The largest database of trusted experimental protocols
> Physiology > Genetic Function > DNA Replication

DNA Replication

DNA replication is the fundamental biological process by which a DNA molecule is duplicated, producing two identical copies.
This essential process ensures the accurate transmission of genetic information from one cell generation to the next.
During replication, the double-stranded DNA molecule is unwound and separated, serving as a template for the synthesis of new complementary strands.
A complex of enzymes and proteins, including DNA polymerase, primase, and helicase, orchestrate this intricate process.
Understanding DNA replication is crucial for advancing research in areas such as genetics, cell biology, and molecular biology.
Optimizing DNA replication protocols can drive forward innovation in fields like DNA sequencing, gene editing, and synthetic biology.
Expereince the future of DNA replication optimization today with PubCompare.ai, the AI-driven platform revolutionizing this critical area of study.

Most cited protocols related to «DNA Replication»

Sequence replication can occur during different steps of the sequencing protocol, and can therefore generate artificial duplicates (Gomez-Alvarez et al., 2009 (link)). Here, duplicates are categorized into the following groups: (i) exact duplicate, (ii) 5 duplicate (sequence matches the 5-end of a longer sequence), (iii) 3 duplicate, (iv) exact duplicate with the reverse complement of another sequence and (v) 5/3 duplicate with the reverse complement of another sequence. The duplicates are identified independently by sorting and prefix/suffix matching of the sequences.
Publication 2011
Complement 3 Complement 5 DNA Replication
All samples were obtained under institutional IRB approval and with documented informed consent. A complete list of samples is given in Table S2. Whole-exome capture libraries were constructed and sequenced on Illumina HiSeq flowcells to average coverage of 118x. Whole-genome sequencing was done with the Illumina GA-II or Illumina HiSeq sequencer, achieving an average of ~30X coverage depth. Reads were aligned to the reference human genome build hg19 using an implementation of the Burrows-Wheeler Aligner, and a BAM file was produced for each tumor and normal sample using the Picard pipeline6 (link). The Firehose pipeline was used to manage input and output files and submit analyses for execution. The MuTect30 and Indelocator (Sivachenko, A. et al., manuscript in preparation) algorithms were used to identify somatic single-nucleotide variants (SSNVs) and short somatic insertions and deletions, respectively. Mutation spectra were analyzed using non-negative matrix factorization (NMF). Significantly mutated genes were identified using MutSigCV, which estimates the background mutation rate (BMR) for each gene-patient-category combination based on the observed silent mutations in the gene and noncoding mutations in the surrounding regions. Because in most cases these data are too sparse to obtain accurate estimates, we increased accuracy by pooling data from other genes with similar properties (e.g. replication time, expression level). Significance levels (p-values) were determined by testing whether the observed mutations in a gene significantly exceed the expected counts based on the background model. False Discovery Rates (q-values) were then calculated, and genes with q≤0.1 were reported as significantly mutated. Full methods details are listed in Supplementary Information.
Publication 2013
Diploid Cell DNA Replication Exome Gene Deletion Genes Genes, vif Genetic Background Genome, Human Insertion Mutation Multiple Acyl Coenzyme A Dehydrogenase Deficiency Mutation Neoplasms Nucleotides Patients Silent Mutation
Total RNA was extracted from EBV transformed lymphoblastoid cell line pellets by the TRIzol reagent (Ambion), and mRNA and small RNA sequencing of 465 unique individuals was performed on the Illumina HiSeq2000 platform, with paired-end 75bp mRNA-seq and single-end 36bp small RNA-seq. Five samples were sequenced in replicate in each of the seven sequencing laboratories. The mRNA and small RNA reads were mapped with GEM31 and miraligner32 (link), respectively, with an average of 48.9M mRNA-seq reads and 1.2M miRNA reads per sample after QC. Numerous transcript features were quantified using Gencode v1233 (link) and miRBase v1834 (link) annotations: protein-coding and lincRNA genes (16,084 detected in >50% of samples), transcripts (67,603; with FluxCapacitor7 (link)), exons (146,498), annotated splice junctions (129,805; analyzed in detail in Ferreira et al. submitted), transcribed repetitive elements (47,409), and mature miRNAs (715). Data quality was assessed by sample correlations and read and gene count distributions, and technical variation was removed by PEER normalization35 (link) for the QTL and miRNA-mRNA correlation analyses11 (link). The samples clustered uniformly both before and after normalization. The genotype data was obtained from 1000 Genomes Phase 1 data set for 421 samples (80× average exome and 5× whole genome read depth), and the remaining 41 samples were imputed from Omni 2.5M SNP array data. Furthermore, we did functional reannotation for all the 1000 Genomes variants using Gencode v12. QTL mapping was done with linear regression, using genetic variants with >5% frequency in 1MB window and normalized quantifications transformed to standard normal. Permutations were used to adjust FDR to 5%. Full details are provided in Supplementary Methods.
Publication 2013
Cell Line, Transformed DNA Replication Exome Exons Genes Genetic Diversity Genome Genotype Long Intergenic Non-Protein Coding RNA MicroRNAs Pellets, Drug Proteins Repetitive Region RNA, Messenger RNA-Seq trizol
A main limitation of efficiency calibrated method and ΔΔCt method is that only one set of cDNA samples are employed to determine the amplification efficiency. It was assumed that the same amplification efficiency could be applied to other cDNA samples as long as the primers and amplification conditions are the same. However, amplification efficiency not only depends on the primer characteristics, but also varies among different cDNA samples. Using a standard curve for only one set of tested samples to derive the amplification efficiency might overlook the error introduced by sample differences. In our experimental design, we have performed standard curve experiments with four concentrations of three replicates for all samples and genes involved. The ΔΔCt will derive from the standard curves only, and the data quality is examined for each gene and sample combination. The analysis of two samples is presented in the paper as an example. A minimal of PCRs of two replicates in three concentrations will be required for each sample. Even though more effort is required, the data is more reliable out of stringent data quality control and data analysis based on statistical models.
The output dataset included Ct number, gene name, sample name, concentration and replicate. We used Microsoft® Excel to open the exported Ct file from an ABI 7000 sequence analysis system and then to transform data into a tab delimited text file for SAS processing. The sample data set is shown in Table 1.
All programs were developed with SAS 9.1 (SAS Institute).
Full text: Click here
Publication 2006
DNA, Complementary DNA Replication Genes Oligonucleotide Primers Polymerase Chain Reaction
ChIP-seq analysis was performed in biological replicate as described4 using antibodies validated by Western blots and peptide competitions. ChIP DNA and input controls were sequenced using the Illumina Genome Analyzer. Expression profiles were acquired using Affymetrix GeneChip arrays. Chromatin states were learned jointly by applying an HMM8 to 10 data tracks for each of the 9 cell types. We focused on a 15 state model that provides sufficient resolution to resolve biologically-meaningful patterns yet is reproducible across cell types when independently processed. We used this model to produce 9 genome-wide chromatin state annotations, which were validated by additional ChIP experiments and reporter assays. Multi-cell type clustering was conducted on locations assigned to strong promoter state 1 (or strong enhancer state 4) in at least one cell type using the k-means algorithm. Enhancer-target gene linkages were predicted by correlating normalized signal intensities of H3K27ac, H3K4me1 and H3K4me2 with gene expression across cell types as a function of distance to the TSS. Upstream regulators were predicted using a set of known TF motifs assembled from multiple sources. Motif instances were identified by sequence match and evolutionary conservation. P-values for GWAS studies were based on randomizing the location of SNPs, and the FDR based on randomizing the assignment of SNPs across studies. Datasets are available from the ENCODE website (http://genome.ucsc.edu/ENCODE), the supporting website for this paper (http://compbio.mit.edu/ENCODE_chromatin_states), and the Gene Expression Omnibus (GSE26386).
Publication 2011
Antibodies Biological Assay Biological Evolution Biopharmaceuticals Cells Chromatin Chromatin Immunoprecipitation Sequencing DNA Chips DNA Replication Gene Chips Gene Expression Genome Genome-Wide Association Study Linkage, Genetic Peptides Physiology, Cell Single Nucleotide Polymorphism Western Blot

Most recents protocols related to «DNA Replication»

Not available on PMC !

Example 7

The MTT Cell Proliferation assay determines cell survival following apple stem cell extract treatment. The purpose was to evaluate the potential anti-tumor activity of apple stem cell extracts as well as to evaluate the dose-dependent cell cytotoxicity.

