Log In Sign up
The largest database of trusted experimental protocols
> Physiology > Genetic Function > Transcription Initiation, Genetic

Transcription Initiation, Genetic

Transcription Initiation, Genetic is the process by which the transcription of genetic information from DNA to messenger RNA is initiated.
This complex process involves the coordinated action of RNA polymerase, transcription factors, and other regulatory elements that recognize and bind to specific DNA sequences, allowing the transcription machinery to assemble and begin the synthesis of RNA.
Undestanding the mechanisms of transcription initiation is crucial for studying gene expression, regulation, and the development of therapeutic interventions targeting transcriptional dysregulation.
Reseachers can leverage AI-driven literature analysis tools like PubCompare.ai to efficiently identify the most relevant protocols, products, and methods to accelerate their genetic transcription initiation research.

Most cited protocols related to «Transcription Initiation, Genetic»

1
CRISPR-Cas9 Genome Editing in C. elegans
Plasmids have been deposited in Addgene with the following accession numbers: Cas9-sgRNA plasmid targeting a site near ttTi5605, #47550; Cas9-sgRNA plasmid with no targeting sequence, #47549; Peft-3::Cre::tbb-2 3’UTR construct, #47551. All other plasmids used in this study are available from the authors upon request.
To construct the Cas9-sgRNA expression plasmid shown in Fig. 1c, we first designed a synthetic gene encoding Cas9, with C. elegans coding bias and synthetic C. elegans introns, using the C. elegans Codon Adapter40 (link). Our Cas9 sequence includes a Nuclear Localization Signal and an HA tag at the C-terminus. The synthetic gene was produced as a series of overlapping 500 bp gBlocks (Integrated DNA Technologies), assembled using Gibson Assembly (New England BioLabs) and inserted into the vector pCFJ601 (Peft-3::Mos1 Transposase::tbb-2 3’UTR)17 (link) in place of the Mos1 transposase. Next, a gBlock containing the U6 promoter and sgRNA sequence was inserted 3’ of the tbb-2 3’UTR. Genomic targets of Cas9 conform to the target sequence GN19NGG, where N is any base. The initial G is a requirement for transcription initiation by the U6 promoter, and the NGG (PAM) motif is required for Cas9 activity (note that the NGG motif must be present in the genomic target but is not included in the sgRNA sequence). To target Cas9 to different genomic sequences, we inserted the desired targeting sequence into the Cas9 + sgRNA construct using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs) with forward primer 5’-N19GTTTTAGAGCTAGAAATAGCAAGT-3’, where N19 is replaced by the desired 19 bp targeting sequence, and reverse primer 5’-CAAGACATCTCGCAATAGG-3’. Supplementary Table 5 lists the targeting sequences used in this study.
Targeting vectors for single-copy transgene insertion on chromosome II were constructed in the pCFJ150 vector backbone20 (link) using Gateway cloning. We used site-directed mutagenesis with the Q5 site-directed mutagenesis kit (New England Biolabs) to delete a short region of the 3’ recombination arm comprising the Cas9 target sequence, to prevent the homologous repair templates from being cleaved by Cas9.
Homologous repair templates for GFP insertion and lin-31 mutagenesis were constructed in two steps. First, we PCR amplified a 3–4 kb region centered on the desired modification from N2 genomic DNA and cloned the resulting fragment into the pCR-Blunt vector using the ZeroBlunt TOPO Cloning Kit (Life Technologies). Second, we modified this genomic clone by inserting GFP (for GFP knock-ins) or a 3’ exon containing point mutations (for lin-31 mutagenesis), along with the unc-119(+) rescue gene flanked by LoxP sites. GFP and unc-119(+) fragments were generated by PCR, and LoxP sites were included in the unc-119(+) primers. The mutated lin-31 3’ exons were synthesized as gBlocks. These fragments were integrated into the genomic clones using Gibson assembly, which allows for seamless fusion of DNA fragments without the need to include any extra sequence (e.g. restriction sites). To avoid cleavage of the repair templates by Cas9, we deleted or mutated the Cas9 target site in all repair templates. Complete plasmid sequences of all targeting vectors are available from the authors upon request.
