Log In Sign up
The largest database of trusted experimental protocols
> Physiology > Genetic Function > Mismatch Repair

Mismatch Repair

Mismatch repair is a cellular process that corrects errors that occur during DNA replication and recombination.
It plays a crucial role in maintaining genomic integrity by removing mismatched base pairs and small insertion/deletion loops that arise from DNA replication errors, DNA damage, or genetic recombination.
Defects in mismatch repair are associated with increased mutation rates and the development of certain types of cancers, such as hereditary nonpolyposis colorectal cancer.
Understanding the mechanisms and importance of mismatch repair is essential for advancing research in areas like cancer biology, genetics, and reproductive health.
PubComapre.ai can help streamline this critical area of study by enabling researchers to easily locate relevant protocols and leverage AI-driven comparisons to identify optimal experimental approaches.

Most cited protocols related to «Mismatch Repair»

1
Bayesian NMF for Mutational Signature Analysis
SignatureAnalyzer uses a Bayesian variant of NMF that infers the number of signatures through the automatic relevance determination technique and delivers highly interpretable and sparse representations for both signature profiles and attributions that strike a balance between data fitting and model complexity. Further details of the actual implementation of the computational approach have previously been published9 (link),27 (link),64 (link). SignatureAnalyzer was applied by using a two-step signature extraction strategy using 1,536 pentanucleotide contexts for SBSs, 83 indel features and 78 DBS features. In addition to the separate extraction of SBS, indel and DBS signatures, we performed a ‘COMPOSITE’ signature extraction based on all 1,697 features (1,536 SBS + 78 DBS + 83 indel). For SBSs, the 1,536 SBS COMPOSITE signatures are preferred; for DBSs and indels, the separately extracted signatures are preferred.
In step 1 of the two-step extraction process, global signature extraction was performed for the samples with a low mutation burden (n = 2,624). These excluded hypermutated tumours: those with putative polymerase epsilon (POLE) defects or mismatch repair defects (microsatellite instable tumours), skin tumours (which had intense UV-light mutagenesis) and one tumour with temozolomide (TMZ) exposure. Because the underlying algorithm of SignatureAnalyzer performs a stochastic search, different runs can produce different results. In step 1, we ran SignatureAnalyzer 10 times and selected the solution with the highest posterior probability. In step 2, additional signatures unique to hypermutated samples were extracted (again selecting the highest posterior probability over ten runs) while allowing all signatures found in the samples with low mutation burden, to explain some of the spectra of hypermutated samples. This approach was designed to minimize a well-known ‘signature bleeding’ effect or a bias of hyper- or ultramutated samples on the signature extraction. In addition, this approach provided information about which signatures are unique to the hypermutated samples, which was later used when attributing signatures to samples.
