> Physiology > Genetic Function > Recombinational Repair of DNA

Recombinational Repair of DNA

Recombinational Repair of DNA refers to the cellular process of repairing DNA double-strand breaks through the use of homologous recombination.
This mechanism involves the exchange of genetic material between similar or identical DNA sequences, allowing the damaged DNA to be accurately restored.
Recombinational repair plays a crucial role in maintaining genomic integrity and is involved in various cellular processes, such as DNA replication, meiosis, and the repair of ionizing radiation-induced DNA damage.
Understanding the mechanisms and regulation of recombinational repair is essential for advancing research in fields like cancer biology, developmental biology, and evolutionary genetics.

Most cited protocols related to «Recombinational Repair of DNA»

CRISPR-Mediated Gene Disruption in T. cruzi

The TcPFR2 sgRNA sequence was cloned into the Cas9/pTREX-n vector by using the BamHI site as described above and then used to cotransfect T. cruzi epimastigotes with a linear donor DNA template to induce DNA repair by homologous recombination (CRISPR-HR). This cassette was generated by PCR with 120-bp ultramers (primers 11 and 12; see Table S1 in the supplemental material) from which 100 bp correspond to regions located upstream of the start codon (forward primer) and downstream of the Cas9 target site (reverse primer) of the TcPFR2 gene and 20 bp for annealing on the blasticidin-S deaminase gene (Bsd) on the pTREX-b vector, which was used as a PCR template. Epimastigotes cotransfected with TcPFR2sgRNA/Cas9/pTREX-n and a blasticidin resistance cassette were cultured with G418 and blasticidin for selection of double-resistant parasites. Primers 13 and 14 (see Table S1 in the supplemental material) were used in a PCR assay to verify disruption of the TcPFR2 gene by the blasticidin resistance cassette. For a detailed protocol for gene disruption in T. cruzi by CRISPR/Cas9-mediated homologous recombination, see Supplemental Methods S1 in the supplemental material.

Lander N., Li Z.H., Niyogi S, & Docampo R. (2015). CRISPR/Cas9-Induced Disruption of Paraflagellar Rod Protein 1 and 2 Genes in Trypanosoma cruzi Reveals Their Role in Flagellar Attachment. mBio, 6(4), e01012-15.

Publication 2015

antibiotic G 418 Biological Assay blasticidin S deaminase Cloning Vectors Clustered Regularly Interspaced Short Palindromic Repeats Codon, Initiator Genes Homologous Recombination Oligonucleotide Primers Parasites Recombinational Repair of DNA T-DNA Tissue Donors

Somatic Mutation Analysis in Cancer

Mutation calls from WXS were obtained from the TCGA Unified Ensemble “MC3” Call Set (50 (link)), the public, open-access dataset of somatic mutation calls produced by the MC3 calling effort (“Multi-Center Mutation Calling in Multiple Cancers”), downloaded from www.synapse.org/#!Synapse:syn7214402/wiki/405297. (The results here are in whole or part based on data generated by the TCGA Research Network, http://cancergenome.nih.gov/, as outlined in the TCGA publications guidelines, http://cancergenome.nih.gov/publications/publicationguidelines.)
Following the filtering procedure that was used for the PanCanAtlas project, the MC3 dataset was filtered to include only “PASS” variants, which removes patients that were subjected to whole-genome amplification (WGA), as well as the acute myeloid leukemia (LAML) cohort. This yielded a final cohort of 9023 patients covering 32 tumor types. Mutation calls from WGS were combined from TCGA and other projects (1 (link), 2 (link), 4 (link),13 (link),15 (link)), restricting to somatic single-nucleotide variants (SSNVs) and excluding patients with fewer than 500 SSNVs in the genome, yielding a final WGS dataset comprising 1686 unique patients spanning 27 tumor types.
Mutations were analyzed by non-negative matrix factorization (NMF) as described (1 (link),4 (link),5 (link)), usingk = 8. NMF discovered a set of signatures corresponding to known mutational processes associated with (i) APOBEC enzyme activity; (ii) UV radiation exposure; (iii) POLE proofreading loss; (iv) MSI, microsatellite instability due to loss of mismatch repair; (v) tobacco smoking; (vi) ESO, a mutational process of unknown etiology first observed in esophageal cancer; (vii) normal cellular aging, associated with spontaneous deamination of methylated cytosines in CpG dinucleotides; and (viii) BRCA, a relatively “flat” signature associated with loss of homologous recombination repair.
A quantitative model of hairpin loop TpC mutation frequency was constructed by binning hairpins according to the following characteristics: stem strength (computed as 3 times the number of G-C base pairs plus the number of A-T base pairs), loop size (3 to 11 nt), TpC positioning within the loop (ranging from 1 to loop size), and the identity of the nucleotides directly preceding and following the TpC site. For each bin, the number of sites in the genome matching its parameters was determined, and the number of observed mutations in the APOBEC⁺ cohort was tallied. This provided a denominator and numerator for computing mutation frequency, which was then normalized to the “no-hairpin” baseline to provide a relative mutation frequency. See (33 ) for full details.