To construct the Peft-3::Cre::tbb-2 3’UTR plasmid used for removal of selectable markers with Cre recombinase, we first amplified the Cre ORF from the plasmid pEM3 (ref. 41 (link)) and cloned it into the Gateway donor vector pDONR221. We then performed a 3-fragment gateway reaction using our Cre donor vector, pCFJ386 (Peft-3; a gift from Christian Frøkjær-Jensen), pCM1.36 (tbb-2 3’UTR)42 (link) and the destination vector pCFJ212 (ref. 17 (link)), which contains an unc-119(+) rescue gene.
Supplementary Table 6 lists all primers used in this study.
Dickinson D.J., Ward J.D., Reiner D.J, & Goldstein B. (2013). Engineering the Caenorhabditis elegans Genome Using Cas9-Triggered Homologous Recombination. Nature methods, 10(10), 1028-1034.
Publication 2013
3' Untranslated Regions Caenorhabditis elegans Chromosomes Cloning Vectors Codon Cre recombinase Cytokinesis Exons Genes Genome Introns Mos1 transposase Mutagenesis Mutagenesis, Site-Directed Nuclear Localization Signals Oligonucleotide Primers Plasmids Point Mutation Recombination, Genetic Synthetic Genes Tissue Donors Topotecan Transcription Initiation, Genetic Transgenes
2
Integrative Analysis of Transcriptional Regulation in E. coli
From the intensity files, macs2 software (7 (link)) and BEDOPS (8 ) commands were run to obtain enrichment regions. These sequences were processed with matrix scan from RSAT tools (9 (link)) to obtain putative TFBSs. A HT TFBS and a RegulonDB TFBS were considered the same if they overlapped in >50% of their length. Conditions or phenotypes of RNA-seq experiments were identified to generate a condition contrast. The two conditions in RNA-seq datasets were compared with a two-sample t-test and the resulting p-values were adjusted for the false discovery rate (FDR). The log2 fold change across conditions and the FDR P-values were used to construct a volcano plot (10 (link)) highlighting the differentially expressed genes (FDR < 5%). To identify RIs, the TFBSs were mapped, when possible, to the regulatory regions of Escherichia coli genes using an ad hoc python script. A regulatory region per gene per TF was defined either by the distance to the farthest known TFBS (with strong evidence) of such TF or as the interval between −400 and +100 base-pairs with respect to transcription initiation. The processing of files is shown in Supplementary Figure S1.
Santos-Zavaleta A., Salgado H., Gama-Castro S., Sánchez-Pérez M., Gómez-Romero L., Ledezma-Tejeida D., García-Sotelo J.S., Alquicira-Hernández K., Muñiz-Rascado L.J., Peña-Loredo P., Ishida-Gutiérrez C., Velázquez-Ramírez D.A., Del Moral-Chávez V., Bonavides-Martínez C., Méndez-Cruz C.F., Galagan J, & Collado-Vides J. (2018). RegulonDB v 10.5: tackling challenges to unify classic and high throughput knowledge of gene regulation in E. coli K-12. Nucleic Acids Research, 47(Database issue), D212-D220.
Publication 2018
Escherichia coli Genes Genes, vif Phenotype Python Radionuclide Imaging Regulatory Sequences, Nucleic Acid RNA-Seq Transcription Initiation, Genetic
3
Comprehensive Atlas of Transcription Start Sites
A comprehensive description of the method and analysis software can be found in the Supplemental Methods as well as at http://homer.ucsd.edu/homer/ngs/csRNAseq/. Small RNAs of ∼20–60 nt were size-selected from 2–15 µg of total RNA by denaturing gel electrophoresis (Supplemental Fig. S7). A 10% input sample was taken aside and the remainder enriched for 5′-capped RNAs with 3′-OH. Monophosphorylated RNAs were selectively degraded by Terminator 5′-phosphate-dependent exonuclease (Lucigen). Subsequent 5′ dephosporylation by CIP (NEB) followed by decapping with RppH (NEB) augments Cap-specific 5′ adapter ligation by T4 RNA ligase 1 (NEB). The 3′ adapter was ligated using truncated T4 RNA ligase 2 (NEB) without prior 3′ repair to select against degraded RNA fragments. Following cDNA synthesis, libraries were amplified for 11–14 cycles and sequenced SE75 on the Illumina NextSeq 500.
