Log In Sign up
The largest database of trusted experimental protocols
> Physiology > Cell Function > Virus Replication

Virus Replication

Virus replication is the process by which viruses reproduce inside the cells of a host organism.
This involves the virus hijacking the host's cellular machinery to produce more copies of the viral genome and assemble new viral particles.
Understanding virus replication is crucial for developing effective treatments and preventive measures against viral infections.
PubCompare.ai can help optimize your virus replication research by locating relevant protocols from literature, preprints, and patents, while leveraging AI-driven comparisions to identify the most accurate and reproducible methods.
Enhance your research with PubCompare.ai's powerful tools and acheive better results.

Most cited protocols related to «Virus Replication»

1
ZIKV 2007 Strain Real-Time PCR Assay
Cited 307 times
Two real-time primer/probe sets specific for the ZIKV 2007 strain were designed by using ZIKV 2007 nucleotide sequence data in the PrimerExpress software package (Applied Biosystems, Foster City, CA, USA). Primers were synthesized by Operon Biotechnologies (Huntsville, AL, USA) with 5-FAM as the reporter dye for the probe (Table 3). All real-time assays were performed by using the QuantiTect Probe RT-PCR Kit (QIAGEN, Valencia, CA, USA) with amplification in the iCycler instrument (Bio-Rad, Hercules, CA, USA) following the manufacturer’s protocol. Specificity of the ZIKV primers was evaluated by testing the following viral RNAs, all of which yielded negative results: DENV-1, DENV-2, DENV-3, DENV-4, WNV, St. Louis encephalitis virus, YFV, Powassan virus, Semliki Forest virus, o’nyong-nyong virus, chikungunya virus, and Spondweni virus (SPOV).
Sensitivity of the ZIKV real-time assay was evaluated by testing dilutions of known copy numbers of an RNA transcript copy of the ZIKV 2007 sequence. Copy numbers of RNA were determined by using the Ribogreen RNA-specific Quantitiation Kit (Invitrogen) and the TBE-380 mini-fluorometer (Turner Biosystems, Sunnyvale, CA, USA). RNA transcripts ranging from 16,000 to 0.2 copies were tested in quadruplicate to determine the sensitivity limit and to construct a standard curve for estimating the genome copy number of ZIKV in patient samples. All serum samples obtained during the epidemic were tested for ZIKV RNA by using this newly designed real-time RT-PCR. Concentration of viral RNA (copies/milliliter) was estimated in ZIKV-positive patients by using the standard curve calculated by the iCycler instrument (Table 4). All RT-PCR–positive specimens were placed on monolayers of Vero, LLC-MK2, and C6/36 cells to isolate virus; no specimens showed virus replication.
Lanciotti R.S., Kosoy O.L., Laven J.J., Velez J.O., Lambert A.J., Johnson A.J., Stanfield S.M, & Duffy M.R. (2008). Genetic and Serologic Properties of Zika Virus Associated with an Epidemic, Yap State, Micronesia, 2007. Emerging Infectious Diseases, 14(8), 1232-1239.
Full text: Click here
Publication 2008
Base Sequence Biological Assay Cells Chikungunya virus Encephalitis Viruses Epidemics Genome Hypersensitivity Oligonucleotide Primers Operon Patients Powassan virus Real-Time Polymerase Chain Reaction Reverse Transcriptase Polymerase Chain Reaction RNA, Viral RNA Sequence Semliki forest virus Serum Strains Technique, Dilution Virus Virus Replication Zika Virus
2
Profiling Immune Responses to Influenza Vaccination
Cited 41 times