Buisson R., Langenbucher A., Bowen D., Kwan E.E., Benes C.H., Zou L, & Lawrence M.S. (2019). Passenger hotspot mutations in cancer driven by APOBEC3A and mesoscale genomic features. Science (New York, N.Y.), 364(6447), eaaw2872.

Publication 2019

A-Loop cytidylyl-3'-5'-guanosine Cytosine Deamination Diploid Cell enzyme activity Esophageal Cancer Genome Leukemia, Myelocytic, Acute Malignant Neoplasms Microsatellite Instability Mismatch Repair Mutation Neoplasms Nucleotides Patients Radiation Exposure Recombinational Repair of DNA Stem, Plant Synapses

Integrative Analysis of Ovarian Cancer

The OC-clinical data, OC-RNA sequencing profiles, and normal ovarian epithelial tissue RNA sequencing profiles were obtained from The Cancer Genome Atlas (TCGA) [17 (link)] and GTEx database [18 (link)] using UCSC Xena. We excluded OC patients without RNA sequencing, survival time, or repeat sequencing, and finally, only 374 patients were retained for subsequent analysis. At a ratio of 3:7, the total OC patients were divided into two sets (training set and testing set) using the caret package in R software. Meanwhile, lncRNAs and protein-coding genes were identified based on annotation documents of the GENCODE database [19 (link)]. In addition, 296 FIRGs (Table. S1) were extracted based on previous studies [20 (link)], including ferroptosis regulators, ferroptosis markers, ferroptosis pathway, Iron uptake and transport, and Iron ion homeostasis, etc. It is worth mentioning that somatic mutation data were also obtained from the TCGA database, and homologous recombination repair (HRR) related genes were obtained from the previous reference [21 (link)].

Feng S., Yin H., Zhang K., Shan M., Ji X., Luo S, & Shen Y. (2022). Integrated clinical characteristics and omics analysis identifies a ferroptosis and iron-metabolism-related lncRNA signature for predicting prognosis and therapeutic responses in ovarian cancer. Journal of Ovarian Research, 15, 10.

Full text: Click here

Publication 2022

Diploid Cell Epithelium Ferroptosis Gene Products, Protein Genes Genome Homeostasis Iron Malignant Neoplasms Mutation Ovary Patients Recombinational Repair of DNA RNA, Long Untranslated

