptomycin Tissue Donors Transport, Nucleocytoplasmic

Axoplasm Extraction for Biochemical Analysis

Cited 4 times

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2015

Axon Buffers Cells Centrifugation Detergents Lanugo Mass Spectrometry Mus Nervousness Neuroglia Nonidet P-40 Proteins Sciatic Nerve Transport, Nucleocytoplasmic Western Blot

Most recents protocols related to «Transport, Nucleocytoplasmic»

Transfection and Nuclear Transport Assay

TW01-EBV or HeLa cells were transfected with Lipofectamine 2000 (LF 2000; Invitrogen Co.) following the manufacturer’s instructions. Plasmids were transfected with Lipofectamine 2000 at a plasmid DNA (μg)Lipofectamine (μL) ratio of 2:3. The medium was refreshed at 6 h posttransfection, and the cells were incubated at 37°C with 5% CO₂ for the indicated time. For rM81 virus production, 293/rM81 cells were transfected with TransIT-LT1 at a plasmid (μg)/TransIT-LT1 (μL) ratio of 1:3. The medium was refreshed at 16 hpt, and the cells were incubated at 37°C with 5% CO₂ for the indicated time.
In the analysis of importin-β-mediated nuclear transport, 2 × 10⁶ HeLa cells were seeded onto silane coating microslides (no. SM5116, Muto Pure Chemicals Co., Ltd.) in 10-cm petri dishes and incubated for 24 h before transfection. Cells were transfected with 10 μg pEYFP-LacZ-serial plasmids by using TransIT-LT1 (Mirus Bio) according to the manufacture’s instructions. Then, 6 h posttransfection, culture medium was replaced by fresh 10% fetal bovine serum (FBS)-DMEM with or without IPZ, and the cells were incubated for another 18 h. Cells on slides were then fixed with 4% paraformaldehyde-PBS at room temperature (RT) for 20 min, washed with PBS 3 times, and subjected to immunofluorescence analysis.

Chao T.Y., Cheng Y.Y., Wang Z.Y., Fang T.F., Chang Y.R., Fuh C.S., Su M.T., Su Y.W., Hsu P.H., Su Y.C., Chang Y.C., Lee T.Y., Chou W.H., Middeldorp J.M., Saraste J, & Chen M.R. (2023). Subcellular Distribution of BALF2 and the Role of Rab1 in the Formation of Epstein-Barr Virus Cytoplasmic Assembly Compartment and Virion Release. Microbiology Spectrum, 11(1), e04369-22.

Publication 2023

Cells Culture Media Fetal Bovine Serum HeLa Cells Hyperostosis, Diffuse Idiopathic Skeletal Immunofluorescence Importins LacZ Genes Lipofectamine lipofectamine 2000 paraform Plasmids Silanes Transfection Transport, Nucleocytoplasmic Virus

Analysis of Organelle Genome Transfers

Blastn v2.11.0 + [63 (link)] was used to identify transfer events from organelles to the nuclear genome with the filter parameter ‘identity greater than 80% and alignment length greater than 100 bp’. These results were further divided into two datasets: 80–89% and 90–100% similarity to a known organelle sequence to represent older (more mutations) and newer (fewer mutations) transfers respectively. In addition, each dataset was further divided into different length categories of 100–199 bp, 200–299 bp, 300–399 bp, 400–499 bp, 500–599 bp, 600–699 bp, 700–799 bp, 800–899 bp, 900–999 bp, and 1000 bp and above. BEDtools v2.30.0 [71 (link)] was used to annotate organelle transfer locations in the nuclear genome and their distribution patterns in different chromosomes and genomic regions (i.e. exon, intron, intergenic, mRNA) based on the annotation file of the nuclear genome. The transfer fragment and the 5’ and 3’ flanking sequences (100–499 bp, 500–1000 bp, and above 1000 bp) were extracted and calculated for GC content. The program ggplot2 v3.3.6 [72 (link)] was used for visualization.

Zhang S., Wang J., He W., Kan S., Liao X., Jordan D.R., Mace E.S., Tao Y., Cruickshank A.W., Klein R., Yuan D., Tembrock L.R, & Wu Z. (2023). Variation in mitogenome structural conformation in wild and cultivated lineages of sorghum corresponds with domestication history and plastome evolution. BMC Plant Biology, 23, 91.