Principle: Treated cells are exposed to 3-(4,5-dimethythiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT). MTT enters living cells and passes into the mitochondria where it is reduced by mitochondrial succinate dehydrogenase to an insoluble, colored (dark purple) formazan product. The cells are then solubilized with DMSO and the released, solubilized formazan is measured spectrophotometrically. The MTT assay measures cell viability based on the generation of reducing equivalents. Reduction of MTT only occurs in metabolically active cells, so the level of activity is a measure of the viability of the cells. The percentage cell viability is calculated against untreated cells.

Method: A549 and NCI-H520 lung cancer cell lines and L132 lung epithelial cell line were used to determine the plant stem cell treatment tumor-specific cytotoxicity. The cell lines were maintained in Minimal Essential Media supplemented with 10% FBS, penicillin (100 U/ml) and streptomycin (100 μg/ml) in a 5% CO2 at 37 Celsius. Cells were seeded at 5×103 cells/well in 96-well plates and incubated for 48 hours. Triplicates of eight concentrations of the apple stem cell extract were added to the media and cells were incubated for 24 hours. This was followed by removal of media and subsequent washing with the phosphate saline solution. Cell proliferation was measured using the MTT Cell Proliferation Kit I (Boehringer Mannheim, Indianapolis, IN) New medium containing 50 μl of MTT solution (5 mg/ml) was added to each well and cultures were incubated a further 4 hours. Following this incubation, DMSO was added and the cell viability was determined by the absorbance at 570 nm by a microplate reader.

In order to determine the effectiveness of apple stem cell extracts as an anti-tumor biological agent, an MTT assay was carried out and IC50 values were calculated. IC50 is the half maximal inhibitory function concentration of a drug or compound required to inhibit a biological process. The measured process is cell death.

Results: ASC-Treated Human Lung Adenocarcinoma Cell Line A549.

TABLE 7
Results of cytotoxicity of apple stem cell extract on lung cancer cell
line A549 as measured by MTT assay (performed in triplicate).
Values of replicates are % of cell death.
Concentration*replicatereplicatereplicateMean of% Live
(μg/ml)123replicatesSDSEMCells
25093.1890.8690.3491.461.510.878.54
10086.8885.1885.6985.920.870.5014.08
5080.5879.4981.0480.370.800.4619.63
2574.2873.8176.3974.831.380.7925.17
12.567.9868.1371.7569.282.131.2330.72
6.2561.6762.4567.1063.742.931.6936.26
3.12555.3756.7762.4558.203.752.1641.80
1.56249.0751.0857.8052.654.572.6447.35
0.78142.7745.4053.1547.115.403.1252.89

Results: ASC-Treated Human Squamous Carcinoma Cell Line NCI-H520.

TABLE 8
Results of cytotoxicity of apple stem cell extract on lung cancer
cell line NCI-H520 measured by MTT assay (performed in triplicate).
Values of replicates are % of cell death.
Concen-%
tration*replicatereplicatereplicateMean ofLive
(μg/ml)123replicatesSDSEMcell
25088.2889.2987.7388.430.790.4611.57
10078.1379.1978.1378.480.610.3521.52
5067.9869.0968.5468.540.560.3231.46
2557.8358.9958.9458.590.660.3841.41
12.547.6848.8949.3448.640.860.5051.36
6.2537.5338.7939.7538.691.110.6461.31
3.12527.3728.6930.1528.741.390.8071.26
1.56217.2218.5920.5618.791.680.9781.21
0.781 7.07 8.4810.96 8.841.971.1491.16

Results: ASC-treated Lung Epithelial Cell Line L132.

TABLE 9
Results of cytotoxicity of apple stem cell extract on
lung epithelial cell line L132 as measured by MTT assay
(performed in triplicate). Values of replicates are % of cell death.
Concen-rep-rep-rep-Mean%
tration*licatelicatelicateofLive
(μg/ml)123replicatesSDSEMcell
25039.5142.5244.0342.022.301.3357.98
10032.9334.4433.6933.690.750.4466.31
5030.6028.9430.5230.020.940.5469.98
2527.9627.8127.1327.630.440.2572.37
12.525.6225.5525.4025.520.120.0774.48
6.2523.1320.8718.6120.872.261.3179.13
3.12513.3411.0811.8312.081.150.6687.92
1.562 6.56 7.31 9.57 7.811.570.9192.19
0.781 8.06 4.30 3.54 5.302.421.4094.70

Summary Results: Cytotoxicity of Apple Stem Cell Extracts.

TABLE 10
IC50 values of the apple stem cell extracts on the on the target
cell lines as determined by MTT assay.
Target Cell
LineIC50
A54912.58
NCI-H52010.21
L132127.46

Apple stem cell extracts killed lung cancer cells lines A549 and NCI-H520 at relatively low doses: IC50s were 12.58 and 10.21 μg/ml respectively as compared to 127.46 μg/ml for the lung epithelial cell line L132. Near complete anti-tumor activity was seen at a dose of 250 μg/ml in both the lung cancer cell lines. This same dose spared more than one half of the L132 cells. See Tables 7-10. The data revealed that apple stem cell extract is cytotoxic to lung cancer cells while sparing lung epithelial cells. FIG. 6 shows a graphical representation of cytotoxicity activity of apple stem cell extracts on lung tumor cell lines A549, NCIH520 and on L132 lung epithelial cell line (marked “Normal”). The γ-axis is the mean % of cells killed by the indicated treatment compared to unexposed cells. The difference in cytotoxicity levels was statistically significant at p≤05.

Example 9

The experiment of Example 7 was repeated substituting other plant materials for ASC. Plant stem cell materials included Dandelion Root Extract (DRE), Aloe Vera Juice (AVJ), Apple Fiber Powder (AFP), Ginkgo Leaf Extract (GLE), Lingonberry Stem Cells (LSC), Orchid Stem Cells (OSC) as described in Examples 1 and 2. The concentrations of plant materials used were nominally 250, 100, 50, 25, 6.25, 3.125, 1.562, and 0.781 μg/mL. These materials were tested only for cells the human lung epithelial cell line L132 (as a proxy for normal epithelial cells) and for cells of the human lung adenocarcinoma cell line A549 (as a proxy for lung cancer cells).

A549 cells lung cancer cell line cytotoxicity results for each of the treatment materials.

DRE-Treated Lung Cancer Cell Line A549 Cells.

TABLE 11
Triplicate results of cell death of DRE-treated
A549 cells measured by MTT assay.
Percentage of live cells calculated as 100% − Mean of triplicates.
Concentration%
(μg/mL)-DRE-Live
treated A549% of cell deathMeanSDSEMcell
25080.4376.4074.8477.232.891.6722.77
10067.6075.2663.7768.885.853.3831.12
5065.3262.9459.9462.732.701.5637.27
2556.8357.9748.1454.315.383.1145.69
6.2555.5949.6949.1751.483.572.0648.52
3.12551.7648.4545.3448.523.211.8551.48
1.56243.6944.0036.0241.244.522.6158.76
0.78137.4726.1919.5727.749.055.2372.26

AVJ-Treated Lung Cancer Cell line A549 Cells.

TABLE 12
Triplicate results of cell death of AVJ-treated
A549 cells measured by MTT assay.
Percentage of live cells calculated as 100% − Mean of triplicates.
Concentration%
(μg/mL)-AVJ-treatedLive
A549% of cell deathMeanSDSEMcell
25076.8178.1675.8876.951.140.6623.05
10076.4075.2673.7175.121.350.7824.88
5065.3266.1559.9463.803.371.9536.20
2550.1048.4556.6351.734.322.5048.27
6.2547.5246.3846.1746.690.720.4253.31
3.12539.8638.6143.7940.752.701.5659.25
1.56232.4019.7730.5427.576.823.9472.43
0.78120.5015.6332.1922.778.514.9277.23

AFP-Treated Lung Cancer Cell line A549 Cells.

TABLE 13
Triplicate results of cell death of AFP-treated
A549 cells measured by MTT assay.
Percentage of live cells calculated as 100% − Mean of triplicates.
Concentration%
(μg/mL)-AFP-treatedLive
A549% of cell deathMeanSDSEMcell
25086.1387.9986.6586.920.960.5613.08
10079.5081.0682.0980.881.300.7519.12
5073.6072.4671.3372.461.140.6627.54
2568.0167.7066.9867.560.530.3132.44
6.2560.8762.1160.7761.250.750.4338.75
3.12549.4851.7650.7250.661.140.6649.34
1.56240.0641.7247.0042.933.622.0957.07
0.78139.2337.7836.8537.961.200.6962.04

GLE-treated Lung Cancer Cell line A549 Cells.