Quantifying Chronic Conditions in Medicare Beneficiaries

We counted the number of chronic conditions documented in the claims for each beneficiary during 2007. We used the 9 major chronic conditions based on the work of Iezzoni et al,^{2 (link)} as adapted for the 2008 Dartmouth Atlas of Health Care. The conditions were cancer with poor prognosis, chronic obstructive pulmonary disease, coronary artery disease, congestive heart failure, peripheral artery disease, severe liver disease, diabetes with end-organ disease, chronic renal failure, and dementia.
For a beneficiary to be counted as having a chronic condition, the diagnosis had to be either coded on at least 1 hospital discharge abstract following an inpatient stay or on at least 2 claims involving physician contact that were at least 7 days apart. The latter requirement was used to reduce the likelihood of erroneously including “rule out” diagnoses. A beneficiary was counted as either having or not having each of the 9 conditions, and the total number of conditions for each beneficiary was calculated (range, 0–9).
We calculated the mean number of chronic conditions per beneficiary within each of the 306 HRRs to examine the variation in diagnosis frequency across the Medicare population as a whole. The HRRs were sorted in terms of increasing diagnosis frequency and grouped into quintiles based on population counts (ie, approximately 1 million beneficiaries per quintile). Within each quintile, we examined the distribution of the number of chronic conditions diagnosed. To assess system factors that may be related to the likelihood of diagnosis, we examined 4 measures reflecting physician encounters and diagnostic testing: the number of physician visits, the number of different physicians seen, the number of imaging tests obtained, and the number of laboratory tests obtained.

Welch H.G., Sharp S.M., Gottlieb D.J., Skinner J.S, & Wennberg J.E. (2011). Geographic Variation in Diagnosis Frequency and Risk of Death Among Medicare Beneficiaries. JAMA : the journal of the American Medical Association, 305(11), 1113-1118.

Publication 2011

Chronic Condition Chronic Kidney Diseases Chronic Obstructive Airway Disease Congestive Heart Failure Coronary Artery Disease Dementia Diabetes Mellitus Diagnosis Disease, Chronic Hepatobiliary Disorder Inpatient Malignant Neoplasms Patient Discharge Peripheral Arterial Diseases Physicians Prognosis Recombinational Repair of DNA Vision

Efficient CRISPR-Cas9 Genome Editing in Aspergillus

A. fumigatus strains wild-type strains Af293 and CEA10 along with MFIG001, a member of the CEA10 laboratory lineage lacking a functional ku80 gene, were used as the parental isolates for the transformations (Bertuzzi et al., 2020 , Furukawa et al., 2020 (link)). Where the hygromycin resistance cassette was used as a selectable marker, it was amplified from the pAN7.1 plasmid (available from the Fungal Genetics Stock Centre) using primers detailed in the results section and Table S1.
Target specific crRNAs as well as oligos to prepare a repair template were designed using a web-based guide RNA designing tool EuPaGDT (Peng and Tarleton 2015 (link)). The genome sequence of A. fumigatus A1163, which was downloaded from the CADRE genomic database, was manually uploaded to EuPaGDT, and the program was executed with default setting to design gRNAs to the aft4 (Hey 2007 ), pacC and srbA loci. As a result, several candidate crRNAs were obtained. Those crRNAs closest to the target integration sites with the highest QC scores were manually selected for the transformation experiments (Table S1).
Homology directed repair (HDR) templates were amplified using primers that incorporated 50-bp microhomology arms (MHAs) (see Fig. 2, Fig. 3, Supplementary figure 1, Supplementary figure 3, Supplementary figure 6, Supplementary figure 7 and Table S1). The egfp- or the 3xFLAG-containing repair templates were amplified from pUgfp-pacCTF (the egfp fragment was originally sourced from pCH008 (Helmschrott et al. 2013 (link))) or pUpacC-3xFLAG (a plasmid containing a codon optimized 3xFLAG tag-pacC fusion gene) by PCR with a corresponding pair of primers listed in Table S1 using Phusion Flash Master Mix (Thermo Fisher Scientific). The amplified MHA templates were gel purified (Qiagen PCR purification kit) and used for transformation. The guide RNAs and primers used for the CRISPR-Cas9 mediated transformation are listed in Table S1.

van Rhijn N., Furukawa T., Zhao C., McCann B.L., Bignell E, & Bromley M.J. (2020). Development of a marker-free mutagenesis system using CRISPR-Cas9 in the pathogenic mould Aspergillus fumigatus. Fungal Genetics and Biology, 145, 103479.