Publication 2023

3' Flanking Region BP 100 Chromosomes Exons Genome Introns Mutation Organelles RNA, Messenger Transport, Nucleocytoplasmic

Aging and Inflammatory Response in Cattle

This study is part of a wide project deciphering the role of ageing on the response to inflammation in cattle, and more especially the methylation of the genome according to age and inflammation status (not reported here). The present study was grafted onto the same experimental design. All cows were generated by nuclear transfer using cultured ear explant-derived fibroblasts as previously described^{30 ,31}. As somatic cloning can be performed using nuclei from frozen fibroblasts, it makes possible to generate individuals for more than 15 years using the original cell culture. Thus, the initial sample comprised 14 Holstein cows with the same genetic background: 6 cows aged 10–15 years (body weight: 693.5 ± 87.3 kg, referred to as ‘old cows’) and 8 cows aged 6 years (678.2 ± 37.9 kg, referred to as ‘young cows’).
The cows were housed in a loose-stall deep-bedded barn at the INRAE Experimental Facility at Bressonvilliers, France. The cows had been raised together since birth. The two groups, i.e. old and young cows, were housed in two face-to-face pens. The 8 ‘young’ cows were housed together with 9 contemporary (i.e. same-age, same-breed) non-cloned cows in a 18 × 28 m pen. No measurements were performed on contemporary cows. The 6 ‘old’ cows were housed in a 15.4 × 32 m pen. All cows in each pen had been together for more than 10 months before the start of the study. They were fed a corn silage, soybean meal and concentrate ration designed to meet the dietary requirements for dry cows. Feed was given once a day at 10:00 a.m. The mixed ration was pushed back toward the cows three times a day (at 2:30 p.m., and 8:30 p.m. then at around 7:30 a.m). Water was provided ad libitum.
To avoid oestrus behaviour, the study was carried out during the cows’ luteal phase. At 27 days before challenge, the cows were submitted to an ovulation synchronization protocol using a Norgestomet ear implant for 10 days simultaneously with intramuscular injections of 10 µg buserelin at the start (CRESTAR PACK, Intervet, Beaucouzé, France), then 0.5 mg prostaglandin (ESTRUMATE, Intervet, Beaucouzé, France) 8 days later, and 400 UI of eCG (SYNCRO-PART PMSG 400 UI BOVINS-OVINS-CAPRINS, Ceva Santé Animale, Libourne, France) on the day of ear-implant removal. Effective ovulation was checked at 7 days after the end of the synchronization protocol by palpation of corpus luteum. All cows had a visible corpus luteum, showing similar ovarian activity between the young and old groups.

Ledoux D., Veissier I., Meunier B., Gelin V., Richard C., Kiefer H., Jammes H., Foucras G, & de Boyer des Roches A. (2023). Combining accelerometers and direct visual observations to detect sickness and pain in cows of different ages submitted to systemic inflammation. Scientific Reports, 13, 1977.

Publication 2023

Birth Body Weight Buserelin Cattle Cell Culture Techniques Cell Nucleus Corns Corpus Luteum Dietary Requirements Diploid Cell Estrumate Estrus Face Fibroblasts Freezing Genetic Background Genome Holstein Cow Inflammation Intramuscular Injection Luteal Phase Methylation norgestomet Ovary Ovulation Palpation Prostaglandins Silage Soybean Flour Transport, Nucleocytoplasmic

Saluki Skin Cells for Nuclear Transfer

To obtain cells for nuclear transfer; a skin biopsy was obtained from a living Saluki. These clones would later be used as a syngeneic control for UDC SCNT. After mechanical and enzymatic dissociation of the tissue (Hossein, 2009 #2), cells were allowed to attach to a culture dish (Product No. 353002, Falcon^®, Corning) in Dulbecco modified Eagle medium (Cat. #11995065, DMEM high glucose pyruvate, GibcoTM) with 10% fetal bovine serum (Cat. #16000044, FBS, GibcoTM) at 37 °C in an atmosphere of 5% CO2 and air. Media was changed every 48 hrs until the cellular monolayer reached approximately 80% confluence. UDCs used in the cloning experiments were obtained, as described above (UDCs), from two cloned saluki pups of the same donor origin. Both explants and UDCs were cultured until they approached 90% confluence, trypsinized and reconstituted at concentrations of approximately 1 x 10⁶ cells per mL, then cryopreserved in cryovials containing DMEM + 20% FBS +10% DMSO. Prior to cryopreservation cells were taken in the same manner to be used as donor cells for SCNT. After cell populations reached near confluence, cells were used for SCNT (Nuclear Transfer).

Olsson P.O., Yeonwoo J., Park K., Yoo Y.M, & Hwang W.S. (2023). Live births from urine derived cells. PLOS ONE, 18(1), e0278607.