A similar strategy was used for signature attribution: we performed a separate attribution process for low- and hypermutated samples in all COMPOSITE, SBS, DBS and indel signatures. For downstream analyses, we preferred to use the COMPOSITE attributions for SBSs and the separately calculated attributions for DBSs and indels. Signature attribution in samples with a low mutation burden was performed separately in each tumour type (for example, Biliary–AdenoCA, Bladder–TCC, Bone–Osteosarc, and so on). Attribution was also performed separately in the combined microsatellite instable tumours (n = 39), POLE (n = 9), skin melanoma (n = 107) and TMZ-exposed samples (syn11738314). In both groups, signature availability (which signatures were active, or not) was primarily inferred through the automatic relevance determination process applied to the activity matrix H only, while fixing the signature matrix W. The attribution in samples with a low mutation burden was performed using only signatures found in the step 1 of the signature extraction. Two additional rules were applied in SBS signature attribution to enforce biological plausibility and minimize a signature bleeding: (i) allow SBS4 (smoking signature) only in lung, head and neck cases; and (ii) allow SBS11 (TMZ signature) in a single GBM sample. This was enforced by introducing a binary, signature-by-sample signature indicator matrix Z (1, allowed; 0, not allowed), which was multiplied by the H matrix in every multiplication update of H. No additional rules were applied to indel or DBS signature attributions, except that signatures found in hypermutated samples were not allowed in samples with a low mutation burden.
Alexandrov L.B., Kim J., Haradhvala N.J., Huang M.N., Tian Ng A.W., Wu Y., Boot A., Covington K.R., Gordenin D.A., Bergstrom E.N., Islam S.M., Lopez-Bigas N., Klimczak L.J., McPherson J.R., Morganella S., Sabarinathan R., Wheeler D.A., Mustonen V., Getz G., Rozen S.G, & Stratton M.R. (2020). The repertoire of mutational signatures in human cancer. Nature, 578(7793), 94-101.
Full text: Click here
Publication 2020
Bile Biopharmaceuticals Bones Familial Atypical Mole-Malignant Melanoma Syndrome Head INDEL Mutation Lung Microsatellite Instability Mismatch Repair Mutagenesis Mutation Neck Neoplasms Skin Neoplasms Temozolomide Ultraviolet Rays Urinary Bladder
2
Analyzing Somatic Mutations in Cancers
We calculate mutation frequency by dividing the number of validated somatic variants by the number of base pairs that have sufficient coverage. Minimum coverage is six and eight reads for normal and tumour BAMs, respectively. For mutation spectrum we classify the mutation by six types (transitions/transversions). Mutation context is generated by counting the frequency of A, T, C and G nucleotides that are 2 bp 5′ and 3′ to each variant within the six mutation categories. For the clustering, we pooled all samples (excluding hypermutators having >500 mutations) for each cancer type. We calculated the mutation context (–2 to +2 bp) for each somatic variant in each mutation category. A hierarchical clustering was then done using the pairwise correlation of the mutation context across all cancer types. We used correlation modules in the mutational significance in cancer (MuSiC) package to identify genes with mutations that are positively correlated with the number of mutations in the tumour sample. This analysis was performed for all 12 cancer types. Only genes mutated in at least 5% of tumours were included in the analysis. A list of genes known to be involved in DNA mismatch repair is included Supplementary Table 13.
Kandoth C., McLellan M.D., Vandin F., Ye K., Niu B., Lu C., Xie M., Zhang Q., McMichael J.F., Wyczalkowski M.A., Leiserson M.D., Miller C.A., Welch J.S., Walter M.J., Wendl M.C., Ley T.J., Wilson R.K., Raphael B.J, & Ding L. (2013). Mutational landscape and significance across 12 major cancer types. Nature, 502(7471), 333-339.
Publication 2013
Arhinia, choanal atresia, and microphthalmia Diploid Cell Genes Genes, vif Malignant Neoplasms Mismatch Repair Mutation Neoplasms Nucleotides
3
Linking Pathway Alterations to Immune Profiles