Full text: Click here

Publication 2020

2',5'-oligoadenylate Arm, Upper Clustered Regularly Interspaced Short Palindromic Repeats Codon Genes Genes, Fungal Genome hygromycin A Oligonucleotide Primers Parent Plasmids Recombinational Repair of DNA RNA Strains

Most recents protocols related to «Recombinational Repair of DNA»

CRISPR-mediated Genetic Modifications

Cas9 was inserted upstream of GAPDH, by CRISPR-mediated homology-directed repair as previously described¹⁵. Several clones were tested, and one was selected for all experiments, based on its Cas9-editing efficiency. Editing efficiency was assessed by transducing d4 neurons with a lentiviral vector encoding BFP, GFP and a sgRNA for GFP. Neurons were dissociated on d8 and subjected to flow cytometry using CytoFLEX S (Beckman Coulter). Editing efficiency was calculated by comparing the percentage of BFP⁺/GFP^- (edited) to BFP⁺/GFP⁺ (total transduced) cells using FlowJo version 10.8.1 Software for macOS (BD Life Sciences).
Tag-RFP was inserted downstream of CHOP, separated by a T2A as described previously¹⁵. The following sgRNA sequence was used: 5ʹ-UGCUCCCAAUUGUUCAUGCU-3ʹ (Merck). Several clones were genotyped by PCR (primers: TATCTTCATACATCACCACACCTGA and TTCTAAAACACATCAGAGATTGGGG) and Sanger sequencing. Validation experiments were performed with two homozygote (518/535) and two heterozygote (403/407) clonal lines. All other experiments were performed with both homozygote lines.

Pavlou S., Foskolou S., Patikas N., Field S.F., Papachristou E.K., Santos C.D., Edwards A.R., Kishore K., Ansari R., Rajan S.S., Fernandes H.J, & Metzakopian E. (2023). CRISPR-Cas9 genetic screen leads to the discovery of L-Moses, a KAT2B inhibitor that attenuates Tunicamycin-mediated neuronal cell death. Scientific Reports, 13, 3934.

Full text: Click here

Publication 2023

Cells Clone Cells Cloning Vectors Clustered Regularly Interspaced Short Palindromic Repeats DDIT3 protein, human Flow Cytometry GAPDH protein, human Heterozygote Homozygote Neurons Oligonucleotide Primers Recombinational Repair of DNA

Yeast Strains for Antioxidant and Antigenotoxicity Assays

The budding yeast Saccharomyces cerevisiae was selected as eukaryotic cell model for this work. The strains BY4741 (MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0) and CEN.PK dDEL (HIS3 Δ::dDEL; created by Silva et al.^{21 (link)}) were used for measurement of antioxidant activity in viability assays (colony-forming units, CFU’s) and antigenotoxicity using the dominant deletion (dDEL) assay, respectively. The strain CEN.PK dDEL was created by replacing the HIS3 gene from the plasmid pPS1 with the dDEL cassette, which is limited by two partial alleles of the hphMX6Δ marker that comprise between them sequences with homology and a marker for geneticin (G418) resistance, in the laboratory strain CEN.PK 102-3A (Mata ura3-52 HIS3 leu2-3112 TRP1 MAL2-8c SUC2)^{21 (link)}. Upon double-strand break in the region comprised between the partial alleles of the hphMX6Δ marker, the homologous recombination repair pathway is activated, leading to the reversion of the marker. Due to this process, the strain loses the marker for geneticin resistance and becomes resistant to hygromycin B (HygB). The strains BY4741 and CEN.PK dDEL were cultured every week on solid rich medium [YPDA; composed of 1% (w/v) yeast extract (Acros Organics), 2% (w/v) peptone (BD Bacto), 2% (w/v) glucose, 2% (w/v) agar (Liofilchem)] and YPDA supplemented with 300 µg/mL geneticin, respectively, and stored at 4 °C. For each experiment, one colony from the cultures at 4 °C was suspended in liquid rich medium (YPD; same composition as YPDA, except agar) and YPD supplemented with 400 µg/mL geneticin for BY4741 and CEN.PK dDEL strains, respectively, and incubated at 30 °C and 200 rpm. Cell proliferation was monitored by measuring the optical density at 600 nm (OD₆₀₀). In the dDEL assay, the recombinant cells were selected on YPDA medium supplemented with 100 µg/mL HygB.