Sequencing reads were trimmed for 3′ adapter sequences (AGATCGGAAGAGCACACGTCT) using HOMER (“homerTools trim”) and aligned using HISAT2 (Kim et al. 2015 (link)) with default parameters. For mapping stats and statistics, please see Supplemental Table S1. TSS clusters were defined using HOMER's findcsRNATSS.pl tool that automates the following analysis steps to produce an annotated list of likely TSSs: (1) Peaks of strand-specific csRNA-seq reads found within 150 bp with a minimum read-depth of seven reads per 107 aligned reads and greater than twofold reads per base pair than the surrounding 10 kb were considered for further analysis. This step eliminates loci with minimal numbers of supporting reads or regions with high levels of diffuse signal. (2) Short RNA input libraries (and/or total RNA-seq) were integrated and the appropriate enrichment thresholds for csRNA-seq reads over input or total RNA-seq libraries calculated. The optimal threshold is defined as the ratio that generates the largest difference in cumulative distributions of putative TSS regions in annotated TSS regions (i.e., true positives) relative to putative TSSs identified in downstream exons (i.e., likely false positives). This semisupervised threshold detection approach is most needed when RNA quality is low. By using this approach, we were able to successfully call TSSs from libraries generated from RNA with RIN numbers as low as two.
To estimate the likely stability of transcripts initiating from each TSS, total RNA-seq reads (sense strand) are quantified from [−100,+500] relative to the TSS. “Stable TSSs” were defined as TSS clusters containing at least two per 107 RNA-seq reads within this region. Bidirectional or divergent transcription for a given TSS cluster was calculated by quantifying csRNA-seq signal on the opposite strand [−500,+100] relative to the TSS. Regions with at least two csRNA-seq reads per 107 were called as “bidirectional” TSSs. TSS clusters were further annotated based on their overlaps with annotated gene regions (i.e., exons, introns, etc.), and the closest annotated gene promoters were also identified to assess their distal annotation (promoter-distal TSSs defined as >500 bp from annotated gene TSSs). TSSs from alternative transcription initiation methods were analyzed using the same pipeline as described for csRNA-seq to ensure a fair comparison among assay types. Modifications were made to adapter trimming as needed per data set to remove the correct 3′ adapter, and for assays that use paired end sequencing, only the read encoding the 5′ initiation site was used in downstream analysis.
Duttke S.H., Chang M.W., Heinz S, & Benner C. (2019). Identification and dynamic quantification of regulatory elements using total RNA. Genome Research, 29(11), 1836-1846.
Full text: Click here
Publication 2019
Anabolism Base Pairing Biological Assay DNA, Complementary Electrophoresis Exons Exonuclease Genes Introns Ligation Phosphates Promoter, Genetic RNA-Seq RNA Caps RNA Ligase (ATP) Toxic Shock Syndrome TRAF3 protein, human Transcription, Genetic Transcription Initiation, Genetic Transcription Initiation Site Whole Transcriptome Sequencing
4
Constructing Lentiviral CRISPR-Cas9 Vectors
The U6-sgRNA-EFS-Cas9-2A-Cre (pSECC) lentiviral vector was constructed by assembling four parts with overlapping DNA ends using Gibson assembly. Briefly, a 2.2kb part (corresponding to the U6-Filler fragment from LentiCRISPR28 (link)), a 0.3kb part (corresponding to the EFS promoter from LentiCRISPR28 (link)), a 5.3kb part (corresponding to a Cas9-2A-Cre fragment, which was generated by assembly PCR) and a 5.7kb lentiviral backbone were assembled using Gibson assembly following manufacturer guidelines. Detailed cloning strategies and primer sequences are available on request. For sgRNA cloning, the pSECC vector was digested with BsmBI and ligated with BsmBI-compatible annealed oligos (Supplementary Table 1). sgRNAs were designed using CRISPR Design24 (which was also used to predict potential off-target sites; see Extended Data Fig. 8 and Supplementary Tables 2) or E-CRISP29 (link), except for sgApc which was previously reported17 (link). An extra G (required for U6 transcriptional initiation) was added to the 5′ end of sgRNAs that lacked it.
Sánchez-Rivera F.J., Papagiannakopoulos T., Romero R., Tammela T., Bauer M.R., Bhutkar A., Joshi N.S., Subbaraj L., Bronson R.T., Xue W, & Jacks T. (2014). Rapid modeling of cooperating genetic events in cancer through somatic genome editing. Nature, 516(7531), 428-431.