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2018
Arm, Upper Frameshift Mutation Gene Deletion Genes, Neoplasm Heterozygote Homozygote Leukocytes Mismatch Repair Neoplasms Patients PIK3CB protein, human Signal Transduction Pathways Student Tissues Transforming Growth Factor beta
4
Colon Cancer Genetic and Epigenetic Profiling
RNA was available from 175 tumor and nontumor tissue pairs who were part of the Diet, Activity, and Lifestyle study, which is an incident, population-based, case-control study of colon cancer conducted in Utah, the Kaiser Permanente Medical Research Program (KPMRP), and the Twin Cities Metropolitan area. Tumor tissue for RNA extraction was available from the Utah and KPMRP sites. Cases had to have tumor registry verification of a first primary adenocarcinoma of the colon and diagnosed between October 1991 and September 1994 to be eligible for the study. Tumor tissue was obtained for 97% of all Utah cases and for 85% of all KPMRP cases (Slattery et al., 2000 (link)) and included those who signed informed consent and those retrieved by local tumor registries and sent to study investigators without personal identifiers. Individuals with known adenomatous polyposis coli (APC), Crohn’s disease, or inflammatory bowel disease were not eligible for the study. Individuals with MSI high tumors were sequenced for inherited mutations in mismatch repair genes and excluded from the study if such mutations existed (Samowitz et al., 2001 (link)). The study was approved by the Institutional Review Board of the University of Utah and at KPMRP.
We have previously assessed these tumor samples for TP53 and KRAS mutations, the CpG island methylator phenotype (CIMP) using the classic panel (Samowitz et al., 2005 (link)), and MSI and MSS based on the mononucleotides BAT26 and TGFbRII and a panel of 10 tetranucleotide repeats that were correlated highly with the Bethesda Panel (Slattery et al., 2000 (link)); our study was done prior to the Bethesda Panel development. The classic CIMP panel consisted of five markers, hMLH1, p16, and MINT1, MINT2, and MINT31. Tumors were scored as CIMP high if two or more of the CpG islands were methylated otherwise they were classified as CIMP low.
Slattery M.L., Pellatt D.F., Mullany L.E., Wolff R.K, & Herrick J.S. (2015). Gene Expression in Colon Cancer: A Focus on Tumor Site and Molecular Phenotype. Genes, chromosomes & cancer, 54(9), 527-541.
Publication 2015
Adenocarcinoma Cancer of Colon Colon Adenocarcinomas Colonic Neoplasms CpG Islands Crohn Disease Diet Ethics Committees, Research Gene, APC Genes Germ-Line Mutation Inflammatory Bowel Diseases K-ras Genes Mismatch Repair Mutation Neoplasms Phenotype RNA, Neoplasm Tissues TP53 protein, human Twins
5
Derivation and Characterization of Haploid Embryonic Stem Cells
For the derivation of haploid ESCs mouse oocytes were activated in M16 medium as described 24 . ESC culture in chemically defined 2i medium has been described previously 7 ,8 . Cell sorting for DNA content was performed after staining with 15 μg/ml Hoechst 33342 (Invitrogen) on a MoFlo flow sorter (Beckman Coulter) selecting the haploid 1n peak. For analytic flow profiles cells were fixed in ethanol, RNase treated, and stained with propidium iodide (PI). For karyotype analysis cells were arrested in metaphase with demecolcine (Sigma). After incubation in hypotonic KCl buffer cells were fixed in methanol-acetic acid (3:1) and chromosome spreads were prepared and stained with DAPI. RNA was extracted using the RNeasy Kit (Quiagen). Transcription profiles were generated using Affymetrix GeneChip 430.2 arrays. Sample preparation, hybridization, and basic data analysis were performed by Imagenes (Berlin, Germany). Further analysis was performed using the Genespring GX software (Agilent). For CGH analysis genomic DNA was isolated from haploid ESC lines and hybridized to NimbleGen 3x720K whole-genome tiling arrays by Imagenes (Berlin, Germany) using C57BL/6 kidney DNA as a reference. For chimera experiments GFP labelled HAP-1 (p29), HAP-2 (p18) and HTG-2 (p23) ESCs were injected into C57BL/6 host blastocysts. Live born chimaeras were analysed for expression of GFP at postnatal day 2. Genetic screening was performed following a previously published strategy 25 . In brief, HAP-1 ESCs were co-transfected with 2 μg piggyBac transposase expression vector 15 and 1μg piggyBac gene trap vector (Suppl. Fig. 8) using Lipofectamine 2000 (Invitrogen). Selection for transposon insertions was performed using 2 μg/ml puromycin for 8 days. 1×107 puromycin resistant ESCs were plated in two 15 cm dishes and mutations in mismatch repair genes were selected using 0.3 μg/ml 6-TG (Sigma). piggyBac integration sites in seven 6-TG resistant clones were mapped by Splinkerette PCR 16 .
Leeb M, & Wutz A. (2011). Derivation of haploid embryonic stem cells from mouse embryos. Nature, 479(7371), 131-134.
Publication 2011
Acetic Acid Blastocyst Buffers Cells Childbirth Chimera Chromosomes Clone Cells Cloning Vectors Crossbreeding Culture Media DAPI Demecolcine Endoribonucleases Enhanced S-Cone Syndrome Ethanol Gene Chips Genes Genetic Vectors Genome HOE 33342 Hyperostosis, Diffuse Idiopathic Skeletal Insertion Mutation Jumping Genes Karyotype Kidney lipofectamine 2000 Metaphase Methanol Mismatch Repair Mus Mutation Oocytes Propidium Iodide Puromycin Transcription, Genetic Transposase