Oliveira D., Dias M.I., Barros L., Custódio L, & Oliveira R. (2023). Antigenotoxic properties of the halophyte Polygonum maritimum L. highlight its potential to mitigate oxidative stress-related damage. Scientific Reports, 13, 3727.

Full text: Click here

Publication 2023

Agar Alleles antibiotic G 418 Antioxidant Activity Biological Assay Cell Proliferation Cells Deletion Mutation Eukaryotic Cells Genes Geneticin Glucose Homologous Sequences Hygromycin B Peptones Plasmids Recombinational Repair of DNA Saccharomyces cerevisiae Saccharomycetales Strains tyrosinase-related protein-1 Vision

Generating Homology-Directed Repair Templates for GFP11 Insertion

The 4× GFP11 double-stranded DNA (dsDNA) donor templates [258 base pairs (bp)] for both N- and C-terminal insertion were synthesized in the pUC57 vector by GenScript (New Jersey, USA), containing four repeats of GFP11 separated by five amino acid linkers, as shown by Leonetti et al. (54 (link)). Homology-directed repair (HDR) templates were generated by polymerase chain reaction (PCR) amplification of the 4× GFP11 donor template with gene-specific primers (IDT, Iowa, USA) using Phusion DNA polymerase (NEB, Massachusetts, USA), resulting in HDR templates with 35- to 45-nucleotide (nt) homology arms. The final PCR product was confirmed on a 1 to 2% agarose gel and purified using the GeneJET PCR Purification Kit (Thermo Fisher Scientific, Massachusetts, USA). The concentration of the HDR template was measured on the NanoDrop before cell transfection.

Hastings J.F., Latham S.L., Kamili A., Wheatley M.S., Han J.Z., Wong-Erasmus M., Phimmachanh M., Nobis M., Pantarelli C., Cadell A.L., O’Donnell Y.E., Leong K.H., Lynn S., Geng F.S., Cui L., Yan S., Achinger-Kawecka J., Stirzaker C., Norris M.D., Haber M., Trahair T.N., Speleman F., De Preter K., Cowley M.J., Bogdanovic O., Timpson P., Cox T.R., Kolch W., Fletcher J.I., Fey D, & Croucher D.R. (2023). Memory of stochastic single-cell apoptotic signaling promotes chemoresistance in neuroblastoma. Science Advances, 9(9), eabp8314.

Full text: Click here

Publication 2023

Amino Acids Arm, Upper Cells Cloning Vectors DNA, Double-Stranded DNA-Directed DNA Polymerase Genes Nucleotides Oligonucleotide Primers Polymerase Chain Reaction Recombinational Repair of DNA Sepharose Tissue Donors Transfection