TABLE 14
Triplicate results of cell death of GLE-treated
A549 cells measured by MTT assay.
Percentage of live cells calculated as 100% − Mean of triplicates.
Concentration%
(μg/mL)-GLE-treatedLive
A549% of cell deathMeanSDSEMcell
25088.4291.4990.4490.121.560.909.88
10084.3983.7783.1683.770.610.3516.23
5079.4781.5876.7579.272.421.4020.73
2573.6072.5471.4072.511.100.6327.49
6.2562.8963.6859.9162.161.991.1537.84
3.12550.1854.4751.8452.162.171.2547.84
1.56246.9344.3043.3344.851.861.0755.15
0.78139.5639.3940.9639.970.870.5060.03

LSC-treated lung cancer cell lines A549 cells.

TABLE 15
Triplicate results of cell death of LSC-treated
A549 cells measured by MTT assay.
Percentage of live cells calculated as 100% − Mean of triplicates.
Concentration
(μg/mL)% Live
LSC treated A549% of cell deathMeanSDSEMcell
25077.5478.8578.2078.200.650.3821.80
10077.1476.0476.5976.590.550.3223.41
5066.4268.5266.8267.251.120.6532.75
2559.8067.2264.1663.733.732.1536.27
6.2550.5348.8248.0749.141.260.7350.86
3.12541.1443.6042.7242.491.240.7257.51
1.56239.4739.7440.6139.940.600.3460.06
0.78138.5531.8336.7935.723.482.0164.28

OSC-treated Lung Cancer Cell line A549 Cells.

TABLE 16
Triplicate results of cell death of OSC-treated
A549 cells measured by MTT assay.
Percentage of live cells calculated as 100% − Mean of triplicates.
Concentration
(μg/mL)% Live
OSC-treated A549% of cell deathMeanSDSEMcell
25070.8465.5771.4969.303.251.8730.70
10048.8150.9157.2852.334.412.5547.67
5046.5949.6053.3349.843.381.9550.16
2538.7740.8136.5838.722.111.2261.28
6.2535.7440.7941.0539.193.001.7360.81
3.12534.5533.6837.0235.081.731.0064.92
1.56233.8633.4427.6331.643.482.0168.36
0.78121.3220.0034.8225.388.214.7474.62

L132 cells (“normal” lung epithelial cell line) cytotoxicity results for each of the treatment materials.

DRE-Treated Lung Epithelial Cell Line L132 cells.

TABLE 17
Triplicate results of cell death of DRE-treated
L132 cells measured by MTT assay.
Percentage of live cells calculated as 100% − Mean of triplicates.
Concentration% of %
(μg/mL)cellLive
DRE-treated L132deathMeanSDSEMcell
25086.6686.6186.6686.640.030.0213.36
10076.2977.3976.8476.840.550.3223.16
5065.9268.1767.0167.031.130.6532.97
2555.5458.9557.1957.231.700.9842.77
6.2545.1749.7347.3747.422.281.3252.58
3.12534.8040.5037.5437.612.851.6562.39
1.56224.4231.2827.7227.813.431.9872.19
0.78114.0522.0617.8918.004.012.3182.00

AVJ-Treated Lung Epithelial Cell Line L132 cells.

TABLE 18
Triplicate results of cell death of AVJ-treated
L132 cells measured by MTT assay.
Percentage of live cells calculated as 100% − Mean of triplicates
AFP-treated lung epithelial cell line L132 cells.
Concentration % of %
(μg/mL)cellLive
AVJ-treated L132deathMeanSDSEMcell
25057.0355.9353.6255.531.741.0044.47
10050.9949.7847.0449.272.031.1750.73
5044.9543.6340.4543.012.311.3456.99
2538.9137.4933.8636.752.601.5063.25
6.2532.8831.3427.2830.502.891.6769.50
3.12526.8425.1920.6924.243.181.8475.76
1.56220.8019.0514.1117.983.472.0082.02
0.78114.7612.90 7.5211.733.762.1788.27

AFP-Treated Lung Epithelial Cell Line L132 cells.

TABLE 19
Triplicate results of cell death of AFP-treated
L132 cells measured by MTT assay.
Percentage of live cells calculated as 100% − Mean of triplicates
AFP-treated lung epithelial cell line L132 cells.
Concentration
(μg/mL)% Live
AFP-treated L132% of cell deathMeanSDSEMcell
25056.1555.4357.1956.260.880.5143.74
10049.9548.2447.6448.611.200.6951.39
5043.7441.0538.0940.962.831.6359.04
2537.5433.8628.5433.324.532.6166.68
6.2531.3426.6718.9925.676.243.6074.33
3.12525.1419.489.4418.027.954.5981.98
1.56218.9412.2910.8714.034.312.4985.97
0.78112.73 5.10 6.81 8.214.002.3191.79

GLE-Treated Lung Epithelial Cell Line L132 cells.

TABLE 20
Triplicate results of cell death of GLE-treated
L132 cells measured by MTT assay.
Percentage of live cells calculated as 100% − Mean of triplicates
AFP-treated lung epithelial cell line L132 cells.
Concentration
(μg/mL)% Live
GLE-treated L132% of cell deathMeanSDSEMcell
25084.4283.2083.0883.570.740.4316.43
10080.0579.2978.5979.310.730.4220.69
5072.7571.5974.1072.811.260.7227.19
2580.0581.8679.9980.631.060.6119.37
6.2568.2670.1368.2668.881.080.6231.12
3.12560.6263.0760.6261.441.410.8238.56
1.56248.0748.7748.8348.560.420.2451.44
0.78146.2745.5746.6746.170.560.3253.83

LSC-Treated Lung Epithelial Cell Line L132 cells.

TABLE 21
Triplicate results of cell death of LSC-treated
L132 cells measured by MTT assay.
Percentage of live cells calculated as 100% − Mean of triplicates
AFP-treated lung epithelial cell line L132 cells.
Concentration
(μg/mL)% Live
LSC-treated L132% of cell deathMeanSDSEMcell
25086.4185.8285.7686.000.350.2014.00
10081.2181.2779.9980.820.720.4219.18
5075.9674.7473.5174.741.230.7125.26
2574.7472.7571.4772.991.650.9527.01
6.2570.1368.3268.2668.901.060.6131.10
3.12554.0358.0553.4455.172.511.4544.83
1.56253.9751.9851.9852.641.150.6647.36
0.78146.7945.6244.9245.78 0.940.54 54.22

OSC-Treated Lung Epithelial Cell Line L132 cells.

TABLE 22
Triplicate results of cell death of OSC-treated
L132 cells measured by MTT assay.
Percentage of live cells calculated as 100% − Mean of triplicates
AFP-treated lung epithelial cell line L132 cells.
Concentration %
(μg/mL)Live
OSC-treated L132% of cell deathMeanSDSEMcell
25061.8462.3760.4461.551.000.5738.45
10054.1453.4452.1053.231.040.6046.77
5042.9442.3040.3241.851.370.7958.15
2535.9434.4833.3134.581.320.7665.42
6.2533.9632.6732.0332.890.980.5767.11
3.12527.4826.2026.7226.800.650.3773.20
1.562 9.80 7.29 7.35 8.151.430.8391.85
0.781 7.29 8.98 8.05 8.110.850.4991.89

Calculated values.