Most recents protocols related to «Mismatch Repair»

1
In Vivo Albumin Gene Editing using Zinc Finger Nucleases
Not available on PMC !

Example 5

To deliver the albumin-specific ZFNs to the liver in vivo, the normal site of albumin production, we generated a hepatotropic adeno-associated virus vector, serotype 8 expressing the albumin-specific ZFNs from a liver-specific enhancer and promoter (Shen et al., ibid and Miao et al., ibid). Adult C57BL/6 mice were subjected to genome editing at the albumin gene as follows: adult mice were treated by i.v. (intravenous) injection with 1×1011 v.g. (viral genomes)/mouse of either ZFN pair 1 (SBS 30724 and SBS 30725), or ZFN pair 2 (SBS 30872 and SBS 30873) and sacrificed seven days later. The region of the albumin gene encompassing the target site for pair 1 was amplified by PCR for the Cel-I mismatch assay using the following 2 PCR primers:

Cel1 F1:
(SEQ ID NO: 69)
5′ CCTGCTCGACCATGCTATACT 3′
Cel1 R1:
(SEQ ID NO: 70)
5′ CAGGCCTTTGAAATGTTGTTC 3′

The region of the albumin gene encompassing the target site for pair 2 was amplified by PCR for the Cel-I assay using these PCR primers:

mAlb set4F4:
(SEQ ID NO: 71)
5′ AAGTGCAAAGCCTTTCAGGA 3′
mAlb set4R4:
(SEQ ID NO: 72)
5′ GTGTCCTTGTCAGCAGCCTT 3′

As shown in FIG. 4, the ZFNs induce indels in up to 17% of their target sites in vivo in this study.

The mouse albumin specific ZFNs SBS30724 and SBS30725 which target a sequence in intron 1 were also tested in a second study. Genes for expressing the ZFNs were introduced into an AAV2/8 vector as described previously (Li et al. (2011) Nature 475 (7355): 217). To facilitate AAV production in the baculovirus system, a baculovirus containing a chimeric serotype 8.2 capsid gene was used. Serotype 8.2 capsid differs from serotype 8 capsid in that the phopholipase A2 domain in capsid protein VP1 of AAV8 has been replaced by the comparable domain from the AAV2 capsid creating a chimeric capsid. Production of the ZFN containing virus particles was done either by preparation using a HEK293 system or a baculovirus system using standard methods in the art (See Li et al., ibid, see e.g., U.S. Pat. No. 6,723,551). The virus particles were then administered to normal male mice (n=6) using a single dose of 200 microliter of 1.0el 1 total vector genomes of either AAV2/8 or AAV2/8.2 encoding the mouse albumin-specific ZFN. 14 days post administration of rAAV vectors, mice were sacrificed, livers harvested and processed for DNA or total proteins using standard methods known in the art. Detection of AAV vector genome copies was performed by quantitative PCR. Briefly, qPCR primers were made specific to the bGHpA sequences within the AAV as follows:

Oligo200 (Forward)
(SEQ ID NO: 102)
5′-GTTGCCAGCCATCTGTTGTTT-3′
Oligo201 (Reverse)
(SEQ ID NO: 103)
5′-GACAGTGGGAGTGGCACCTT-3′
Oligo202 (Probe)
(SEQ ID NO: 104)
5′-CTCCCCCGTGCCTTCCTTGACC-3′

Cleavage activity of the ZFN was measured using a Cel-I assay performed using a LC-GX apparatus (Perkin Elmer), according to manufacturer's protocol. Expression of the ZFNs in vivo was measured using a FLAG-Tag system according to standard methods.