CRISPR-Cas9 Foxp3 Domain Swap Mice

The Foxp3 domain-swap mutant mice were generated by CRISPR/Cas9-based genome editing⁴⁰. Briefly, two sgRNAs containing the target sequences gRNA1(TGAAAGGGGGTCGCATATTG) and gRNA2 (AAACCACCCCGCCACCTGGA) and Cas9 protein were used to introduce double-strand DNA breaks; a 1340 base pair (bp) single-strand DNA (ssDNA) containing the sequence encoding the three amino acids mutations (W348Q, M370T, A372P) was used to introduce Foxp3 domain-swap mutations via homology-directed DNA repair mechanism. The gRNAs-Cas9 RNP together with ssDNA were injected into fertilized eggs derived from the Foxp3^Thy1.1 reporter mice, and then transplanted into pseudo-prepregnant recipient mice. The genomic region surrounding the target sites was amplified from genomic DNA of resultant founder progeny by PCR using the following primers: 5’-TCTGAGGAGCCCCAAGATGT 3’, 5’-CCACTCGCACAAAGCACTTG-3’. After verifying the Foxp3 domain-swap mutations by sequencing, Foxp3 DSM mice were bred with Foxp3^Thy1.1 mice and analyzed to determine the outcomes of the Foxp3 domain-swap mutation. Details of the ssDNA sequence are listed in Supplementary Table 1.

Liu Z., Lee D.S., Liang Y., Zheng Y, & Dixon J.R. (2023). Foxp3 Orchestrates Reorganization of Chromatin Architecture to Establish Regulatory T Cell Identity. bioRxiv.

Publication Preprint 2023

Amino Acids Base Pairing Clustered Regularly Interspaced Short Palindromic Repeats CRISPR-Associated Protein 9 DNA, Single-Stranded DNA Breaks, Double-Stranded Genome Mice, House Mutation Oligonucleotide Primers Recombinational Repair of DNA Transplant Recipients Zygote

NEFL Genetic Manipulation in 293T and SH-SY5Y Cells

Unless otherwise indicated, cells were transfected with 10 μg of DNA at 70–80% cell density using TransIT-LT1 (Mirus, 2300) for 293T cells and at 50–60% cell density with Lipofectamine 3000 (ThermoFisher Scientific, L3000001) for SH-SY5Y cells. For co-IPs, 293T cells were transfected with 8 μg of each DNA at 25–30% cell density. For CRISPR-tagging of NEFL, 10 million 293T cells seeded on a 15 cm culture dish were transfected with 10 μg of pSpCas9-GFP-NEFL knock-in construct (or pSpCas9-GFP-AAVS1, negative control) single gRNA (gRNA) and 20 μg of NEFL homology-directed repair vector at 50–60% cell density. For CRISPR deletion, 10 million 293T or 10 million SH-SY5Y cells seeded in a 15 cm culture dish were transfected with 15 μg of pSpCas9-GFP-NEFL knockout construct (or pSpCas9-GFP-AAVS1, negative control) gRNA.

Huynh D.T., Hu J., Schneider J.R., Tsolova K.N., Soderblom E.J., Watson A.J., Chi J.T., Evans C.S, & Boyce M. (2023). O-GlcNAcylation regulates neurofilament-light assembly and function and is perturbed by Charcot-Marie-Tooth disease mutations. bioRxiv.

Publication Preprint 2023

Cells Cloning Vectors Clustered Regularly Interspaced Short Palindromic Repeats Deletion Mutation HEK293 Cells Hyperostosis, Diffuse Idiopathic Skeletal Lipofectamine NEFL protein, human Recombinational Repair of DNA

Top products related to «Recombinational Repair of DNA»

Lipofectamine 2000 by Thermo Fisher Scientific

Sourced in United States, China, Germany, United Kingdom, Canada, Japan, France, Italy, Switzerland, Australia, Spain, Belgium, Denmark, Singapore, India, Netherlands, Sweden, New Zealand, Portugal, Poland, Israel, Lithuania, Hong Kong, Argentina, Ireland, Austria, Czechia, Cameroon, Taiwan, Province of China, Morocco

Lipofectamine 2000 is a cationic lipid-based transfection reagent designed for efficient and reliable delivery of nucleic acids, such as plasmid DNA and small interfering RNA (siRNA), into a wide range of eukaryotic cell types. It facilitates the formation of complexes between the nucleic acid and the lipid components, which can then be introduced into cells to enable gene expression or gene silencing studies.