TABLE 23
Calculated IC50 doses (ug/mL) and therapeutic ratios
(IC50 for L132 cells/IC50 for A549 cells) for each
treatment material. Values greater than one indicate
that a material would be more selective in killing cancer
cells than normal cells. ASC results imported from
Example 8. These studies indicate that at least
some of the materials may be effective anti-cancer agents.
ASC has outstanding selectivity compared to other materials.
ASCDREAVJAFPGLELSCOSC
A549 12.589.82211.4811.9811.1 13.733.9 
IC50
L132 127.4656.88 62.6682.6577.6369.26715.38
IC50
Ther.10.15.8 5.56.97.0 0.70.5
Ratio

Full text: Click here
Patent 2024
14-3-3 Proteins 43-63 61-26 A549 Cells Action Potentials Adenocarcinoma of Lung Aloe Aloe vera Antineoplastic Agents Biological Assay Biological Factors Biological Processes Bromides Cardiac Arrest Cell Death Cell Extracts Cell Lines Cell Proliferation Cells Cell Survival Cytotoxin diphenyl DNA Replication Epistropheus Epithelial Cells Fibrosis Formazans Genetic Selection Ginkgo biloba Ginkgo biloba extract Homo sapiens Lingonberry Lung Lung Cancer Lung Neoplasms Malignant Neoplasms Mitochondria Mitochondrial Inheritance Neoplasms Neoplastic Stem Cells Oral Cavity PEG SD-01 Penicillins Pharmaceutical Preparations Phosphates Plant Cells Plant Leaves Plant Roots Plants Powder Psychological Inhibition Saline Solution SD 31 SD 62 SEM-76 Squamous Cell Carcinoma Stem, Plant Stem Cells Streptomycin Succinate Dehydrogenase Sulfoxide, Dimethyl Taraxacum Tetrazolium Salts
Not available on PMC !

Example 1

Cells were treated with the indicated compounds for 7 hours before lysis with Buffer RLT (QIAGEN, Hilden, Germany) containing 1% β-mercaptoethanol. Total RNA was isolated using the Rneasy Plus Mini kit (QIAGEN, Hilden, Germany) according to the manufacturer's instructions. First-strand cDNA was synthesized using the SuperScript VILO Master Mix (Thermo Fisher Scientific, Waltham, MA) according to the manufacturer's instructions. Real-time qPCR was run on ViiA 7 Real Time PCR System (Thermo Fisher Scientific). For qRT-PCR, the expression of the reference gene glucuronidase beta (GUSB) was used to normalize expression of the target genes DUSP6, SPRY4, and glycogen synthase kinase 3 beta (GSK3B). Replicate qRT-PCR reactions were analyzed for each sample, and QuantStudio Real-Time PCR software (Life Technologies, Carlsbad, CA) normalized the average expression of DUSP6, SPRY4, or GSK3B to the average expression of the reference gene GUSB in each sample. FIGS. 1A-1C show relative transcript expression of RET pathway targets DUSP6 and SPRY4 and AKT-pathway target GSK3B 7 hours after treatment of L2C/ad cells (FIG. 1A), MZ-CRC-1 cells (FIG. 1B), or TT MTC cells (FIG. 1C) with Compound 1 or cabozantinib. FIG. 2 shows relative transcript expression of DUSP6, SPRY4 and GSK3B from KIF5B-RET NSCLC PDX. Tumors collected at the indicated times (hours) after administration of last dose. Data are the mean+SD. *P<0.05, **P<0.01, ***P<0.001, 2-sided Student's t-test. SD, standard deviation.

Full text: Click here
Patent 2024
2-Mercaptoethanol beta-Glucuronidase Buffers cabozantinib Cells DNA, Complementary DNA Replication DUSP6 protein, human Gene Expression Genes Glycogen Synthase Kinase 3 beta KIF5B protein, human Neoplasms Non-Small Cell Lung Carcinoma Real-Time Polymerase Chain Reaction

Example 2

A. Seed Treatment with Isolated Microbe

In this example, an isolated microbe from Tables 1-3 will be applied as a seed coating to seeds of corn (Zea mays). Upon applying the isolated microbe as a seed coating, the corn will be planted and cultivated in the standard manner.

A control plot of corn seeds, which did not have the isolated microbe applied as a seed coating, will also be planted.

It is expected that the corn plants grown from the seeds treated with the seed coating will exhibit a quantifiably higher biomass than the control corn plants.

The biomass from the treated plants may be about 1-10% higher, 10-20% higher, 20-30% higher, 30-40% higher, 40-50% higher, 50-60% higher, 60-70% higher, 70-80% higher, 80-90% higher, or more.

The biomass from the treated plants may equate to about a 1 bushel per acre increase over the controls, or a 2 bushel per acre increase, or a 3 bushel per acre increase, or a 4 bushel per acre increase, or a 5 bushel per acre increase, or more.

In some aspects, the biomass increase is statistically significant. In other aspects, the biomass increase is not statistically significant, but is still quantifiable.

B. Seed Treatment with Microbial Consortia

In this example, a microbial consortium, comprising at least two microbes from Tables 1-3 will be applied as a seed coating to seeds of corn (Zea mays). Upon applying the microbial consortium as a seed coating, the corn will be planted and cultivated in the standard manner.

A control plot of corn seeds, which did not have the microbial consortium applied as a seed coating, will also be planted.

It is expected that the corn plants grown from the seeds treated with the seed coating will exhibit a quantifiably higher biomass than the control corn plants.

The biomass from the treated plants may be about 1-10% higher, 10-20% higher, 20-30% higher, 30-40% higher, 40-50% higher, 50-60% higher, 60-70% higher, 70-80% higher, 80-90% higher, or more.

The biomass from the treated plants may equate to about a 1 bushel per acre increase over the controls, or a 2 bushel per acre increase, or a 3 bushel per acre increase, or a 4 bushel per acre increase, or a 5 bushel per acre increase, or more.

In some aspects, the biomass increase is statistically significant. In other aspects, the biomass increase is not statistically significant, but is still quantifiable.

C. Treatment with Agricultural Composition Comprising Isolated Microbe

In this example, an isolated microbe from Tables 1-3 will be applied as an agricultural composition, administered to the corn seed at the time of sowing.

For example, it is anticipated that a farmer will apply the agricultural composition to the corn seeds simultaneously upon planting the seeds into the field. This can be accomplished, for example, by applying the agricultural composition to a hopper/bulk tank on a standard 16 row planter, which contains the corn seeds and which is configured to plant the same into rows. Alternatively, the agricultural composition can be contained in a separate bulk tank on the planter and sprayed into the rows upon planting the corn seed.

A control plot of corn seeds, which are not administered the agricultural composition, will also be planted.

It is expected that the corn plants grown from the seeds treated with the agricultural composition will exhibit a quantifiably higher biomass than the control corn plants.

The biomass from the treated plants may be about 1-10% higher, 10-20% higher, 20-30% higher, 30-40% higher, 40-50% higher, 50-60% higher, 60-70% higher, 70-80% higher, 80-90% higher, or more.

The biomass from the treated plants may equate to about a 1 bushel per acre increase over the controls, or a 2 bushel per acre increase, or a 3 bushel per acre increase, or a 4 bushel per acre increase, or a 5 bushel per acre increase, or more.

In some aspects, the biomass increase is statistically significant. In other aspects, the biomass increase is not statistically significant, but is still quantifiable.

D. Treatment with Agricultural Composition Comprising Microbial Consortia

In this example, a microbial consortium, comprising at least two microbes from Tables 1-3 will be applied as an agricultural composition, administered to the corn seed at the time of sowing.

For example, it is anticipated that a farmer will apply the agricultural composition to the corn seeds simultaneously upon planting the seeds into the field. This can be accomplished, for example, by applying the agricultural composition to a hopper/bulk tank on a standard 16 row planter, which contains the corn seeds and which is configured to plant the same into rows. Alternatively, the agricultural composition can be contained in a separate bulk tank on the planter and sprayed into the rows upon planting the corn seed.

A control plot of corn seeds, which are not administered the agricultural composition, will also be planted.

It is expected that the corn plants grown from the seeds treated with the agricultural composition will exhibit a quantifiably higher biomass than the control corn plants.

The biomass from the treated plants may be about 1-10% higher, 10-20% higher, 20-30% higher, 30-40% higher, 40-50% higher, 50-60% higher, 60-70% higher, 70-80% higher, 80-90% higher, or more.

The biomass from the treated plants may equate to about a 1 bushel per acre increase over the controls, or a 2 bushel per acre increase, or a 3 bushel per acre increase, or a 4 bushel per acre increase, or a 5 bushel per acre increase, or more.

In some aspects, the biomass increase is statistically significant. In other aspects, the biomass increase is not statistically significant, but is still quantifiable.

A. Seed Treatment with Isolated Microbe

In this example, an isolated microbe from Tables 1-3 will be applied as a seed coating to seeds of corn (Zea mays). Upon applying the isolated microbe as a seed coating, the corn will be planted and cultivated in the standard manner.

A control plot of corn seeds, which did not have the isolated microbe applied as a seed coating, will also be planted.