As shown in FIG. 5 (for each mouse in the study) the ZFNs were expressed, and cleave the target in the mouse liver gene. The % indels generated in each mouse sample is provided at the bottom of each lane. The type of vector and their contents are shown above the lanes. Mismatch repair following ZFN cleavage (indicated % indels) was detected at nearly 16% in some of the mice.

The mouse specific albumin ZFNs were also tested for in vivo activity when delivered via use of a variety of AAV serotypes including AAV2/5, AAV2/6, AAV2/8 and AAV2/8.2. In these AAV vectors, all the ZFN encoding sequence is flanked by the AAV2 ITRs, contain, and then encapsulated using capsid proteins from AAV5, 6, or 8, respectively. The 8.2 designation is the same as described above. The SBS30724 and SBS30725 ZFNs were cloned into the AAV as described previously (Li et al., ibid), and the viral particles were produced either using baculovirus or a HEK293 transient transfection purification as described above. Dosing was done in normal mice in a volume of 200 μL per mouse via tail injection, at doses from 5e10 to 1e12 vg per dose. Viral genomes per diploid mouse genome were analyzed at days 14, and are analyzed at days 30 and 60. In addition, ZFN directed cleavage of the albumin locus was analyzed by Cel-I assay as described previously at day 14 and is analyzed at days 30 and 60.

As shown in FIG. 6, cleavage was observed at a level of up to 21% indels. Also included in Figure are the samples from the previous study as a comparison (far right, “mini-mouse” study-D14 and a background band (“unspecific band”).