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2014
Antibody-Secreting Cells Biological Assay BLOOD Cells Crossbreeding Dietary Supplements Freezing Genes Healthy Volunteers Immunoglobulins Influenza Leeks Microarray Analysis neuro-oncological ventral antigen 2, human Population Group Technique, Dilution Virus Virus Replication
3
Visualizing SARS-CoV-2 Entry Factors
Cited 21 times
HeLa cells transiently expressing ACE2 were prepared using Lipofectamine 3000 (Thermo Fisher Scientific) in a 96-well plate; mock-transfected cells were used as controls. 2019-nCoV grown in Vero E6 cells was used for infection at a MOI of 0.5. APN and DPP4 were analysed in the same way. The inoculum was removed after absorption for 1 h and washed twice with PBS and supplemented with medium. At 24 h after infection, cells were washed with PBS and fixed with 4% formaldehyde in PBS (pH 7.4) for 20 min at room temperature. ACE2 expression was detected using a mouse anti-S tag monoclonal antibody and a FITC-labelled goat anti-mouse IgG H&L (Abcam, ab96879). Viral replication was detected using a rabbit antibody against the Rp3 N protein (generated in-house, 1:1,000) and a Cy3-conjugated goat anti-rabbit IgG (1:200, Abcam, ab6939). Nuclei were stained with DAPI (Beyotime). Staining patterns were examined using confocal microscopy on a FV1200 microscope (Olympus).
Zhou P., Yang X.L., Wang X.G., Hu B., Zhang L., Zhang W., Si H.R., Zhu Y., Li B., Huang C.L., Chen H.D., Chen J., Luo Y., Guo H., Jiang R.D., Liu M.Q., Chen Y., Shen X.R., Wang X., Zheng X.S., Zhao K., Chen Q.J., Deng F., Liu L.L., Yan B., Zhan F.X., Wang Y.Y., Xiao G.F, & Shi Z.L. (2020). A pneumonia outbreak associated with a new coronavirus of probable bat origin. Nature, 579(7798), 270-273.
Full text: Click here
Publication 2020
ACE2 protein, human anti-IgG Antibodies, Anti-Idiotypic Cell Nucleus Cells DAPI DPP4 protein, human Fluorescein-5-isothiocyanate Formaldehyde Goat HeLa Cells Immunoglobulins Infection Lipofectamine Microscopy, Confocal Monoclonal Antibodies Mus nucleoprotein, Measles virus Rabbits SARS-CoV-2 Vero Cells Virus Replication
4
Production of Replication-Competent HIV-1 Virus
Cited 21 times
Replication-competent HIV-1 virus was produced by transfection of 293T cells with one of the following pNL4-3 proviral constructs: the NLENG1-IRES vector (kindly provided by Dr. D.N. Levy, New York University college of Dentistry, New York, NY) [34] (link), the NL4-3-IRES-HSA vector (kindly provided by Dr. M.J. Tremblay, Faculté de Médecine, Université Laval, Québec, Canada) [35] (link) or the HIV-1 NL4-3-IRES-eGFP vector (kindly provided by Dr. F. Kirchhoff, Institute of Virology, University of Ulm, Ulm, Germany) [36] (link). Transfection was performed with Calcium Phosphate Transfection Kit (Life Technologies) or JetPei® (Polyplus, Sélestat, France), according to manufacturer’s instructions. Viral supernatant was harvested 48 hours or 72 hours after transfection and centrifugated at 900 g for 10 min, to clarify the supernatant from remaining cells. High-titer viral supernatant, that was used to produce a standard curve for the SG-PERT assay, was obtained by infection of Jurkat CD4 CCR5 cells with HIV-1 (140 ng p24 equivalent per mL) and subsequent collection of the culture medium 12 days after infection. During infection, culture medium was refreshed every two or three days.
Vermeire J., Naessens E., Vanderstraeten H., Landi A., Iannucci V., Van Nuffel A., Taghon T., Pizzato M, & Verhasselt B. (2012). Quantification of Reverse Transcriptase Activity by Real-Time PCR as a Fast and Accurate Method for Titration of HIV, Lenti- and Retroviral Vectors. PLoS ONE, 7(12), e50859.
Full text: Click here
Publication 2012
Biological Assay Calcium Phosphates CCR5 protein, human CD4 Positive T Lymphocytes Cloning Vectors Culture Media HEK293 Cells HIV-1 Infection Internal Ribosome Entry Sites Proviruses Transfection Virus Replication
5
Pseudotyped HIV and MLV Particle Production
Cited 17 times
Replication-incompetent HIV particles pseudotyped with VSV-G were generated by calcium phosphate transfection of HEK-293T cells (ATCC) with 20 μg of proviral HIV vector and 12 μg of pL-VSV-G plasmid (36 (link)) per 3 × 106 cells seeded on 10-cm plates. The transfection media was replaced after 8 h with fresh DMEM supplemented with 10% FCS. Supernatants were collected at 48 h after transfection. The virus-containing supernatants were centrifuged for 10 min at 1,200 rpm to remove cells, then passed through 0.4-μm filters to remove fine debris. Supernatants either were used immediately for infections or were frozen in aliquots at −80°C. The viral titers were determined by infection of the human T cell line Hut78 with serially diluted virus supernatant. Typically, viral titers had a range of 3–10 × 106 infectious units (ifu)/ml. T cells were infected at a multiplicity of infection (MOI) of 10–20 in 24-well plates in the presence of 10 μg/ml polybrene (Sigma Chemical Co.). After an additional day of culture with virus supernatants, cells were washed or sedimented through Ficoll and resuspended in fresh culture media. R5-tropic replication-competent viruses were prepared similarly by transfecting 293T cells, and titers of 2–5 × 105 ifu/ml were obtained. VSV-G–pseudotyped MLV-based viruses were similarly prepared by transfecting 293T cells with 12 μg each of pMX.EGFP, pJK3 (expressing MLV gag and pol genes), and pL-VSV-G as well as 3 μg of pCMV-Tat plasmids.
Unutmaz D., KewalRamani V.N., Marmon S, & Littman D.R. (1999). Cytokine Signals Are Sufficient for HIV-1 Infection of Resting Human T Lymphocytes. The Journal of Experimental Medicine, 189(11), 1735-1746.
Publication 1999
Calcium Phosphates Cells Cloning Vectors Culture Media DNA Replication Ficoll Freezing HEK293 Cells Homo sapiens Infection Plasmids pol Genes Polybrene Proviruses T-Lymphocyte Transfection Virus Virus Replication