It is expected that the corn plants grown from the seeds treated with the seed coating will exhibit a quantifiable and superior ability to tolerate drought conditions and/or exhibit superior water use efficiency, as compared to the control corn plants.

The drought tolerance and/or water use efficiency can be based on any number of standard tests from the art, e.g leaf water retention, turgor loss point, rate of photosynthesis, leaf color and other phenotypic indications of drought stress, yield performance, and various root morphological and growth patterns.

B. Seed Treatment with Microbial Consortia

In this example, a microbial consortium, comprising at least two microbes from Tables 1-3 will be applied as a seed coating to seeds of corn (Zea mays). Upon applying the microbial consortium as a seed coating, the corn will be planted and cultivated in the standard manner.

A control plot of corn seeds, which did not have the microbial consortium applied as a seed coating, will also be planted.

It is expected that the corn plants grown from the seeds treated with the seed coating will exhibit a quantifiable and superior ability to tolerate drought conditions and/or exhibit superior water use efficiency, as compared to the control corn plants.

The drought tolerance and/or water use efficiency can be based on any number of standard tests from the art, e.g leaf water retention, turgor loss point, rate of photosynthesis, leaf color and other phenotypic indications of drought stress, yield performance, and various root morphological and growth patterns.

C. Treatment with Agricultural Composition Comprising Isolated Microbe

In this example, an isolated microbe from Tables 1-3 will be applied as an agricultural composition, administered to the corn seed at the time of sowing.

For example, it is anticipated that a farmer will apply the agricultural composition to the corn seeds simultaneously upon planting the seeds into the field. This can be accomplished, for example, by applying the agricultural composition to a hopper/bulk tank on a standard 16 row planter, which contains the corn seeds and which is configured to plant the same into rows. Alternatively, the agricultural composition can be contained in a separate bulk tank on the planter and sprayed into the rows upon planting the corn seed.

A control plot of corn seeds, which are not administered the agricultural composition, will also be planted.

It is expected that the corn plants grown from the seeds treated with the with the agricultural composition will exhibit a quantifiable and superior ability to tolerate drought conditions and/or exhibit superior water use efficiency, as compared to the control corn plants.

The drought tolerance and/or water use efficiency can be based on any number of standard tests from the art, e.g leaf water retention, turgor loss point, rate of photosynthesis, leaf color and other phenotypic indications of drought stress, yield performance, and various root morphological and growth patterns.

D. Treatment with Agricultural Composition Comprising Microbial Consortia

In this example, a microbial consortium, comprising at least two microbes from Tables 1-3 will be applied as an agricultural composition, administered to the corn seed at the time of sowing.

For example, it is anticipated that a farmer will apply the agricultural composition to the corn seeds simultaneously upon planting the seeds into the field. This can be accomplished, for example, by applying the agricultural composition to a hopper/bulk tank on a standard 16 row planter, which contains the corn seeds and which is configured to plant the same into rows. Alternatively, the agricultural composition can be contained in a separate bulk tank on the planter and sprayed into the rows upon planting the corn seed.

A control plot of corn seeds, which are not administered the agricultural composition, will also be planted.

It is expected that the corn plants grown from the seeds treated with the with the agricultural composition will exhibit a quantifiable and superior ability to tolerate drought conditions and/or exhibit superior water use efficiency, as compared to the control corn plants.

The drought tolerance and/or water use efficiency can be based on any number of standard tests from the art, e.g leaf water retention, turgor loss point, rate of photosynthesis, leaf color and other phenotypic indications of drought stress, yield performance, and various root morphological and growth patterns.

A. Seed Treatment with Isolated Microbe

In this example, an isolated microbe from Tables 1-3 will be applied as a seed coating to seeds of corn (Zea mays). Upon applying the isolated microbe as a seed coating, the corn will be planted and cultivated in the standard manner.

A control plot of corn seeds, which did not have the isolated microbe applied as a seed coating, will also be planted.

It is expected that the corn plants grown from the seeds treated with the seed coating will exhibit a quantifiable and superior ability to utilize nitrogen, as compared to the control corn plants.

The nitrogen use efficiency can be quantified by recording a measurable change in any of the main nitrogen metabolic pool sizes in the assimilation pathways (e.g., a measurable change in one or more of the following: nitrate, nitrite, ammonia, glutamic acid, aspartic acid, glutamine, asparagine, lysine, leucine, threonine, methionine, glycine, tryptophan, tyrosine, total protein content of a plant part, total nitrogen content of a plant part, and/or chlorophyll content), or where the treated plant is shown to provide the same or elevated biomass or harvestable yield at lower nitrogen fertilization levels compared to the control plant, or where the treated plant is shown to provide elevated biomass or harvestable yields at the same nitrogen fertilization levels compared to a control plant.

B. Seed Treatment with Microbial Consortia

In this example, a microbial consortium, comprising at least two microbes from Tables 1-3 will be applied as a seed coating to seeds of corn (Zea mays). Upon applying the microbial consortium as a seed coating, the corn will be planted and cultivated in the standard manner.

A control plot of corn seeds, which did not have the microbial consortium applied as a seed coating, will also be planted.

It is expected that the corn plants grown from the seeds treated with the seed coating will exhibit a quantifiable and superior ability to utilize nitrogen, as compared to the control corn plants.

The nitrogen use efficiency can be quantified by recording a measurable change in any of the main nitrogen metabolic pool sizes in the assimilation pathways (e.g., a measurable change in one or more of the following: nitrate, nitrite, ammonia, glutamic acid, aspartic acid, glutamine, asparagine, lysine, leucine, threonine, methionine, glycine, tryptophan, tyrosine, total protein content of a plant part, total nitrogen content of a plant part, and/or chlorophyll content), or where the treated plant is shown to provide the same or elevated biomass or harvestable yield at lower nitrogen fertilization levels compared to the control plant, or where the treated plant is shown to provide elevated biomass or harvestable yields at the same nitrogen fertilization levels compared to a control plant.

C. Treatment with Agricultural Composition Comprising Isolated Microbe

In this example, an isolated microbe from Tables 1-3 will be applied as an agricultural composition, administered to the corn seed at the time of sowing.

For example, it is anticipated that a farmer will apply the agricultural composition to the corn seeds simultaneously upon planting the seeds into the field. This can be accomplished, for example, by applying the agricultural composition to a hopper/bulk tank on a standard 16 row planter, which contains the corn seeds and which is configured to plant the same into rows. Alternatively, the agricultural composition can be contained in a separate bulk tank on the planter and sprayed into the rows upon planting the corn seed.

A control plot of corn seeds, which are not administered the agricultural composition, will also be planted.

It is expected that the corn plants grown from the seeds treated with the agricultural composition will exhibit a quantifiable and superior ability to utilize nitrogen, as compared to the control corn plants.

The nitrogen use efficiency can be quantified by recording a measurable change in any of the main nitrogen metabolic pool sizes in the assimilation pathways (e.g., a measurable change in one or more of the following: nitrate, nitrite, ammonia, glutamic acid, aspartic acid, glutamine, asparagine, lysine, leucine, threonine, methionine, glycine, tryptophan, tyrosine, total protein content of a plant part, total nitrogen content of a plant part, and/or chlorophyll content), or where the treated plant is shown to provide the same or elevated biomass or harvestable yield at lower nitrogen fertilization levels compared to the control plant, or where the treated plant is shown to provide elevated biomass or harvestable yields at the same nitrogen fertilization levels compared to a control plant.

D. Treatment with Agricultural Composition Comprising Microbial Consortia

In this example, a microbial consortium, comprising at least two microbes from Tables 1-3 will be applied as an agricultural composition, administered to the corn seed at the time of sowing.

For example, it is anticipated that a farmer will apply the agricultural composition to the corn seeds simultaneously upon planting the seeds into the field. This can be accomplished, for example, by applying the agricultural composition to a hopper/bulk tank on a standard 16 row planter, which contains the corn seeds and which is configured to plant the same into rows. Alternatively, the agricultural composition can be contained in a separate bulk tank on the planter and sprayed into the rows upon planting the corn seed.

A control plot of corn seeds, which are not administered the agricultural composition, will also be planted.

It is expected that the corn plants grown from the seeds treated with the agricultural composition will exhibit a quantifiable and superior ability to utilize nitrogen, as compared to the control corn plants.