US11859190B2. Methods and compositions for regulation of transgene expression (2024-01-02). Sangamo Therapeutics, Inc. [US]. Inventors: Edward J. Rebar [US].
Full text: Click here
Patent 2024
Adult Albumins Baculoviridae Biological Assay Capsid Proteins Chimera Cloning Vectors Cytokinesis Dependovirus Diploidy Genes Genome INDEL Mutation Introns Liver Males Mice, Inbred C57BL Mismatch Repair Mus Oligonucleotide Primers Protein Domain Proteins Tail Transfection Transients Viral Genome Virion
2
Personalized Endometrial Cancer Treatment
The primary objective of this study is to compare the adjuvant treatment efficacy in women with IR (stage IA grade 3 or stage IB grade 1–2) or HIR (stage IB grade 3 or stage II) endometrioid endometrial cancer (EEC) treated after surgery with molecular profile-based recommendations for either observation, or chemoradiotherapy or radiotherapy. We hypothesise that the efficacy of molecular-based treatment is not inferior to that of conventional clinicopathological-based treatment.
The secondary objective is to determine the preferred treatment for each subgroup following different recommendations with regard to the treatment efficacy, safety and tolerability. We hypothesise that de-escalated treatment strategies yield better quality-of-life outcomes without sacrificing treatment efficacy in patients with POLE mutation (POLEmut) and partial mismatch repair deficient (MMRd) or non-specific molecular profile (NSMP) subgroups. In contrast, escalated treatment is considered necessary for the p53-abnormal (p53abn) subgroup.
Li Y., Zhu C., Xie H., Chen Y., Lv W., Xie X, & Wang X. (2023). Molecular profile-based recommendations for postoperative adjuvant therapy in early endometrial cancer with high-intermediate or intermediate risk: a Chinese randomized phase III trial (PROBEAT). Journal of Gynecologic Oncology, 34(2), e37.
Publication 2023
Chemoradiotherapy Endometrial Carcinoma Mismatch Repair Mutation Operative Surgical Procedures Patients Pharmaceutical Adjuvants Radiotherapy Safety Woman
3
Comprehensive Rectal Cancer Evaluation and Outcomes
Patients baseline characteristics like age, gender, clinical stage, tumor location, tumor differentiation, circumferential resection margin (CRM) status, and extramural venous invasion (EMVI) status were collected on diagnosis. Adverse events, imaging assessments in pre- and post-nCRT, and pathological responses including epidermal growth factor receptor (EGFR) status, human epidermal growth factor receptor-2 (Her-2) status, and mismatch repair (MMR) status were recorded during follow-up observation. The time window for local recurrence rate, distant metastasis-free survival (DMFS), disease-free survival (DFS), and overall survival (OS) was from the date of surgery to the date of final follow-up. The last follow-up date was in November 2021. This study employed the outpatient system, the inpatient system, and telephone consultations to collect accurate patient information and to check for gaps through various collection methods. Regarding tumor location, tumors less than 5cm from the anus were considered low, tumors between 5-10cm from the anus were considered median, and tumors 10-12cm from the anus were considered high. The research was approved by the local ethics committee of The First Affiliated Hospital of Wenzhou Medical University and the Hospital Reviewing Board.
Xu Y., Zou H., Shao Z., Zhang X., Ren X., He H., Zhang D., Du D, & Zou C. (2023). Efficacy and safety of different radiotherapy doses in neoadjuvant chemoradiotherapy in patients with locally advanced rectal cancer: A retrospective study. Frontiers in Oncology, 13, 1119323.
Full text: Click here
Publication 2023
Anus Anus Neoplasms Diagnosis Epidermal Growth Factor Receptor erbb2 Gene Ethics Committees, Clinical Gender Inpatient Mismatch Repair Neoplasm Metastasis Neoplasms Neoplasms by Site Operative Surgical Procedures Outpatients Patients Recurrence Surgical Margins Veins
4
Benchmarking Computational Tools for Splice Site Prediction