Most recents protocols related to «Virus Replication»

1
Investigating Virus Infectivity's Role in Plaque Size
Not available on PMC !

Example 3

Investigation of Virus Infectivity as a Factor that Determines Plaque Size.

With the revelation that plaque formation is strongly influenced by the immunogenicity of the virus, the possibility that infectivity of the virus could be another factor that determines plaque sizes was investigated. The uptake of viruses into cells in vitro was determined by measuring the amounts of specific viral RNA sequences through real-time PCR.

To measure total viral RNA, total cellular RNA was extracted using the RNEasy Mini kit (Qiagen), and complementary DNA synthesized using the iScript cDNA Synthesis kit (Bio-Rad). To measure total viral RNA, quantitative real-time PCR was done using a primer pair targeting a highly conserved region of the 3′ UTR common to all four serotypes of dengue; inter-sample normalization was done using GAPDH as a control. Primer sequences are listed in Table 5. Pronase (Roche) was used at a concentration of 1 mg/mL and incubated with infected cells for five minutes on ice, before washing with ice cold PBS. Total cellular RNA was then extracted from the cell pellets in the manner described above.

TABLE 5
PCR primer sequences.
Gene TargetPrimer Sequence
DENV LYL 3′UTRForward: TTGAGTAAACYRTGCTGCCTGTA
TGCC (SEQ ID NO: 24)
Reverse: GAGACAGCAGGATCTCTGGTCTY
TC (SEQ ID NO: 25)
GAPDH (Human)Forward: GAGTCAACGGATTTGGTCGT
(SEQ ID NO: 26)
Reverse: TTGATTTTGGAGGGATCTCG
(SEQ ID NO: 27)
CXCL10 (Human)Forward: GGTGAGAAGAGATGTCTGAATCC
(SEQ ID NO: 28)
Reverse: GTCCATCCTTGGAAGCACTGCA
(SEQ ID NO: 29)
ISG20 (Human)Forward: ACACGTCCACTGACAGGCTGTT
(SEQ ID NO: 30)
Reverse: ATCTTCCACCGAGCTGTGTCCA
(SEQ ID NO: 31)
IFIT2 (Human)Forward: GAAGAGGAAGATTTCTGAAG
(SEQ ID NO: 32)
Reverse: CATTTTAGTTGCCGTAGG
(SEQ ID NO: 33)
IFNα (Canine)Forward: GCTCTTGTGACCACTACACCA
(SEQ ID NO: 34)
Reverse: AAGACCTTCTGGGTCATCACG
(SEQ ID NO: 35)
IFNβ (Canine)Forward: GGATGGAATGAGACCACTGTCG
(SEQ ID NO: 36)
Reverse: ACGTCCTCCAGGATTATCTCCA
(SEQ ID NO: 37)