Publication 2014
2',5'-oligoadenylate Cloning Vectors Clustered Regularly Interspaced Short Palindromic Repeats Oligonucleotide Primers Transcription Initiation, Genetic Vertebral Column
5
Constructing Lentiviral CRISPR-Cas9 Vectors
The U6-sgRNA-EFS-Cas9-2A-Cre (pSECC) lentiviral vector was constructed by assembling four parts with overlapping DNA ends using Gibson assembly. Briefly, a 2.2kb part (corresponding to the U6-Filler fragment from LentiCRISPR28 (link)), a 0.3kb part (corresponding to the EFS promoter from LentiCRISPR28 (link)), a 5.3kb part (corresponding to a Cas9-2A-Cre fragment, which was generated by assembly PCR) and a 5.7kb lentiviral backbone were assembled using Gibson assembly following manufacturer guidelines. Detailed cloning strategies and primer sequences are available on request. For sgRNA cloning, the pSECC vector was digested with BsmBI and ligated with BsmBI-compatible annealed oligos (Supplementary Table 1). sgRNAs were designed using CRISPR Design24 (which was also used to predict potential off-target sites; see Extended Data Fig. 8 and Supplementary Tables 2) or E-CRISP29 (link), except for sgApc which was previously reported17 (link). An extra G (required for U6 transcriptional initiation) was added to the 5′ end of sgRNAs that lacked it.
Sánchez-Rivera F.J., Papagiannakopoulos T., Romero R., Tammela T., Bauer M.R., Bhutkar A., Joshi N.S., Subbaraj L., Bronson R.T., Xue W, & Jacks T. (2014). Rapid modeling of cooperating genetic events in cancer through somatic genome editing. Nature, 516(7531), 428-431.
Publication 2014
2',5'-oligoadenylate Cloning Vectors Clustered Regularly Interspaced Short Palindromic Repeats Oligonucleotide Primers Transcription Initiation, Genetic Vertebral Column

Most recents protocols related to «Transcription Initiation, Genetic»

1
Fluorescence-based Transcription Initiation Assays
Environment-dependent fluorescence intensity enhancement of Cy3 has also been exploited to study the formation of an unwound transcription initiation bubble comprised of ssDNA segments by RNA polymerase (RNAP) as it binds and unwinds promoter dsDNA. In a first ensemble-level study, Ko and Heyduk [100 (link)] reported that the fluorescence intensity from a Cy3 strategically placed on promoter DNA showed a ~two-fold increase upon binding of RNAP. Subsequently, the Cy3 signature showed a similar decrease after transcription initiation and promoter escape. The results and control experiments described in the same report indicated that the observed fluorescence intensity increase is due to the unwinding of dsDNA to ssDNA upon RNAP binding, while a decrease results from the rewinding of ssDNA to dsDNA upon promoter escape. The large ~two-fold fluorescence enhancement in unwinding-induced fluorescence enhancement (UIFE) assays could possibly result from a combination of binding of RNAP to the promoter dsDNA, unwinding of promoter dsDNA to ssDNA segments, and subsequent conformational changes involving the unwound ssDNA segment and RNAP. The ensemble assay is simple and straightforward to implement and has been used extensively in studies investigating the mechanism of promoter unwinding and promoter escape in transcription by several groups [62 (link),100 (link)–103 ].
Later, the Ha lab implemented a single-molecule UIFE (smUIFE) assay to study the kinetics and mechanism of transcription initiation by a phage T7 RNAP [104 (link)]. More recently, similar smUIFE experiments were used in real-time single-molecule assays investigating the promoter unwinding mechanism by a bacterial RNAP (Figure 4C). Here, the authors monitored the unwinding kinetics of the upstream and downstream segments of a promoter fragment to show that unwinding occurs in steps that proceed from upstream towards the downstream direction [74 (link)]. The smUIFE assays can potentially be combined with high-throughput single-molecule studies of large promoter sequence libraries, enabling a complete dissection of the promoter sequence dependence during this stage of transcription initiation. Similar assays can also be used in other processes that involve DNA unwinding and rewinding, such as replication initiation and nucleic acid helicase and topoisomerase activities. Notably, such assays will carry different signal contributions from the unwinding and the rewinding process, as well as from the proximity of the protein machinery.
Importantly, fluorescence enhancement mechanisms similar to the ones mentioned above exist, where stabilization of the planar excited-state occurs via binding to a molecular scaffold, are used in other fluorescent probes. These dyes are useful due to their increased fluorescence upon binding to, e.g., nucleic acids (e.g., TOTO, YOYO) [105 (link)] or to amyloid-like fibrils (e.g., Thioflavin T [106 (link)], Nile red [107 ]).