Two large truth datasets were used to assess utility of computational prediction tools. The first dataset contained cell survival results (phenotypes: loss of function, intermediate function and functional) from 414 BRCA1 variants12 (link) supplemented with computational splicing prediction results (this study). While the cell survival functional assay did not provide specific results about splicing events, the results were used to infer whether variants were functionally benign or pathogenic, which for intronic variants was presumed to be due to impact via RNA effects. The analysis dataset included information for variants at the donor and acceptor region (3 nucleotides exonic (synonymous substitutions only) and 8 nucleotides intronic).
The second dataset contained in vitro splicing assay and computational splicing prediction results across a range of disease susceptibility genes that have been curated from the literature: 1,008 BRCA1/BRCA2 variants, 659 mismatch repair gene variants (MLH1, MSH2, MSH6, PMS2),13 (link) 284 NF1 variants,6 (link) and 1,070 POU1F1 variants. 14 (link) The majority of these variants were patient-identified. The POU1F1 dataset differed in that it represented results from a high-throughput assay designed to test the effect of variants on upregulation of a minor isoform with transcriptional repressor activity. Of the 3,021 variants collated for this study, 767 were reported to be spliceogenic (associated with one or more aberrant splicing events). All variant data are provided in Table S2 and available for download from a web tool we developed to facilitate calculation of likelihood ratios for calibration (https://gwiggins.shinyapps.io/lr_shiny/). Based on a conservative interpretation of the position weight matrix plot for U2-type introns (the most prevalent intron type),15 (link) the following variant categories were created for the main analysis, based on variant position relative to the canonical splice sites: 1) Canonical splice site (±1/2 intronic nucleotide positions); 2) Standard splice region (Donor site motif - last 3 bases of the exon and 6 nucleotides of intronic sequence adjacent to the exon; and Acceptor site motif - first base of the exon and 20 nucleotides upstream from the exon boundary); 3) “Other” - intronic or exonic nucleotide positions outside canonical splice site and standard splice region. Additionally, sensitivity and specificity was assessed for variants within a minimal splice region (Donor site motif - last 3 bases of the exon and 6 nucleotides of intronic sequence adjacent to the exon; and Acceptor site motif - first base of the exon and 3 nucleotides upstream from the exon boundary), and then separately for intronic and exonic nucleotide positions outside of canonical splice sites and the minimal splice region.
Walker L.C., de la Hoya M., Wiggins G.A., Lindy A., Vincent L.M., Parsons M.T., Canson D.M., Bis-Brewer D., Cass A., Tchourbanov A., Zimmermann H., Byrne A.B., Pesaran T., Karam R., Harrison S, & Spurdle A.B. (2023). APPLICATION OF THE ACMG/AMP FRAMEWORK TO CAPTURE EVIDENCE RELEVANT TO PREDICTED AND OBSERVED IMPACT ON SPLICING: RECOMMENDATIONS FROM THE CLINGEN SVI SPLICING SUBGROUP. medRxiv.
Full text: Click here
Publication Preprint 2023
Base Sequence Biological Assay BRCA1 protein, human Cell Survival Exons Gene, BRCA2 Genetic Diversity Genetic Predisposition to Disease High-Throughput Screening Introns Mismatch Repair MLH1 protein, human MSH6 protein, human Nucleotides Pathogenicity Patients Phenotype PMS2 protein, human Prognosis Protein Isoforms Tissue Donors Transcription, Genetic Up-Regulation (Physiology)
5
Comprehensive Clinical Data Collection
Clinical data, including age, gender, Eastern Cooperative Oncology Group (ECOG) score, primary tumor site, histological grade, number of metastatic sites, primary tumor surgery, mismatch repair (MMR) status, intestinal obstruction status, liver metastasis, lung metastasis, peritoneal metastasis and distant lymph node metastasis were recorded.
Meng Q., Zhao J., Yu Y., Wang K., Ren J., Xu C., Wang Y, & Wang G. (2023). Survival comparison of first-line treatment regimens in patients with braf-mutated advanced colorectal cancer: a multicenter retrospective study. BMC Cancer, 23, 191.
Full text: Click here
Publication 2023
Gender Intestinal Obstruction Liver Lung Lymph Node Metastasis Mismatch Repair Neoplasm Metastasis Neoplasms Operative Surgical Procedures Peritoneum