The proportion of infected cells was assessed by flow cytometry. Cells were fixed and permeabilised with 3% paraformaldehyde and 0.1% saponin, respectively. DENV envelope (E) protein was stained with mouse monoclonal 4G2 antibody (ATCC) and AlexaFluor488 anti-mouse secondary antibody. Flow cytometry analysis was done on a BD FACS Canto II (BD Bioscience).

Unexpectedly, despite DENV-2 PDK53 inducing stronger antiviral immune responses, it had higher rates of uptake by HuH-7 cells compared to DENV-2 16681 (FIG. 5). This difference continued to be observed when DENV-2 PDK53 inoculum was reduced 10-fold. In contrast, DENV-3 PGMK30 and its parental strain DENV-3 16562 displayed the same rate of viral uptake in host cells. Furthermore, DENV-2 PDK53 showed a higher viral replication rate compared to DENV-2 16681. This was determined by measuring the percentage of cells that harbored DENV E-protein, detected using flow cytometry. DENV-2 PDK53 showed a higher percentage of infected cells compared to DENV-2 16681 at the same amount of MOI from Day 1 to 3 (FIG. 6). In contrast, DENV-3 PGMK30 showed a reverse trend and displayed lower percentage of infected cells compared to DENV-3 16562. Results here show that successfully attenuated vaccines, as exemplified by DENV-2 PDK53, have greater uptake and replication rate.

Results above demonstrate that the DENV-2 PDK53 and DENV-3 PGMK30 are polarized in their properties that influence plaque morphologies. While both attenuated strains were selected for their formation of smaller plaques compared to their parental strains, the factors leading to this outcome are different between the two.

Accordingly, this study has demonstrated that successfully attenuated vaccines, as exemplified by DENV-2 PDK53 in this study, form smaller plaques due to induction of strong innate immune responses, which is triggered by fast viral uptake and spread of infection. In contrast, DENV-3 PGMK30 form smaller plaques due to its slower uptake and growth in host cells, which inadvertently causes lower up-regulation of the innate immune response.

Based on the results presented in the foregoing Examples, the present invention provides a new strategy to prepare a LAV, which expedites the production process and ensures the generation of effectively attenuated viruses fit for vaccine use.

US11865083B2. Rapid method of generating live attenuated vaccines (2024-01-09). NATIONAL UNIVERSITY OF SINGAPORE [SG]. Inventors: Eng Eong Ooi [SG], Kenneth Goh [SG], Swee Sen Kwek [SG], Choon Kit Tang [SG].
Full text: Click here
Patent 2024
Antibodies, Anti-Idiotypic Antigens, Viral Antiviral Agents Canis familiaris Cells Common Cold Cowpox virus Dengue Fever Dental Plaque DNA, Complementary DNA Replication Flow Cytometry GAPDH protein, human Genes Homo sapiens Immunity, Innate Infection Interferon-alpha Monoclonal Antibodies Mus Oligonucleotide Primers paraform Parent Pellets, Drug Pronase Proteins Real-Time Polymerase Chain Reaction Response, Immune RNA, Viral Saponin Senile Plaques Strains Vaccines Virus Virus Diseases Virus Replication
2
Cytotoxicity of OTS-412 Maintained with GCV
Not available on PMC !