Neon transfection system by Thermo Fisher Scientific

Sourced in United States, Germany, United Kingdom, Switzerland, Japan, France, China, Canada, Italy, Belgium, Luxembourg

The Neon Transfection System is a laboratory equipment designed for the efficient delivery of nucleic acids, such as DNA or RNA, into a variety of cell types. It utilizes electroporation technology to facilitate the transfer of these molecules across the cell membrane, enabling researchers to study gene expression, conduct functional assays, or modify cellular behavior.

Lipofectamine 3000 by Thermo Fisher Scientific

Sourced in United States, China, Germany, Japan, United Kingdom, France, Canada, Italy, Australia, Switzerland, Denmark, Spain, Singapore, Belgium, Lithuania, Israel, Sweden, Austria, Moldova, Republic of, Greece, Azerbaijan, Finland

Lipofectamine 3000 is a transfection reagent used for the efficient delivery of nucleic acids, such as plasmid DNA, siRNA, and mRNA, into a variety of mammalian cell types. It facilitates the entry of these molecules into the cells, enabling their expression or silencing.

Ultracruz transfection reagent by Santa Cruz Biotechnology

Sourced in United States, Germany

The UltraCruz Transfection Reagent is a laboratory product designed for efficient DNA, RNA, and protein transfection in cell culture studies. It is a lipid-based transfection reagent formulated to facilitate the delivery of nucleic acids and other macromolecules into eukaryotic cells.

Q5 polymerase by New England Biolabs

Sourced in United States, Germany, United Kingdom, Belgium

The Q5 polymerase is a high-fidelity DNA polymerase developed by New England Biolabs. It offers accurate and efficient DNA amplification for a variety of applications.

Fugene hd transfection reagent by Promega

Sourced in United States, Germany, United Kingdom, Japan, China, France, Canada, Australia, Italy, Switzerland

FuGENE HD is a transfection reagent that facilitates the delivery of nucleic acids, such as plasmid DNA, into mammalian cells. It is designed to enhance transfection efficiency in a variety of cell lines.

Pspcas9 bb 2a gfp by Addgene

Sourced in United States

PSpCas9(BB)-2A-GFP is a plasmid that encodes the Streptococcus pyogenes Cas9 (SpCas9) protein and a green fluorescent protein (GFP) reporter. The Cas9 protein is a RNA-guided DNA endonuclease that can be programmed to target specific genomic sequences for genome editing.

4d nucleofector by Lonza

Sourced in Switzerland, Germany, United States, Japan

The 4D-Nucleofector is a laboratory instrument designed for the transfection of cells. It utilizes electroporation technology to deliver nucleic acids, such as DNA or RNA, into cells. The core function of the 4D-Nucleofector is to facilitate the efficient introduction of these molecules into a variety of cell types, enabling researchers to conduct genetic and cellular studies.

Dulbecco modified eagle medium (dmem) by Thermo Fisher Scientific

Sourced in United States, China, United Kingdom, Germany, France, Australia, Canada, Japan, Italy, Switzerland, Belgium, Austria, Spain, Israel, New Zealand, Ireland, Denmark, India, Poland, Sweden, Argentina, Netherlands, Brazil, Macao, Singapore, Sao Tome and Principe, Cameroon, Hong Kong, Portugal, Morocco, Hungary, Finland, Puerto Rico, Holy See (Vatican City State), Gabon, Bulgaria, Norway, Jamaica

DMEM (Dulbecco's Modified Eagle's Medium) is a cell culture medium formulated to support the growth and maintenance of a variety of cell types, including mammalian cells. It provides essential nutrients, amino acids, vitamins, and other components necessary for cell proliferation and survival in an in vitro environment.