Top products related to «Mismatch Repair»

1
Benchmark ultra by Roche
Sourced in United States, Switzerland, Germany, Azerbaijan, United Kingdom, Italy, France, Denmark, Japan
The Benchmark Ultra is a versatile lab equipment product designed for various applications. It features precise temperature control, reliable performance, and user-friendly operation. The core function of the Benchmark Ultra is to provide a consistent and accurate environment for scientific experiments and testing.
2
G168 15 by BD
The G168-15 is a laboratory equipment product manufactured by BD. It is designed to perform a core function within a laboratory setting. Further details about its intended use or specific applications are not available.
3
Msi analysis system by Promega
Sourced in United States, France
The MSI Analysis System is a laboratory equipment designed for the analysis of microsatellite instability (MSI) in DNA samples. It provides a reliable and efficient method for detecting genetic alterations associated with various diseases, including cancer.
4
Bond polymer refine detection kit by Leica Biosystems
Sourced in Germany, United Kingdom, United States, Australia, Japan
The Bond Polymer Refine Detection kit is a laboratory reagent used in immunohistochemical (IHC) and in situ hybridization (ISH) procedures. It provides a polymer-based detection system that enables the visualization of target antigens or nucleic acid sequences in biological samples.
5
Msh2 clone g219 1129 by Roche
Sourced in United States
MSH2 (clone G219-1129) is an antibody used in laboratory research applications. It is designed to detect the MSH2 protein, which plays a role in DNA mismatch repair. This antibody can be used in various immunoassay techniques to identify and study the MSH2 protein in biological samples.
6
Alb 4 by BD
The Alb-4 is a laboratory equipment designed for the precise measurement and analysis of various samples. It is a versatile instrument that can be used for a wide range of applications. The core function of the Alb-4 is to provide accurate and reliable data to support research and testing efforts in various industries.
7
Pms2 clone a16 4 by BD
Sourced in Japan, United States
The PMS2 (clone A16-4) is a laboratory equipment product manufactured by BD. It is a monoclonal antibody that is used in immunohistochemical and flow cytometric applications. The core function of this product is to detect the presence of the PMS2 protein, which is involved in DNA mismatch repair processes.
8
Ventana benchmark xt by Roche
Sourced in United States, Switzerland, Japan, France, Germany, Azerbaijan, United Kingdom, Australia
The Ventana Benchmark XT is a fully automated slide staining system designed for immunohistochemistry (IHC) and in situ hybridization (ISH) assays. It is capable of performing deparaffinization, antigen retrieval, primary antibody incubation, and counterstaining on tissue samples mounted on slides.
9
Optiview dab ihc detection kit by Roche
Sourced in United States, Germany, Switzerland, Azerbaijan
The OptiView DAB IHC Detection Kit is a laboratory equipment product designed for Immunohistochemistry (IHC) applications. It provides a reagent system for the detection of target antigens in tissue samples. The kit utilizes a DAB (3,3'-Diaminobenzidine) chromogen to visualize the labeled target proteins.
10
Qiaamp dna mini kit by Qiagen
Sourced in Germany, United States, France, United Kingdom, Netherlands, Spain, Japan, China, Italy, Canada, Switzerland, Australia, Sweden, India, Belgium, Brazil, Denmark
The QIAamp DNA Mini Kit is a laboratory equipment product designed for the purification of genomic DNA from a variety of sample types. It utilizes a silica-membrane-based technology to efficiently capture and purify DNA, which can then be used for various downstream applications.

More about "Mismatch Repair"

Mismatch repair (MMR) is a crucial cellular process that ensures the accuracy and integrity of the genome by correcting errors that occur during DNA replication and recombination.
This complex mechanism plays a vital role in maintaining genetic stability and preventing the development of certain types of cancers, such as hereditary nonpolyposis colorectal cancer (HNPCC), also known as Lynch syndrome.
The MMR system recognizes and removes mismatched base pairs and small insertion/deletion loops that arise from DNA replication errors, DNA damage, or genetic recombination.
This process is mediated by a group of specialized proteins, including MSH2, MSH6, MLH1, and PMS2, which work together to identify and repair these errors.
Defects or mutations in the genes encoding these MMR proteins can lead to a condition called microsatellite instability (MSI), which is characterized by an increased rate of genetic mutations.
This, in turn, is associated with the development of various cancers, particularly colorectal, endometrial, and ovarian cancers.
Understanding the mechanisms and importance of mismatch repair is essential for advancing research in areas like cancer biology, genetics, and reproductive health.
Techniques such as MSI analysis, using systems like the Benchmark Ultra and the Ventana Benchmark XT platform, as well as the Bond Polymer Refine Detection kit and the OptiView DAB IHC Detection Kit, can help researchers identify and study MMR deficiencies.
The QIAamp DNA Mini Kit is a useful tool for extracting high-quality DNA samples, which can be used in conjunction with MMR-related analyses.
Additionally, the use of antibodies targeting MMR proteins, such as MSH2 (clone G219-1129) and PMS2 (clone A16-4), can provide valuable insights into the expression and localization of these key components of the mismatch repair pathway.
By leveraging the power of AI-driven platforms like PubCompare.ai, researchers can streamline their mismatch repair research process, easily locate relevant protocols from literature, pre-prints, and patents, and identify optimal experimental approaches to ensure the reproducibility and reliability of their findings.