Example 5

To determine whether cytotoxicity of OTS-412 was maintained despite the inhibition of OTS-412 virus replication by GCV, the cytotoxicity between the following groups was compared: groups treated with the wild type HSV1-TK-expressing vaccinia virus, alone or in combination with GCV, and groups treated with OTS-412, alone or in combination with GCV. Specifically, HCT-116 cancer cells were treated with 0.05 MOI (0.05 pfu/cell) of wild type HSV1-TK-expressing vaccinia virus or OTS-412, alone or in combination with GCV (50 μg). The resulting cells were cultured for 72 hours and analyzed for cytotoxicity using CCK8 (Cell Counting Kit 8).

As a result, the cytotoxicity of OTS-412 and GCV combined treatment was maintained at 95% or more of OTS-412 single treated group whereas the vaccinia virus expressing wild-type HSV1-TK showed almost no cytotoxicity (FIG. 8). It was confirmed that the vaccinia virus expressing wild-type HSV1-TK had higher sensitivity to GCV than HSV1-TKmut inserted in OTS-412 and that the cancer cell killing effect was hardly observed due to the complete inhibition of viral replication.

US11857585B2. Oncolytic virus improved in safety and anticancer effect (2024-01-02). BIONOXX INC. [KR]. Inventors: Taeho Hwang [KR], Mong Cho [KR].
Full text: Click here
Patent 2024
Cells Cytotoxin HCT116 Cells Human Herpesvirus 1 Hypersensitivity Malignant Neoplasms Psychological Inhibition Vaccinia virus Virus Replication
3
Generation of HIV-1 Reporter Virus Stocks
Replication-competent reporter virus stocks were generated from an HIV-1 NL4-3 molecular clone in which GFP had been cloned behind an IRES cassette following the viral nef gene (NIH AIDS Reagent Program, catalog no. 11349). Briefly, 10 mg of the molecular clone was transfected (PolyJet; SignaGen) into 5 × 106 human embryonic kidney (HEK) 293T cells (ATCC, CRL-3216) according to the manufacturer’s protocol. Twenty-five milliliters of the supernatant was collected at 48 and 72 hours and then combined. The virus-containing supernatant was filtered through 0.45-mm polyvinylidene difluoride filters (Millipore) and precipitated in 8.5% polyethylene glycol [average molecular weight (Mn), 6000; Sigma-Aldrich] and 0.3 M NaCl for 4 hours at 4°C. Supernatants were centrifuged at 3500 rpm for 20 min, and the virus was resuspended in 0.5 ml of PBS for a 100× effective concentration. Aliquots were stored at −80°C until use.
Soliman S.H., Cisneros W.J., Iwanaszko M., Aoi Y., Ganesan S., Walter M., Zeidner J.M., Mishra R.K., Kim E.Y., Wolinsky S.M., Hultquist J.F, & Shilatifard A. (2023). Enhancing HIV-1 latency reversal through regulating the elongating RNA Pol II pause-release by a small-molecule disruptor of PAF1C. Science Advances, 9(10), eadf2468.
Publication 2023
Acquired Immunodeficiency Syndrome Clone Cells Embryo Genes, Viral HEK293 Cells HIV-1 Homo sapiens Internal Ribosome Entry Sites Kidney Polyethylene Glycols polyvinylidene fluoride Sodium Chloride Virus Virus Replication
4
Inactivation of SADS-CoV via UV Irradiation
To create replication-deficient virus, the supernatant containing SADS-CoV was ultraviolet (UV)-irradiated on ice at 100 μJ/cm2 for 60 min using a CL-1000 crosslinker. Vero E6 cells were incubated with the UV-inactivated SADS-CoV supernatant for 1 h in an incubator. Then, the supernatant was replaced with DMEM containing 1 μg/mL trypsin and maintained for 48 h. The inactivation efficiency of cells that were infected with UV-inactivated SADS-CoV was measured using an immunofluorescence assay with a specific anti-viral protein N antibody.