Publication 2023

Atmosphere Biopsy Cells Cryopreservation Eagle Enzymes Glucose Hyperostosis, Diffuse Idiopathic Skeletal Population Group Pyruvate Reproduction sarcoursodeoxycholic acid Skin Sulfoxide, Dimethyl Tissue Donors Tissues Transport, Nucleocytoplasmic

Investigating Mouse Embryo Development

Sperm were collected from the epididymis of 8- to 9-month-old male ICR mice and capacitated in EmbryoMax Human Tubal Fluid (HTF, Merck Millipore) for 40 minutes at 37°C and 5% CO₂. The oocyte-cumulus complexes were collected from superovulated 5- to 6-week-old or 7- to 8-week-old female mice and placed in HTF at 37°C in an atmosphere of 5% CO₂. An appropriate amount of capacitated sperm was added into the HTF liquid drops, which contained oocyte-cumulus complexes. After 6 hours, mouse zygotes were microinjected with siRNA or cRNA. siRNAs and cRNAs were as follows: Rsl1d1 siRNA (siRsl1d1, 5′–CCUCAGAUGUAUGUCUCUUTT–3′, 40 μM); synonymous mutated Rsl1d1 cRNA (1,000 ng/μL); cRNA of mClover3-RSL1D1 (1,000 ng/μL) and H₂B-mcherry (1,000 ng/μL); human KPNA7 cRNA (3,000 ng/μL); mouse Kpna7 cRNA (3,000 ng/μL); human KPNA2 cRNA (1,000 ng/μL); and mouse Kpna2 cRNA (1,000 ng/μL). After injection, zygotes were transferred to KSOM medium (Nanjing Aibei Biotechnology) for culture. Embryos were assessed at 24 hours, 48 hours, 60 hours, 72 hours, and 108 hours after fertilization. Fluorescence was observed 3 hours after injection for the RSL1D1 nuclear transport assays.

Wang W., Miyamoto Y., Chen B., Shi J., Diao F., Zheng W., Li Q., Yu L., Li L., Xu Y., Wu L., Mao X., Fu J., Li B., Yan Z., Shi R., Xue X., Mu J., Zhang Z., Wu T., Zhao L., Wang W., Zhou Z., Dong J., Li Q., Jin L., He L., Sun X., Lin G., Kuang Y., Wang L, & Sang Q. (2023). Karyopherin α deficiency contributes to human preimplantation embryo arrest. The Journal of Clinical Investigation, 133(2), e159951.

Publication 2023

Atmosphere Biological Assay Complementary RNA Embryo Epididymis Females Fertilization Fluorescence Homo sapiens KPNA2 protein, human Males Mice, Inbred ICR Mice, Laboratory Oocytes RNA, Small Interfering Sperm Transport, Nucleocytoplasmic Zygote

Top products related to «Transport, Nucleocytoplasmic»

Fetal bovine serum (fbs) by Thermo Fisher Scientific

Sourced in United States, China, United Kingdom, Germany, Australia, Japan, Canada, Italy, France, Switzerland, New Zealand, Brazil, Belgium, India, Spain, Israel, Austria, Poland, Ireland, Sweden, Macao, Netherlands, Denmark, Cameroon, Singapore, Portugal, Argentina, Holy See (Vatican City State), Morocco, Uruguay, Mexico, Thailand, Sao Tome and Principe, Hungary, Panama, Hong Kong, Norway, United Arab Emirates, Czechia, Russian Federation, Chile, Moldova, Republic of, Gabon, Palestine, State of, Saudi Arabia, Senegal

Fetal Bovine Serum (FBS) is a cell culture supplement derived from the blood of bovine fetuses. FBS provides a source of proteins, growth factors, and other components that support the growth and maintenance of various cell types in in vitro cell culture applications.

Dulbecco modified eagle medium (dmem) by Thermo Fisher Scientific

Sourced in United States, China, United Kingdom, Germany, France, Australia, Canada, Japan, Italy, Switzerland, Belgium, Austria, Spain, Israel, New Zealand, Ireland, Denmark, India, Poland, Sweden, Argentina, Netherlands, Brazil, Macao, Singapore, Sao Tome and Principe, Cameroon, Hong Kong, Portugal, Morocco, Hungary, Finland, Puerto Rico, Holy See (Vatican City State), Gabon, Bulgaria, Norway, Jamaica

DMEM (Dulbecco's Modified Eagle's Medium) is a cell culture medium formulated to support the growth and maintenance of a variety of cell types, including mammalian cells. It provides essential nutrients, amino acids, vitamins, and other components necessary for cell proliferation and survival in an in vitro environment.