The nitrogen use efficiency can be quantified by recording a measurable change in any of the main nitrogen metabolic pool sizes in the assimilation pathways (e.g., a measurable change in one or more of the following: nitrate, nitrite, ammonia, glutamic acid, aspartic acid, glutamine, asparagine, lysine, leucine, threonine, methionine, glycine, tryptophan, tyrosine, total protein content of a plant part, total nitrogen content of a plant part, and/or chlorophyll content), or where the treated plant is shown to provide the same or elevated biomass or harvestable yield at lower nitrogen fertilization levels compared to the control plant, or where the treated plant is shown to provide elevated biomass or harvestable yields at the same nitrogen fertilization levels compared to a control plant.

The inoculants were prepared from isolates grown as spread plates on R2A incubated at 25° C. for 48 to 72 hours. Colonies were harvested by blending with sterile distilled water (SDW) which was then transferred into sterile containers. Serial dilutions of the harvested cells were plated and incubated at 25° C. for 24 hours to estimate the number of colony forming units (CFU) in each suspension. Dilutions were prepared using individual isolates or blends of isolates (consortia) to deliver 1×105 cfu/microbe/seed and seeds inoculated by either imbibition in the liquid suspension or by overtreatment with 5% vegetable gum and oil.

Seeds corresponding to the plants of table 15 were planted within 24 to 48 hours of treatment in agricultural soil, potting media or inert growing media. Plants were grown in small pots (28 mL to 200 mL) in either a controlled environment or in a greenhouse. Chamber photoperiod was set to 16 hours for all experiments on all species. Air temperature was typically maintained between 22-24° C.

Unless otherwise stated, all plants were watered with tap water 2 to 3 times weekly. Growth conditions were varied according to the trait of interest and included manipulation of applied fertilizer, watering regime and salt stress as follows:

    • Low N—seeds planted in soil potting media or inert growing media with no applied N fertilizer
    • Moderate N—seeds planted in soil or growing media supplemented with commercial N fertilizer to equivalent of 135 kg/ha applied N
    • Insol P—seeds planted in potting media or inert growth substrate and watered with quarter strength Pikovskaya's liquid medium containing tri-calcium phosphate as the only form phosphate fertilizer.
    • Cold Stress—seeds planted in soil, potting media or inert growing media and incubated at 10° C. for one week before being transferred to the plant growth room.
    • Salt stress—seeds planted in soil, potting media or inert growing media and watered with a solution containing between 100 to 200 mg/L NaCl.

Untreated (no applied microbe) controls were prepared for each experiment. Plants were randomized on trays throughout the growth environment. Between 10 and 30 replicate plants were prepared for each treatment in each experiment. Phenotypes were measured during early vegetative growth, typically before the V3 developmental stage and between 3 and 6 weeks after sowing. Foliage was cut and weighed. Roots were washed, blotted dry and weighed. Results indicate performance of treatments against the untreated control.

TABLE 15
StrainShootRoot
Microbe sp.IDCropAssayIOC (%)IOC (%)
Bosea thiooxidans123EfficacyEfficacy
overall100%100%
Bosea thiooxidans54522WheatEarly vigor - insol P30-40 
Bosea thiooxidans54522RyegrassEarly vigor50-60 50-60 
Bosea thiooxidans54522RyegrassEarly vigor - moderate P0-100-10
Duganella violaceinigra111EfficacyEfficacy
overall100%100%
Duganella violaceinigra66361TomatoEarly vigor0-100-10
Duganella violaceinigra66361TomatoEarly vigor30-40 40-50 
Duganella violaceinigra66361TomatoEarly vigor20-30 20-30 
Herbaspirillum huttiense222Efficacy
overall100%
Herbaspirillum huttiense54487WheatEarly vigor - insol P30-40 
Herbaspirillum huttiense60507MaizeEarly vigor - salt stress0-100-10
Janthinobacterium sp.222Efficacy
Overall100%
Janthinobacterium sp.54456WheatEarly vigor - insol P30-40 
Janthinobacterium sp.54456WheatEarly vigor - insol P0-10
Janthinobacterium sp.63491RyegrassEarly vigor - drought0-100-10
stress
Massilia niastensis112EfficacyEfficacy
overall80%80%
Massilia niastensis55184WheatEarly vigor - salt stress0-1020-30 
Massilia niastensis55184WinterEarly vigor - cold stress0-1010-20 
wheat
Massilia niastensis55184WinterEarly vigor - cold stress20-30 20-30 
wheat
Massilia niastensis55184WinterEarly vigor - cold stress10-20 10-20 
wheat
Massilia niastensis55184WinterEarly vigor - cold stress<0<0
wheat
Novosphingobium rosa211EfficacyEfficacy
overall100%100%
Novosphingobium rosa65589MaizeEarly vigor - cold stress0-100-10
Novosphingobium rosa65619MaizeEarly vigor - cold stress0-100-10
Paenibacillus amylolyticus111EfficacyEfficacy
overall100%100%
Paenibacillus amylolyticus66316TomatoEarly vigor0-100-10
Paenibacillus amylolyticus66316TomatoEarly vigor10-20 10-20 
Paenibacillus amylolyticus66316TomatoEarly vigor0-100-10
Pantoea agglomerans323EfficacyEfficacy
33%50%
Pantoea agglomerans54499WheatEarly vigor - insol P40-50 
Pantoea agglomerans57547MaizeEarly vigor - low N<00-10
Pantoea vagans55529MaizeEarly vigor<0<0
(formerly P. agglomerans)
Polaromonas ginsengisoli111EfficacyEfficacy
66%100%
Polaromonas ginsengisoli66373TomatoEarly vigor0-100-10
Polaromonas ginsengisoli66373TomatoEarly vigor20-30 30-40 
Polaromonas ginsengisoli66373TomatoEarly vigor<010-20 
Pseudomonas fluorescens122Efficacy
100%
Pseudomonas fluorescens54480WheatEarly vigor - insol P>100 
Pseudomonas fluorescens56530MaizeEarly vigor - moderate N0-10
Rahnella aquatilis334EfficacyEfficacy
80%63%
Rahnella aquatilis56532MaizeEarly vigor - moderate N10-20 
Rahnella aquatilis56532MaizeEarly vigor - moderate N0-100-10
Rahnella aquatilis56532WheatEarly vigor - cold stress0-1010-20 
Rahnella aquatilis56532WheatEarly vigor - cold stress<00-10
Rahnella aquatilis56532WheatEarly vigor - cold stress10-20 <0
Rahnella aquatilis57157RyegrassEarly vigor<0
Rahnella aquatilis57157MaizeEarly vigor - low N0-100-10
Rahnella aquatilis57157MaizeEarly vigor - low N0-10<0
Rahnella aquatilis58013MaizeEarly vigor0-1010-20 
Rahnella aquatilis58013MaizeEarly vigor - low N0-10<0
Rhodococcus erythropolis313Efficacy
66%
Rhodococcus erythropolis54093MaizeEarly vigor - low N40-50 
Rhodococcus erythropolis54299MaizeEarly vigor - insol P>100 
Rhodococcus erythropolis54299MaizeEarly vigor<0<0
Stenotrophomonas chelatiphaga611EfficacyEfficacy
60%60%
Stenotrophomonas chelatiphaga54952MaizeEarly vigor0-100-10
Stenotrophomonas chelatiphaga47207MaizeEarly vigor<0 0
Stenotrophomonas chelatiphaga64212MaizeEarly vigor0-1010-20 
Stenotrophomonas chelatiphaga64208MaizeEarly vigor0-100-10
Stenotrophomonas chelatiphaga58264MaizeEarly vigor<0<0
Stenotrophomonas maltophilia612EfficacyEfficacy
43%66%
Stenotrophomonas maltophilia54073MaizeEarly vigor - low N50-60 
Stenotrophomonas maltophilia54073MaizeEarly vigor<00-10
Stenotrophomonas maltophilia56181MaizeEarly vigor0-10<0
Stenotrophomonas maltophilia54999MaizeEarly vigor0-100-10
Stenotrophomonas maltophilia54850MaizeEarly vigor 00-10
Stenotrophomonas maltophilia54841MaizeEarly vigor<00-10
Stenotrophomonas maltophilia46856MaizeEarly vigor<0<0
Stenotrophomonas rhizophila811EfficacyEfficacy
12.5%37.5%
Stenotrophomonas rhizophila50839MaizeEarly vigor<0<0
Stenotrophomonas rhizophila48183MaizeEarly vigor<0<0
Stenotrophomonas rhizophila45125MaizeEarly vigor<0<0
Stenotrophomonas rhizophila46120MaizeEarly vigor<00-10
Stenotrophomonas rhizophila46012MaizeEarly vigor<0<0
Stenotrophomonas rhizophila51718MaizeEarly vigor0-100-10
Stenotrophomonas rhizophila66478MaizeEarly vigor<0<0
Stenotrophomonas rhizophila65303MaizeEarly vigor<00-10
Stenotrophomonas terrae221EfficacyEfficacy
50%50%
Stenotrophomonas terrae68741MaizeEarly vigor<0<0
Stenotrophomonas terrae68599MaizeEarly vigor<00-10
Stenotrophomonas terrae68599Capsicum *Early vigor20-30 20-30 
Stenotrophomonas terrae68741Capsicum *Early vigor10-20 20-30 