Shi D., Zhou L., Shi H., Zhang J., Zhang J., Zhang L., Liu D., Feng T., Zeng M., Chen J., Zhang X., Xue M., Jing Z., Liu J., Ji Z., He H., Guo L., Wu Y., Ma J, & Feng L. (2023). Autophagy is induced by swine acute diarrhea syndrome coronavirus through the cellular IRE1-JNK-Beclin 1 signaling pathway after an interaction of viral membrane-associated papain-like protease and GRP78. PLOS Pathogens, 19(3), e1011201.
Full text: Click here
Publication 2023
Antibodies, Anti-Idiotypic Immunofluorescence Swine acute diarrhea syndrome coronavirus Trypsin Vero Cells Viral N Protein Virus Replication
5
Molecular Docking of Anti-SARS-CoV-2 Drug Candidates
The molecular docking simulation was used to determine the binding energy of six antiretrovirals to the RdRp, ExoN-NSP10 and 3CLpro proteins of SARS-CoV-2. These proteins are necessary for viral RNA replication and polyprotein processing [12] (link). The crystal structures of RdRp (Identification code, ID: 6M71) [8] (link), ExoN-NSP10 (ID:7MC6) [37] (link) and 3CLpro (ID: 6M2N) [38] (link) were obtained from the Protein Data Bank (PDB) [39] (link). The resolution structures selected were lower than 3 Å [40] (link). The proteins were subjected to preparation by using Discovery Studio [41] and AutoDockTools (ADT). The active forms of the antiretrovirals [42] (link) were drawn and optimized by using Avogadro software [43] (link) and ADT. Remdesivir [44] (link),[45] (link), pibrentasvir [46] (link) and CQ [47] (link),[48] (link) were used as positive controls of the interaction with RdRp, ExoN-NSP10 and 3CLpro, respectively.
PrankWeb [49] (link) was used to determine the number of pockets and the amino acid residues that comprise them. This program also described the size (volume), depth, surface area or general hydrophobicity of each pocket (Table 1). In addition, Protein plus [50] (link) was implemented to verify the number of pockets obtained by PrankWeb [49] (link), and to describe their characteristics (size, shapes, amino acids composition and descriptor functional groups). The pockets were selected according to the active site or catalytic domain for each protein, as based on previous reports [16] (link),[51] (link),[52] (link).
Couplings were carried out using AutoDock Vina version 4.2.6 [53] (link), with an exhaustiveness value of 20 and a grid box of 24 Å × 24 Å × 24 Å, centered at (116.7829 Å, 109.9570 Å, 123.9430 Å) (XYZ coordinates) for RdRp (PDB ID: 6M71), (28.6904 Å, −1.9647 Å, 13.6836 Å) for ExoN-NSP10 (PDB: 7MC6) and (−47.585 Å, 1.135 Å, −5.600 Å) for 3CLpro (PDB ID:6M2N) (Table 1). The best docking conformation of protein-ligand interactions was predicted based on the binding energy value (kcal/mol). The docked structures were analyzed and visualized by using BIOVIA Discovery Studio Visualizer 16.1.
Zapata-Cardona M.I., Florez-Alvarez L., Guerra-Sandoval A.L., Chvatal-Medina M., Guerra-Almonacid C.M., Hincapie-Garcia J., Hernandez J.C., Rugeles M.T, & Zapata-Builes W. (2023). In vitro and in silico evaluation of antiretrovirals against SARS-CoV-2: A drug repurposing approach. AIMS Microbiology, 9(1), 20-40.
Full text: Click here
Publication 2023
Amino Acids Catalysis Catalytic Domain DNA Replication Exons Ligands Molecular Docking Simulation pibrentasvir Polyproteins Protein Domain Proteins remdesivir RNA, Viral RNA Replication SARS-CoV-2 Virus Replication

Top products related to «Virus Replication»