Tryple select by Thermo Fisher Scientific

Sourced in United States, Japan, United Kingdom, Germany, Switzerland, Canada

TrypLE Select is a recombinant trypsin-like protease used for the dissociation and detachment of adherent cells in cell culture applications. It is a ready-to-use, serum-free, and animal-component-free solution that effectively enzymatically disaggregates cells without the need for additional supplementation.

Primescript rt reagent kit by Takara Bio

Sourced in Japan, China, United States, France, Germany, Switzerland, Canada, Sweden, Italy, Puerto Rico, Singapore

The PrimeScript RT reagent kit is a reverse transcription kit designed for the synthesis of first-strand cDNA from RNA templates. The kit includes RNase-free reagents and enzymes necessary for the reverse transcription process.

Dulbecco modified eagle medium (dmem) by Merck Group

Sourced in United States, Germany, United Kingdom, Italy, Japan, China, Sao Tome and Principe, France, Macao, Canada, Switzerland, Spain, Australia, Austria, Poland, India, Hungary, Israel, Brazil, Ireland, Czechia, Denmark, Sweden, Argentina, Finland, Cameroon

DMEM (Dulbecco's Modified Eagle's Medium) is a commonly used cell culture medium formulated to support the growth and maintenance of various cell lines. It provides a balanced salt solution and essential nutrients required for cell proliferation. DMEM is suitable for use in a wide range of cell culture applications.

Dmem f12 by Thermo Fisher Scientific

Sourced in United States, United Kingdom, Germany, China, France, Japan, Canada, Australia, Italy, Switzerland, Belgium, New Zealand, Spain, Denmark, Israel, Macao, Ireland, Netherlands, Austria, Hungary, Holy See (Vatican City State), Sweden, Brazil, Argentina, India, Poland, Morocco, Czechia

DMEM/F12 is a cell culture medium developed by Thermo Fisher Scientific. It is a balanced salt solution that provides nutrients and growth factors essential for the cultivation of a variety of cell types, including adherent and suspension cells. The medium is formulated to support the proliferation and maintenance of cells in vitro.

Fluorescence quantification kit by Takara Bio

Sourced in China

Fluorescence quantification kits by Takara Bio are designed to measure the amount of fluorescent molecules in a sample. These kits provide a reliable and sensitive method to quantify various fluorescent dyes, proteins, or molecules.

A1r eclipse ti by Nikon

Sourced in Japan

The A1R Eclipse Ti is a high-performance inverted microscope system designed for advanced biological and biomedical research applications. It features a modular design, allowing for the integration of a wide range of imaging techniques and accessories to meet the specific needs of researchers.

Lsm 510 meta confocal microscope by Zeiss

Sourced in Germany, United States, United Kingdom, Italy, France, Canada, Denmark, China, Switzerland, Sweden, Colombia, Japan

The LSM 510 META confocal microscope is a high-performance imaging system designed for advanced biological and materials research. It features a flexible, modular design that allows for customization to meet specific research needs. The LSM 510 META utilizes advanced optical and detection technologies to provide high-resolution, high-sensitivity imaging capabilities.

Hepes by Thermo Fisher Scientific

Sourced in United States, United Kingdom, Germany, France, Canada, Switzerland, Australia, Japan, China, Italy, Macao, Spain, Belgium, Sweden, Austria, Brazil, Denmark, New Zealand, Israel, Netherlands, Gabon, Ireland, Norway

HEPES is a buffering agent commonly used in cell culture and biochemical applications. It maintains a stable pH within a physiological range and is compatible with a variety of biological systems.

What are the different types of transport mechanisms involved in nucleocytoplasmic transport?

The main transport mechanisms in nucleocytoplasmic transport include diffusion, active transport, and vesicular trafficking. Diffusion involves the passive movement of small molecules down a concentration gradient across the nuclear membrane. Active transport utilizes energy, such as ATP, to actively move larger molecules like proteins and RNA against concentration gradients. Vesicular trafficking involves the enclosure of cargo within membrane-bound vesicles that bud from one compartment and fuse with another, allowing the transport of larger molecules and organelles between the nucleus and cytoplasm.

How can disruptions in nucleocytoplasmic transport pathways lead to disease?

Dysregulation of nucleocytoplasmic transport can contribute to the development of various disease states. For example, improper localization of key regulatory proteins or RNA molecules can disrupt gene expression and cellular signaling, potentially leading to conditions like cancer, neurodegeneration, and autoimmune disorders. Mutations in the proteins responsible for nuclear transport have also been implicated in a number of genetic diseases. Understanding the role of nucleocytoplasmic transport in health and disease is crucial for developing targeted therapies to address these transport-related pathologies.