The data presented in table 15 describes the efficacy with which a microbial species or strain can change a phenotype of interest relative to a control run in the same experiment. Phenotypes measured were shoot fresh weight and root fresh weight for plants growing either in the absence of presence of a stress (assay). For each microbe species, an overall efficacy score indicates the percentage of times a strain of that species increased a both shoot and root fresh weight in independent evaluations. For each species, the specifics of each independent assay is given, providing a strain ID (strain) and the crop species the assay was performed on (crop). For each independent assay the percentage increase in shoot and root fresh weight over the controls is given.

Full text: Click here
Patent 2024
Ammonia Asparagine Aspartic Acid Biological Assay Bosea thiooxidans Calcium Phosphates Capsicum Cells Chlorophyll Cold Shock Stress Cold Temperature Crop, Avian Dietary Fiber DNA Replication Droughts Drought Tolerance Embryophyta Environment, Controlled Farmers Fertilization Glutamic Acid Glutamine Glycine Growth Disorders Herbaspirillum Herbaspirillum huttiense Leucine Lolium Lycopersicon esculentum Lysine Maize Massilia niastensis Methionine Microbial Consortia Nitrates Nitrites Nitrogen Novosphingobium rosa Paenibacillus Paenibacillus amylolyticus Pantoea agglomerans Pantoea vagans Phenotype Phosphates Photosynthesis Plant Development Plant Embryos Plant Leaves Plant Proteins Plant Roots Plants Polaromonas ginsengisoli Pseudoduganella violaceinigra Pseudomonas Pseudomonas fluorescens Rahnella Rahnella aquatilis Retention (Psychology) Rhodococcus erythropolis Rosa Salt Stress Sodium Chloride Sodium Chloride, Dietary Stenotrophomonas chelatiphaga Stenotrophomonas maltophilia Stenotrophomonas rhizophila Stenotrophomonas terrae Sterility, Reproductive Strains Technique, Dilution Threonine Triticum aestivum Tryptophan Tyrosine Vegetables Zea mays

Example 3

Investigation of Virus Infectivity as a Factor that Determines Plaque Size.

With the revelation that plaque formation is strongly influenced by the immunogenicity of the virus, the possibility that infectivity of the virus could be another factor that determines plaque sizes was investigated. The uptake of viruses into cells in vitro was determined by measuring the amounts of specific viral RNA sequences through real-time PCR.

To measure total viral RNA, total cellular RNA was extracted using the RNEasy Mini kit (Qiagen), and complementary DNA synthesized using the iScript cDNA Synthesis kit (Bio-Rad). To measure total viral RNA, quantitative real-time PCR was done using a primer pair targeting a highly conserved region of the 3′ UTR common to all four serotypes of dengue; inter-sample normalization was done using GAPDH as a control. Primer sequences are listed in Table 5. Pronase (Roche) was used at a concentration of 1 mg/mL and incubated with infected cells for five minutes on ice, before washing with ice cold PBS. Total cellular RNA was then extracted from the cell pellets in the manner described above.

TABLE 5
PCR primer sequences.
Gene TargetPrimer Sequence
DENV LYL 3′UTRForward: TTGAGTAAACYRTGCTGCCTGTA
TGCC (SEQ ID NO: 24)
Reverse: GAGACAGCAGGATCTCTGGTCTY
TC (SEQ ID NO: 25)
GAPDH (Human)Forward: GAGTCAACGGATTTGGTCGT
(SEQ ID NO: 26)
Reverse: TTGATTTTGGAGGGATCTCG
(SEQ ID NO: 27)
CXCL10 (Human)Forward: GGTGAGAAGAGATGTCTGAATCC
(SEQ ID NO: 28)
Reverse: GTCCATCCTTGGAAGCACTGCA
(SEQ ID NO: 29)
ISG20 (Human)Forward: ACACGTCCACTGACAGGCTGTT
(SEQ ID NO: 30)
Reverse: ATCTTCCACCGAGCTGTGTCCA
(SEQ ID NO: 31)
IFIT2 (Human)Forward: GAAGAGGAAGATTTCTGAAG
(SEQ ID NO: 32)
Reverse: CATTTTAGTTGCCGTAGG
(SEQ ID NO: 33)
IFNα (Canine)Forward: GCTCTTGTGACCACTACACCA
(SEQ ID NO: 34)
Reverse: AAGACCTTCTGGGTCATCACG
(SEQ ID NO: 35)
IFNβ (Canine)Forward: GGATGGAATGAGACCACTGTCG
(SEQ ID NO: 36)
Reverse: ACGTCCTCCAGGATTATCTCCA
(SEQ ID NO: 37)

The proportion of infected cells was assessed by flow cytometry. Cells were fixed and permeabilised with 3% paraformaldehyde and 0.1% saponin, respectively. DENV envelope (E) protein was stained with mouse monoclonal 4G2 antibody (ATCC) and AlexaFluor488 anti-mouse secondary antibody. Flow cytometry analysis was done on a BD FACS Canto II (BD Bioscience).

Unexpectedly, despite DENV-2 PDK53 inducing stronger antiviral immune responses, it had higher rates of uptake by HuH-7 cells compared to DENV-2 16681 (FIG. 5). This difference continued to be observed when DENV-2 PDK53 inoculum was reduced 10-fold. In contrast, DENV-3 PGMK30 and its parental strain DENV-3 16562 displayed the same rate of viral uptake in host cells. Furthermore, DENV-2 PDK53 showed a higher viral replication rate compared to DENV-2 16681. This was determined by measuring the percentage of cells that harbored DENV E-protein, detected using flow cytometry. DENV-2 PDK53 showed a higher percentage of infected cells compared to DENV-2 16681 at the same amount of MOI from Day 1 to 3 (FIG. 6). In contrast, DENV-3 PGMK30 showed a reverse trend and displayed lower percentage of infected cells compared to DENV-3 16562. Results here show that successfully attenuated vaccines, as exemplified by DENV-2 PDK53, have greater uptake and replication rate.

Results above demonstrate that the DENV-2 PDK53 and DENV-3 PGMK30 are polarized in their properties that influence plaque morphologies. While both attenuated strains were selected for their formation of smaller plaques compared to their parental strains, the factors leading to this outcome are different between the two.

Accordingly, this study has demonstrated that successfully attenuated vaccines, as exemplified by DENV-2 PDK53 in this study, form smaller plaques due to induction of strong innate immune responses, which is triggered by fast viral uptake and spread of infection. In contrast, DENV-3 PGMK30 form smaller plaques due to its slower uptake and growth in host cells, which inadvertently causes lower up-regulation of the innate immune response.

Based on the results presented in the foregoing Examples, the present invention provides a new strategy to prepare a LAV, which expedites the production process and ensures the generation of effectively attenuated viruses fit for vaccine use.