1
Lipofectamine 2000 by Thermo Fisher Scientific
Sourced in United States, China, Germany, United Kingdom, Canada, Japan, France, Italy, Switzerland, Australia, Spain, Belgium, Denmark, Singapore, India, Netherlands, Sweden, New Zealand, Portugal, Poland, Lithuania, Hong Kong, Argentina, Ireland, Austria, Israel, Czechia, Cameroon, Taiwan, Province of China, Morocco
Lipofectamine 2000 is a cationic lipid-based transfection reagent designed for efficient and reliable delivery of nucleic acids, such as plasmid DNA and small interfering RNA (siRNA), into a wide range of eukaryotic cell types. It facilitates the formation of complexes between the nucleic acid and the lipid components, which can then be introduced into cells to enable gene expression or gene silencing studies.
2
Dulbecco modified eagle medium (dmem) by Thermo Fisher Scientific
Sourced in United States, China, United Kingdom, Germany, France, Australia, Canada, Japan, Italy, Switzerland, Belgium, Austria, Spain, Israel, New Zealand, Ireland, Denmark, India, Poland, Sweden, Argentina, Netherlands, Brazil, Macao, Singapore, Sao Tome and Principe, Cameroon, Hong Kong, Portugal, Morocco, Hungary, Finland, Puerto Rico, Holy See (Vatican City State), Gabon, Bulgaria, Norway, Jamaica
DMEM (Dulbecco's Modified Eagle's Medium) is a cell culture medium formulated to support the growth and maintenance of a variety of cell types, including mammalian cells. It provides essential nutrients, amino acids, vitamins, and other components necessary for cell proliferation and survival in an in vitro environment.
3
Fetal bovine serum (fbs) by Thermo Fisher Scientific
Sourced in United States, China, United Kingdom, Germany, Australia, Japan, Canada, Italy, France, Switzerland, New Zealand, Brazil, Belgium, India, Spain, Israel, Austria, Poland, Ireland, Sweden, Macao, Netherlands, Denmark, Cameroon, Singapore, Portugal, Argentina, Holy See (Vatican City State), Morocco, Uruguay, Mexico, Thailand, Sao Tome and Principe, Hungary, Panama, Hong Kong, Norway, United Arab Emirates, Czechia, Russian Federation, Chile, Moldova, Republic of, Gabon, Palestine, State of, Saudi Arabia, Senegal
Fetal Bovine Serum (FBS) is a cell culture supplement derived from the blood of bovine fetuses. FBS provides a source of proteins, growth factors, and other components that support the growth and maintenance of various cell types in in vitro cell culture applications.
4
Trizol reagent by Thermo Fisher Scientific
Sourced in United States, China, Japan, Germany, United Kingdom, Canada, France, Italy, Australia, Spain, Switzerland, Netherlands, Belgium, Lithuania, Denmark, Singapore, New Zealand, India, Brazil, Argentina, Sweden, Norway, Austria, Poland, Finland, Israel, Hong Kong, Cameroon, Sao Tome and Principe, Macao, Taiwan, Province of China, Thailand
TRIzol reagent is a monophasic solution of phenol, guanidine isothiocyanate, and other proprietary components designed for the isolation of total RNA, DNA, and proteins from a variety of biological samples. The reagent maintains the integrity of the RNA while disrupting cells and dissolving cell components.
5
Trizol by Thermo Fisher Scientific
Sourced in United States, Germany, China, Japan, United Kingdom, Canada, France, Italy, Spain, Australia, Switzerland, Belgium, Denmark, Netherlands, India, Ireland, Lithuania, Singapore, Sweden, Norway, Austria, Brazil, Argentina, Hungary, Sao Tome and Principe, New Zealand, Hong Kong, Cameroon, Philippines
TRIzol is a monophasic solution of phenol and guanidine isothiocyanate that is used for the isolation of total RNA from various biological samples. It is a reagent designed to facilitate the disruption of cells and the subsequent isolation of RNA.
6
Rneasy mini kit by Qiagen
Sourced in Germany, United States, United Kingdom, Netherlands, Spain, Japan, Canada, France, China, Australia, Italy, Switzerland, Sweden, Belgium, Denmark, India, Jamaica, Singapore, Poland, Lithuania, Brazil, New Zealand, Austria, Hong Kong, Portugal, Romania, Cameroon, Norway
The RNeasy Mini Kit is a laboratory equipment designed for the purification of total RNA from a variety of sample types, including animal cells, tissues, and other biological materials. The kit utilizes a silica-based membrane technology to selectively bind and isolate RNA molecules, allowing for efficient extraction and recovery of high-quality RNA.
7
Prism 9 by GraphPad
Sourced in United States, Austria, Germany, Poland, United Kingdom, Canada, Japan, Belgium, China, Lao People's Democratic Republic, France
Prism 9 is a powerful data analysis and graphing software developed by GraphPad. It provides a suite of tools for organizing, analyzing, and visualizing scientific data. Prism 9 offers a range of analysis methods, including curve fitting, statistical tests, and data transformation, to help researchers and scientists interpret their data effectively.
8
Lipofectamine 3000 by Thermo Fisher Scientific
Sourced in United States, China, Germany, Japan, United Kingdom, France, Canada, Italy, Australia, Switzerland, Denmark, Spain, Singapore, Belgium, Lithuania, Israel, Sweden, Austria, Moldova, Republic of, Greece, Azerbaijan, Finland
Lipofectamine 3000 is a transfection reagent used for the efficient delivery of nucleic acids, such as plasmid DNA, siRNA, and mRNA, into a variety of mammalian cell types. It facilitates the entry of these molecules into the cells, enabling their expression or silencing.
9
Qiaamp viral rna mini kit by Qiagen
Sourced in Germany, United States, United Kingdom, France, Spain, Japan, China, Netherlands, Italy, Australia, Canada, Switzerland, Belgium
The QIAamp Viral RNA Mini Kit is a laboratory equipment designed for the extraction and purification of viral RNA from various sample types. It utilizes a silica-based membrane technology to efficiently capture and isolate viral RNA, which can then be used for downstream applications such as RT-PCR analysis.
10
Penicillin by Thermo Fisher Scientific
Sourced in United States, United Kingdom, Germany, China, France, Canada, Japan, Australia, Switzerland, Italy, Israel, Belgium, Austria, Spain, Brazil, Netherlands, Gabon, Denmark, Poland, Ireland, New Zealand, Sweden, Argentina, India, Macao, Uruguay, Portugal, Holy See (Vatican City State), Czechia, Singapore, Panama, Thailand, Moldova, Republic of, Finland, Morocco
Penicillin is a type of antibiotic used in laboratory settings. It is a broad-spectrum antimicrobial agent effective against a variety of bacteria. Penicillin functions by disrupting the bacterial cell wall, leading to cell death.