Opti mem by Thermo Fisher Scientific

Sourced in United States, United Kingdom, Germany, China, Japan, Canada, France, Switzerland, Italy, Australia, Belgium, Spain, Denmark, Ireland, Netherlands, Holy See (Vatican City State), Israel

Opti-MEM is a cell culture medium designed to support the growth and maintenance of a variety of cell lines. It is a serum-reduced formulation that helps to reduce the amount of serum required for cell culture, while still providing the necessary nutrients and growth factors for cell proliferation.

What is Recombinational Repair of DNA?

Recombinational Repair of DNA refers to the cellular process of repairing DNA double-strand breaks through the use of homologous recombination. This mechanism involves the exchange of genetic material between similar or identical DNA sequences, allowing the damaged DNA to be accurately restored. Recombinational repair plays a crucial role in maintaining genomic integrity and is involved in various cellular processes, such as DNA replication, meiosis, and the repair of ionizing radiation-induced DNA damage.

Why is understanding Recombinational Repair of DNA important?

What are the different types or variations of Recombinational Repair?

Recombinational repair can occur through several distinct pathways, including homologous recombination, single-strand annealing, and alternative end-joining. Each of these mechanisms utilizes unique protein complexes and intermediates to restore the damaged DNA, and they may be preferentially activated under different cellular conditions or in response to specific types of DNA lesions.

How can PubCompare.ai assist with Recombinational Repair research?

PubCompare.ai allows you to screen protocol literature more efficiently and leverage AI to pinpoint critical insights. The platform can help researchers identify the most effective protocols related to Recombinational Repair of DNA for their specific research goals. PubCompare.ai's AI-driven analysis can highlight key differences in protocol effectiveness, enabling you to choose the best option for reproducibility and accuracy, thus streamlining your DNA repair studies.

What are some common challenges in working with Recombinational Repair protocols?

One of the key challenges in working with Recombinational Repair protocols is the complexity of the underlying mechanisms and the need to carefully optimize experimental conditions to achieve reproducible results. Researchers must also be mindful of the potential for off-target effects or unintended consequences when manipulating these critical DNA repair pathways. PubCompare.ai can assist in identifying the most robust and reliable protocols to help overcome these hurdles.

More about "Recombinational Repair of DNA"

Recombinational DNA Repair, Homologous Recombination Repair, Double-Strand Break Repair, Genetic Recombination, Genetic Restoration, Chromosome Repair, Molecular Recombination, Cellular DNA Repair, Genome Integrity Maintenance, DNA Replication Repair, Meiotic Recombination, Ionizing Radiation Damage Repair, Cancer Biology, Developmental Biology, Evolutionary Genetics.
The cellular process of repairing DNA double-strand breaks through the use of homologous recombination involves the exchange of genetic material between similar or identical DNA sequences, allowing the damaged DNA to be accurately restored.
This mechanism plays a crucial role in maintaining genomic integrity and is involved in various cellular processes, such as DNA replication, meiosis, and the repair of ionizing radiation-induced DNA damage.
Understanding the mechanisms and regulation of recombinational repair is essential for advancing research in fields like cancer biology, developmental biology, and evolutionary genetics.
Researchers can leverage cutting-edge tools like Lipofectamine 2000, Neon Transfection System, Lipofectamine 3000, and UltraCruz Transfection Reagent to efficiently deliver genetic material and study recombinational repair in cell lines.
Additionally, high-fidelity enzymes like Q5 polymerase and transfection reagents such as FuGENE HD can be utilized to enhance experimental reproducibility.
The CRISPR-Cas9 system, represented by the PSpCas9(BB)-2A-GFP construct, has also emerged as a powerful tool for genome editing and investigating recombinational repair pathways.
Techniques like 4D-Nucleofection can be employed to introduce genetic material into hard-to-transfect cell types.
Culturing cells in DMEM or Opti-MEM media can provide the necessary nutrients and support for studying recombinational repair processes.
By leveraging these advanced tools and techniques, researchers can gain deeper insights into the mechanisms and regulation of recombinational DNA repair, ultimately advancing our understanding in fields such as cancer biology, developmental biology, and evolutionary genetics.