Ploetz E., Ambrose B., Barth A., Börner R., Erichson F., Kapanidis A.N., Kim H.D., Levitus M., Lohman T.M., Mazumder A., Rueda D.S., Steffen F.D., Cordes T., Magennis S.W, & Lerner E. (2023). A new twist on PIFE: photoisomerisation-related fluorescence enhancement. ArXiv.
Publication Preprint 2023
1,1'-((4,4,7,7-tetramethyl)-4,7-diazaundecamethylene)bis-4-(3-methyl-2,3-dihydro(benzo-1,3-oxazole)-2-methylidine)quinolinium, tetraiodide 1,1'-(4,4,7,7-tetramethyl-4,7-diazaundecamethylene)bis-4-(3-methyl-2,3-dihydro(benzo-1,3-thiazole)-2-methylidene)quinolinium Amyloid Fibrils bacteriophage T7 RNA polymerase Biological Assay Dissection DNA, Double-Stranded DNA, Single-Stranded DNA-Directed RNA Polymerase DNA Helicases DNA Replication Dyes Fluorescence Fluorescent Probes Kinetics Nucleic Acids Proteins RNA, Bacterial thioflavin T Transcription, Genetic Transcription Initiation, Genetic
2
Neonatal and Birth Outcomes in Canada
We included 4 primary neonatal outcomes and 1 primary birth outcome: perinatal death (any stillbirth or neonatal death, as determined by the Canadian Institute for Health Information Discharge Abstract Database); low birth weight of less than 2500 g; preterm birth at less than 37 weeks; Apgar of less than 7 at 5 minutes; and cesarean delivery (all types). Secondary outcomes included labour induction with oxytocin, VBAC, assisted vaginal delivery (vacuum, forceps or both), spontaneous vaginal birth (SVB), third- or fourth-degree perineal tears, and breast- or chest-feeding initiation within 1 hour of birth.
Stoll K., Titoria R., Turner M., Jones A, & Butska L. (2023). Perinatal outcomes of midwife-led care, stratified by medical risk: a retrospective cohort study from British Columbia (2008–2018). CMAJ : Canadian Medical Association Journal, 195(8), E292-E299.
Publication 2023
Breast Cesarean Section Childbirth Forceps Infant, Newborn Labor, Induced Obstetric Delivery Oxytocin Patient Discharge Perineum Premature Birth Tears Transcription Initiation, Genetic Vacuum Vagina
3
Factors Influencing Infant Feeding Practices
Data collection was based on the electronic medical records. All children born in the hospital with infant feeding records were included. The study sample was selected by simple random sampling. The response variable was infant feeding. Feeding type upon hospital discharge was classified and grouped as BF, artificial, or mixed. Infants who abandoned exclusive BF were assigned to the artificial or mixed group. Milk feeding was measured at 1, 2, 4, and 6 months postpartum. Exclusive MBF was defined as infants who were fed exclusively drawn/donor breast milk from the mother. In addition, MBF newborns only received vitamin drops or syrups, medications, or minerals [15 ]. Artificial feeding was defined when the breastfed infant was fed only with artificial milk, and mixed feeding was defined when an infant’s feeding combined BF and artificial milk.
The study variables were: (1) socio-demographic (maternal age and country of origin) and (2) obstetric (gestational age, parity, pregnancy risk (based on the Spanish Society of Gynaecology and Obstetrics, classification as low, medium, high/very high determined by healthcare provider. Different factors, such as maternal age, previous medical conditions, previous or actual obstetric history, and lifestyle factors, may affect the mother´s health and/or the developing foetus [15 ]), birth initiation, amniorrhexis type, analgesia, and end of birth); following the recommendations of Devane et al. [16 (link)], (3) perinatal variables (newborn’s sex, birth weight, birth length, cephalic perimeter, umbilical artery pH), and (4) feeding (LATCH breastfeeding assessment tool [17 (link)], EIBF time and feeding type) were included. The time until EIBF was recorded by the midwife who assisted the birth as routine data in the electronic medical record and was categorised into two periods, ≤60 min or >60 min, with a maximum time of 120 min. The LATCH score was measured and recorded on the date of discharge from the hospital. This LATCH scale measures BF efficiency using five items. Each item is given a maximum score of 2 points and a minimum score of 0, with a maximum 10-point score (the acronym LATCH corresponds to: L ‘how well infant latches onto the breast’, A ‘audible swallowing’, T ‘type of nipple’, C ‘comfort’, and H ‘hold-positioning’). To optimise the LATCH analysis, LATCH scores were categorised into two categories: <9 points and 9–10 points. As reported by other authors, a LATCH score ≥8 at 48 h or discharge had a sensitivity of 93.5% and specificity of 92.1%, with these mothers being 9.28 times more likely to BF at 6 weeks postpartum [17 (link)].