What are some common challenges researchers face when studying nucleocytoplasmic transport?

Researchers investigating nucleocytoplasmic transport often encounter challenges in accurately measuring and quantifying transport kinetics, as well as in identifying the specific molecular mechanisms and transport factors involved. Visualizing and tracking the movement of cargo molecules in real-time can also be technically demanding. Additionally, the complex interplay between different transport pathways and the need to study transport in the context of overall cellular function can make it difficult to isolate and study individual transport processes. PubCompare.ai can help address these challenges by providing researchers with AI-driven insights to optimize their experimental protocols and identify the most effective solutions for their nucleocytoplasmic transport research.

How can PubCompare.ai assist researchers studying Transport, Nucleocytoplasmic?

PubCompare.ai's AI-driven protocol optimization can revolutionize the way researchers approach the study of transport and nucleocytoplasmic processes. The platform allows you to quickly screen the literature to identify the most relevant and effective protocols for your specific research goals. By leveraging artificial intelligence, PubCompare.ai can pinpiont critical insights that help you choose the best protocols for reproducibility and accuracy, saving you time and resources. Whether you're investigating the mechanisms of nucleocytoplasmic transport, exploring its role in disease, or developing new therapeutic strategies, PubCompare.ai can be a valuable tool to streamline your research and find the optimal solutions for your work.

What are some practical applications of understanding nucleocytoplasmic transport?

Undestanding nucleocytoplasmic transport has a wide range of practical applications in biology and medicine. At the cellular level, this knowledge helps researchers elucidate the fundamental mechanisms regulating gene expression, signal transduction, and organelle function. From a disease perspective, insights into disrupted nucleocytoplasmic transport pathways can inform the development of targeted therapies for conditions like cancer, neurodegeneration, and autoimmune disorders. Additionally, this knowledge can be leveraged to engineer novel protein-based therapeutics that rely on precise nuclear import or export. By optimizing their research protocols with the help of PubCompare.ai's AI-driven analysis, researchrs can accelerate their progress in unlocking the full potential of nucleocytoplasmic transport research.

More about "Transport, Nucleocytoplasmic"

Cellular Transport and Nucleocytoplasmic Dynamics: Unlocking the Secrets of Cellular Communication and Signaling Cellular transport and nucleocytoplasmic processes are fundamental to the proper functioning and communication of cells.
These complex mechanisms involve the movement of various molecules, such as proteins and RNA, between the nucleus and cytoplasm, regulating gene expression, cellular signaling, and overall cellular homeostasis.
The transport of substances across cellular membranes and between different compartments within the cell is facilitated by various mechanisms, including diffusion, active transport, and vesicular trafficking.
Diffusion allows for the passive movement of molecules down a concentration gradient, while active transport requires energy expenditure to move molecules against a concentration gradient.
Vesicular trafficking involves the encapsulation of cargo within membrane-bound vesicles, which then fuse with target membranes to deliver their contents.
Disruptions in these transport pathways can lead to a variety of disease states, highlighting the importance of understanding and studying these processes.
Researchers investigating transport and nucleocytoplasmic dynamics can leverage the power of AI-driven protocol optimization tools, such as PubCompare.ai, to streamline their research and find the optimal solutions for their work.
PubCompare.ai's intelligent protocol comparison capabilities allow researchers to easily locate the best protocols from the vast and ever-expanding body of scientific literature, preprints, and patents.
This AI-enhanced protocol selection process can revolutionize the way researchers approach transport and nucleocytoplasmic research, helping them to identify the most efficient and effective methods for their studies.
By utilizing PubCompare.ai, researchers can save time, reduce costs, and increase the likelihood of successful experiments, ultimately advancing our understanding of these critical cellular processes.
Whether working with cell culture techniques, such as FBS, DMEM, TrypLE Select, or DMEM/F12, or leveraging imaging technologies like the A1R Eclipse Ti or LSM 510 META confocal microscope, PubCompare.ai can be a valuable tool in the researcher's arsenal.
Additionally, the availability of reagent kits, such as the PrimeScript RT reagent kit, and fluorescence quantification kits can further enhance the researcher's ability to study transport and nucleocytoplasmic dynamics, with PubCompare.ai providing guidance on the optimal protocols and methods to utilize these resources effectively.
In conclusion, the study of cellular transport and nucleocytoplasmic processes is a crucial area of biology, with far-reaching implications for our understanding of cellular function and communication.
By embracing the power of AI-driven protocol optimization, researchers can streamline their work, maximize their productivity, and make groundbreaking discoveries that advance the field and improve human health.