Gene Silencing

The strain BW27783 (genotype: F-, ∆(araD-araB)567, ∆lacZ4787(::rrnB-3), λ-, ∆(araH-araF)570(::FRT), ∆araEp-532::FRT, φP_cp8-araE535, rph-1, ∆(rhaD-rhaB)568, hsdR514) [6 (link)] was used as a parental strain to derive the MK01 strain by following one-step inactivation of chromosomal genes procedure [7 (link)]. More detailed procedure on strain engineering can be found in the Additional file 1.
The expression of LacI protein was assayed by Western blotting using a mouse anti-LacI monoclonal antibody (Abcam), and a sheep anti-mouse secondary antibody (Jackson ImmunoResearch) conjugated to horseradish peroxidase.
Strains transformed with various DNA constructs (Additional file 1) were grown overnight in M9 minimal medium with appropriate antibiotics at 37°C. These cultures were further diluted to an optical density of 0.001 at 550 nm in the measuring plate. After 6 to 15 hours of further growth, cells were measured for fluorescence, using a BD LSRFortessa™ cell analyzer flow cytometer. The eYFP fluorescence was measured using a 488 nm excitation laser and a 515–545 nm emission filter, while mCherry was measured using a 561 nm excitation laser and 600–620 nm emission filter. A minimum of 10,000 cells was measured from each sample. From the single-cell fluorescence intensities, the mean fluorescence intensity per cell, representing the population average was calculated.

The pRPa^ISL plasmid [25] (link) was redesigned in silico to contain two, inverted Gateway donor sites (containing attP sites and a ccdB counter selectable marker) separated by 150 bp of the lacZ gene. This modification was synthesised (Blue Heron Biotech) and cloned between the BamHI and XbaI sites of pRPA^ISL. The resultant plasmid, termed pGL2084, was propagated in ccdB Survivor cells (Invitrogen) at 25°C. RNAi target sequences were determined for the CDS of each PK gene using the TrypanoFAN: RNAit programme [47] (link). RNAi targets were amplified from T. b. brucei TREU 927 genomic DNA using Phusion high fidelity polymerase (NEB, Massachusetts) with appropriate oligonucleotide pairs (Table S3) incorporating attB1 and attB2 sites before being cloned into pGL2084 in a BP Recombinase reaction (Invitrogen) as per the manufacturer's instructions. 12 PKs were cloned into unmodified pRPa^ISL (indicated in Table S1). The resultant plasmids (pTL) were propagated using DH5α Max Efficiency cells, and purified and digested with AscI (NEB) prior to transfection.
T. b. brucei 2T1 BSF cells and derivatives were maintained in HMI-11 (HMI-9 (GIBCO), 10% v/v foetal calf serum (FCS; GIBCO 10270), Pen/Strep (SIGMA) (penicillin 20 Uml⁻¹, streptomycin 20 µgml⁻¹)), at 37°C, 5% CO₂ in vented flasks [48] (link). Appropriate selective drugs were added at the following concentrations: 2 µg ml⁻¹ puromycin, 2.5 µg ml⁻¹ phleomycin (InvivoGen), 5 µg ml⁻¹ hygromycin B (Calbiochem) and 10 µg ml⁻¹ blasticidin (InvivoGen). BSF parasites were transfected as previously described [27] (link), with independent clones obtained by limiting dilution. Clones were screened for puromycin sensitivity [25] (link); puromycin sensitive clones were prioritised for further analyses.
In order to specifically target each individual NEK12 mRNA, the NEK12.1 and NEK12.2 genes were aligned and short regions (over 20 nt) were identified where enough divergence existed to enable gene specific silencing by RNAi. For each gene, five small fragments (targeting the equivalent regions of each gene) were identified and joined in silico, then synthesised into attB flanked inserts (Genscript) ready for Gateway cloning into pGL2084. CLK1/2 individual RNAi constructs were generated by targeting the diverged 5′ region of the CDS and 5′ UTR.

To test how silencing of a candidate gene in the germline affects fertility, a test vial was set up 10 days after crossing the respective RNAi fly stock with the nos-GAL4-VP16 MVD1 driver. In this vial, five females and three males from the non-balanced F1 progeny were incubated for 15 days at 25 °C before recording fertility. The F1 progeny was considered to be fertile when the number of progeny in the F2 generation was comparable to wild-type flies. When the number of F2 progeny was substantially reduced, the F1 progeny was considered to have reduced fertility. The F1 progeny was considered sterile in the complete absence of larvae or pupae.

Gene overexpression was achieved by pHJLV004-CMV-MCS-EF1-ZsGreen-T2A-puro vector and the silencing of genes was conducted by hU6-MCS-CMV-GFP-SV40 vector, both mediated by lentivirus expression system. For virus preparation, 293T cells were transfected with lentiviral skeleton and helper plasmids (pMD2.G and psPAX2) for 72 h, and the medium supernatant was collected and concentrated. The sequences of shRNA oligonucleotides were as follows: mouse ENTPD5 (GATGGGTCCTATGAAGGCATA).