Sample size was calculated by assuming a 50% MBF prevalence at 6 months postpartum with 5% precision, a 95% confidence interval (95%CI), and an expected 10% proportion of losses. The sample required 335 women. Finally, randomisation of medical record numbers was performed for the births that occurred during the study period, assigning every individual a number by using a random number generator and then randomly picking a subset of the estimated population.
Mena-Tudela D., Soriano-Vidal F.J., Vila-Candel R., Quesada J.A., Martínez-Porcar C, & Martin-Moreno J.M. (2023). Is Early Initiation of Maternal Lactation a Significant Determinant for Continuing Exclusive Breastfeeding up to 6 Months?. International Journal of Environmental Research and Public Health, 20(4), 3184.
Full text: Click here
Publication 2023
Birth Weight Breast Child Childbirth Fetus Gestational Age Health Personnel Hispanic or Latino Hypersensitivity Infant Infant, Newborn Management, Pain Midwife Milk Minerals Mothers Nipples Nursing Assessment Patient Discharge Perimetry Pharmaceutical Preparations Pregnancy Tissue Donors Transcription Initiation, Genetic Umbilical Arteries Vitamins Woman
4
Virtual Screening of Antibacterial Compounds
In the Schrödinger software package for selected antibiotic activity target proteins, the molecular modeling of binding to isolated natural compounds was performed. The molecular modeling algorithm was standard and consisted in the preparation of selected target proteins, preparation of ligands, subsequent docking, and evaluation of target binding. The compounds are ranked in scoring function values as Gibbs binding energies. The crystal structures of all the targets were downloaded from RCSB PDB database (https://www.rcsb.org/ accessed on 9 February 2023) with corresponding PDBID—transcription initiation complex (6VVT) [24 (link)], dihydrofolate reductase (2WV3) [25 (link)], elongation factor G (2BV3) [26 (link)], enoyl-acyl carrier protein reductase (2PD4) [27 (link)], and deacetylase LpxC (2GO4) [28 (link)]. All the ligands, ions, and water molecules were removed from the structures. Hydrogen was first added to each structure, and then the polar hydrogen atoms were removed. The compound library was prepared in the LigPrep module. Molecular docking was performed using the Schrödinger software package (Schrödinger, LLC: New York, NY, USA, 2017) using the gelid algorithm with the corresponding scoring function calculated [29 (link),30 (link)].
Babich O., Larina V., Krol O., Ulrikh E., Sukhikh S., Gureev M.A., Prosekov A, & Ivanova S. (2023). In Vitro Study of Biological Activity of Tanacetum vulgare Extracts. Pharmaceutics, 15(2), 616.
Full text: Click here
Publication 2023
Acyl Carrier Protein Antibiotics cDNA Library Hydrogen Ions Ligands Oxidoreductase Peptide Elongation Factor G Protein Targeting, Cellular Tetrahydrofolate Dehydrogenase Transcription, Genetic Transcription Initiation, Genetic
5
Engineered p14ARF Promoter for Targeted Gene Expression
The human p14ARF gene promoter region was originally identified as a 5.6-kb CpG-rich region 5′ upstream of the p14 first exon (1β) [10 (link)]. However, investigators have used the first 800 bases immediately upstream of the transcription initiation site, and have shown that this region is sufficient to confer AP1 and E2F regulation in a sensitive reporter system [9 (link)]. This region, which we termed the minimal human p14ARF promoter (p14ARFmin), was the starting promoter region in our p14ARF promoter constructs. The modified p14ARFmin promoter was amplified by PCR from human genomic DNA using the published sequence [9 (link)]. Forward primer, 5′- CCATTAATGTCGACAGCTCCGGCAGCGC-3′ and reverse primer, 5′-ACTCGAGATCTCCGCCCCG.
CAGGCGCGCA-3′ were used along with the restriction sites AseI and XhoI to replace the CMV promoter of pIRES vector with the p14ARF promoter.