More about "Virus Replication"

Viral replication is the process by which viruses multiply inside the cells of a host organism.
This involves the virus hijacking the host's cellular machinery to produce more copies of the viral genome and assemble new viral particles.
Understanding the mechanisms of virus replication is crucial for developing effective treatments and preventive measures against viral infections, such as those caused by SARS-CoV-2, influenza, HIV, and hepatitis viruses.
To study virus replication, researchers often utilize various techniques and reagents, including Lipofectamine 2000 for transfecting cells, DMEM (Dulbecco's Modified Eagle Medium) and FBS (Fetal Bovine Serum) for cell culture, TRIzol reagent and the RNeasy Mini Kit for RNA extraction, and Prism 9 for data analysis.
Additionally, Lipofectamine 3000 and the QIAamp Viral RNA Mini Kit may be employed for viral genome isolation and purification.
Optimizing virus replication research is crucial, and tools like PubCompare.ai can help researchers locate relevant protocols from literature, preprints, and patents, while leveraging AI-driven comparisons to identify the most accurate and reproducible methods.
By enhancing their research with PubCompare.ai's powerful tools, researchers can achieve better results and advance our understanding of virus replication, ultimately leading to improved treatments and preventive measures against viral infections.
Key subtopics related to virus replication include viral entry, genome replication, transcription, translation, assembly, and release.
Researchers may also investigate the role of host cellular factors, signaling pathways, and immune responses in the virus replication process.
Abbreviations commonly used in this field include SARS-CoV-2 (Severe Acute Respiratory Syndrome Coronavirus 2), HIV (Human Immunodeficiency Virus), and RNA (Ribonucleic Acid).