Full text: Click here
Patent 2024
Antibodies, Anti-Idiotypic Antigens, Viral Antiviral Agents Canis familiaris Cells Common Cold Cowpox virus Dengue Fever Dental Plaque DNA, Complementary DNA Replication Flow Cytometry GAPDH protein, human Genes Homo sapiens Immunity, Innate Infection Interferon-alpha Monoclonal Antibodies Mus Oligonucleotide Primers paraform Parent Pellets, Drug Pronase Proteins Real-Time Polymerase Chain Reaction Response, Immune RNA, Viral Saponin Senile Plaques Strains Vaccines Virus Virus Diseases Virus Replication

Example 3

Reciprocating tests were used to characterize both friction and wear behavior of the ester blends at 25° C. and 40° C. under boundary lubrication. As mentioned prior, each ester was blended at a concentration of 1% by weight. Neat oil served as the control. The testing device is a custom ball-on-flat microtribometer as seen in FIG. 3 and was operated in conjunction with a temperature-controlled stage. In brief, precise normal loading of a probe onto the sample substrate is performed via software controlled linear stages. The sample substrate is forced to slide against the probe and subsequent lateral or frictional forces are measured. The temperature-controlled stage consists of an aluminum block that contains an oil reservoir. The block's temperature is monitored and controlled via an adhesive thermocouple connected to a PID controller. In addition, the oil temperature is monitored with a thermistor. Prior to testing, an equal volume filled the reservoir and the oil temperature was equilibrated. The oil level sits just above the substrate surface so there is a constant supply of oil into the contact zone.

Reciprocating tests were carried out using a SiC-steel interface: a 4 mm diameter silicon carbide ball on an AISI 8620 steel substrate. The ceramic was chosen for its superior hardness relative to the substrate in order to isolate the majority of the wear to the substrate and preserve the probes geometry. In this way, a consistent contact pressure can be maintained. A constant normal load of 3.4 N (maximum Hertzian pressure of 1.5 GPa) was applied as the substrate was translated at a rate of 10 mm/s over a 8 mm stroke length for 4500 cycles. The load was chosen after initial tests with the PEs at 1.0 GPa were not sufficient to generate measureable wear scars (wear depths were on the same order as the surface roughness). The substrate was isotropically polished to a finish of 0.043 μm Ra determined from a scan area of 1.41 mm×1.88 mm using a Zygo optical profilometer. Based on EHL theory, the roughness, load, and viscosity parameters placed this study well within the boundary lubrication regime as the estimated λ ratio was much less than one.

After test completion, the substrate and probes were wiped with isopropyl alcohol before undergoing SEM and EDS analysis. In addition, the substrate wear scars were scanned using the Zygo optical profilometer. Nine to eleven unique scan areas were gathered to capture the entire length of each scar. All topographic and force data was then imported into MATLAB where the average wear depth and coefficient of friction was calculated. Three replicate tests were completed for each treatment.

Full text: Click here
Patent 2024
Aluminum Cardiac Arrest Cerebrovascular Accident Cicatrix DNA Replication Esters Friction Isopropyl Alcohol Lubrication Medical Devices Oil Reservoirs Pressure Radionuclide Imaging Steel Viscosity Vision

Top products related to «DNA Replication»

Sourced in United States, China, Japan, Germany, United Kingdom, Canada, France, Italy, Australia, Spain, Switzerland, Netherlands, Belgium, Lithuania, Denmark, Singapore, New Zealand, India, Brazil, Argentina, Sweden, Norway, Austria, Poland, Finland, Israel, Hong Kong, Cameroon, Sao Tome and Principe, Macao, Taiwan, Province of China, Thailand
TRIzol reagent is a monophasic solution of phenol, guanidine isothiocyanate, and other proprietary components designed for the isolation of total RNA, DNA, and proteins from a variety of biological samples. The reagent maintains the integrity of the RNA while disrupting cells and dissolving cell components.
Sourced in Germany, United States, United Kingdom, Netherlands, Spain, Japan, Canada, France, China, Australia, Italy, Switzerland, Sweden, Belgium, Denmark, India, Jamaica, Singapore, Poland, Lithuania, Brazil, New Zealand, Austria, Hong Kong, Portugal, Romania, Cameroon, Norway
The RNeasy Mini Kit is a laboratory equipment designed for the purification of total RNA from a variety of sample types, including animal cells, tissues, and other biological materials. The kit utilizes a silica-based membrane technology to selectively bind and isolate RNA molecules, allowing for efficient extraction and recovery of high-quality RNA.
Sourced in United States, Germany, China, Japan, United Kingdom, Canada, France, Italy, Spain, Australia, Switzerland, Belgium, Denmark, Netherlands, India, Ireland, Lithuania, Singapore, Sweden, Norway, Austria, Brazil, Argentina, Hungary, Sao Tome and Principe, New Zealand, Hong Kong, Cameroon, Philippines
TRIzol is a monophasic solution of phenol and guanidine isothiocyanate that is used for the isolation of total RNA from various biological samples. It is a reagent designed to facilitate the disruption of cells and the subsequent isolation of RNA.
Sourced in United States, Austria, Canada, Belgium, United Kingdom, Germany, China, Japan, Poland, Israel, Switzerland, New Zealand, Australia, Spain, Sweden
Prism 8 is a data analysis and graphing software developed by GraphPad. It is designed for researchers to visualize, analyze, and present scientific data.
Sourced in United States, Austria, Japan, Belgium, United Kingdom, Cameroon, China, Denmark, Canada, Israel, New Caledonia, Germany, Poland, India, France, Ireland, Australia
SAS 9.4 is an integrated software suite for advanced analytics, data management, and business intelligence. It provides a comprehensive platform for data analysis, modeling, and reporting. SAS 9.4 offers a wide range of capabilities, including data manipulation, statistical analysis, predictive modeling, and visual data exploration.
Sourced in United States, Germany, Canada, China, France, United Kingdom, Japan, Netherlands, Italy, Spain, Australia, Belgium, Denmark, Switzerland, Singapore, Sweden, Ireland, Lithuania, Austria, Poland, Morocco, Hong Kong, India
The Agilent 2100 Bioanalyzer is a lab instrument that provides automated analysis of DNA, RNA, and protein samples. It uses microfluidic technology to separate and detect these biomolecules with high sensitivity and resolution.
Sourced in United States, United Kingdom, Canada, China, Germany, Japan, Belgium, Israel, Lao People's Democratic Republic, Italy, France, Austria, Sweden, Switzerland, Ireland, Finland
Prism 6 is a data analysis and graphing software developed by GraphPad. It provides tools for curve fitting, statistical analysis, and data visualization.
Sourced in United States, Japan, United Kingdom, Austria, Canada, Germany, Poland, Belgium, Lao People's Democratic Republic, China, Switzerland, Sweden, Finland, Spain, France
GraphPad Prism 7 is a data analysis and graphing software. It provides tools for data organization, curve fitting, statistical analysis, and visualization. Prism 7 supports a variety of data types and file formats, enabling users to create high-quality scientific graphs and publications.
Sourced in United States, Germany, United Kingdom, Israel, Canada, Austria, Belgium, Poland, Lao People's Democratic Republic, Japan, China, France, Brazil, New Zealand, Switzerland, Sweden, Australia
GraphPad Prism 5 is a data analysis and graphing software. It provides tools for data organization, statistical analysis, and visual representation of results.
Sourced in United States, Austria, Germany, Poland, United Kingdom, Canada, Japan, Belgium, China, Lao People's Democratic Republic, France
Prism 9 is a powerful data analysis and graphing software developed by GraphPad. It provides a suite of tools for organizing, analyzing, and visualizing scientific data. Prism 9 offers a range of analysis methods, including curve fitting, statistical tests, and data transformation, to help researchers and scientists interpret their data effectively.

More about "DNA Replication"

DNA duplication, nucleic acid replication, genome replication, genetic information transfer, DNA synthesis, DNA polymerase, primase, helicase, molecular biology techniques, DNA sequencing, gene editing, synthetic biology, TRIzol reagent, RNeasy Mini Kit, Agilent 2100 Bioanalyzer, Prism software suite (Prism 5, Prism 6, Prism 7, Prism 8, Prism 9), SAS 9.4, GraphPad Prism.
DNA replication is the fundamental biological process that ensures the accurate transmission of genetic information from one cell generation to the next.
During this essential process, the double-stranded DNA molecule is unwound and separated, serving as a template for the synthesis of new complementary strands.
A complex of enzymes and proteins, including DNA polymerase, primase, and helicase, orchestrate this intricate process.
Understanding and optimizing DNA replication protocols is crucial for advancing research in areas such as genetics, cell biology, molecular biology, DNA sequencing, gene editing, and synthetic biology.
Expereince the future of DNA replication optimization today with PubCompare.ai, the AI-driven platform revolutionizing this critical area of study.
Discover the power of PubCompare.ai, the intelligent platform that helps you easily locate the best protocols from literature, pre-prints, and patents, and identify the optimal protocols and products to drive your research forward.