Since attempts at expressing GFP in the mut Ras/mut p53 pancreatic cell lines were unsuccessful with the p14ARF promoter (data not shown), a promoter analysis program (Cister: Cis-element Cluster finder, Boston University) was used to detect the presence and efficacy of various transcription factor binding elements and promoter features. We did not use the whole p14ARF promoter because it was too large (5.6 kb) for use in an adenovirus vector, which holds a maximum of 5 kb. While this program identified an E2F potential binding site [9 (link)], its homology to the consensus E2F site was low. Additionally, an AP-1 site, the “TATA” box, and the transcription initiation site, while present, also showed poor homology with consensus sites. Two reporter plasmids, pAP1-Luc and pE2F-Luc (BD Bioscience Clontech, Palo Alto, CA, USA), were then used to transfer each of the transcription factor binding elements, E2F and Ap1 enhancers, to a 5′ region upstream of the p14ARF promoter. The E2F enhancer site, containing 4 tandem repeat E2F elements totaling 70 bp, and the AP1 enhancer site, containing 4 tandem repeat Ap1 elements totaling 50 bp, were amplified by PCR and inserted upstream of the p14ARF promoter. Sequencing was performed to confirm the direction of orientation and the integrity of the promoter’s structure. Additionally, using designed primers and serial PCR amplifications, the sequence of the downstream p14ARF was modified by inserting the TATA box and transcription initiation sequence, which shares more homology with the consensus TATA box sequence than that found in the p14ARF promoter. The TATA box was important in transcription because the TATA factor binding to the region recruits additional factors to initiate transcription. The constructed promoter Ap1e-E2Fe-p14ARF-TATA–transcription initiation site was called the modified p14ARFmin promoter, or simply called the p14ARF. The modified promoter was inserted into the replaced CMV promoter site to make the respective plasmids p14ARF-p14 or tBID or p14-IRES-tBID and p14-IRES-GFP (Figure 1A–D).
Fine R.L., Mao Y., Garcia-Carracedo D., Su G.H., Qiu W., Hochfeld U., Nichols G., Li Y.L., Dinnen R.D., Raffo A, & Brandt-Rauf P.W. (2023). Gene Therapy with p14/tBID Induces Selective and Synergistic Apoptosis in Mutant Ras and Mutant p53 Cancer Cells In Vitro and In Vivo. Biomedicines, 11(2), 258.
Full text: Click here
Publication 2023
Adenovirus Vaccine Binding Sites CDKN2A Gene Cell Lines Cloning Vectors Exons Genome, Human Homologous Sequences Homo sapiens Internal Ribosome Entry Sites Oligonucleotide Primers Pancreas Plasmids Tandem Repeat Sequences TATA Box TBP protein, human Transcription, Genetic Transcription Factor Transcription Initiation, Genetic Transcription Initiation Site

Top products related to «Transcription Initiation, Genetic»

1
Smarter race cdna amplification kit by Takara Bio
Sourced in United States, Japan, China, Germany, Canada, France
The SMARTer RACE cDNA Amplification Kit is a laboratory tool designed for the rapid amplification of cDNA sequences from the 5' and 3' ends of mRNA transcripts. The kit employs a proprietary SMART (Switching Mechanism at 5' End of RNA Transcript) technology to generate high-quality cDNA from limited amounts of starting material.
2
Dual luciferase reporter assay system by Promega
Sourced in United States, China, Germany, United Kingdom, Switzerland, Japan, France, Italy, Spain, Austria, Australia, Hong Kong, Finland
The Dual-Luciferase Reporter Assay System is a laboratory tool designed to measure and compare the activity of two different luciferase reporter genes simultaneously. The system provides a quantitative method for analyzing gene expression and regulation in transfected or transduced cells.
3
Microinjector by Harvard Apparatus
Sourced in United States
The Microinjector is a precise and versatile instrument designed for the injection of small volumes into cells, tissues, or other biological samples. It enables the controlled and accurate delivery of liquids, solutions, or suspensions into targeted areas with minimal disruption. The core function of the Microinjector is to provide a reliable and reproducible method for introducing substances into biological systems for research, experimental, or therapeutic purposes.
4
Smarter race 5 3 kit by Takara Bio
Sourced in United States, Japan, China, France, Germany
The SMARTer RACE 5'/3' Kit is a laboratory tool designed to facilitate the rapid amplification of cDNA sequences from the 5' and 3' ends of mRNA. It employs a template-switching mechanism to generate full-length cDNA transcripts, which can then be used for downstream applications such as gene identification and expression analysis.
5
Nextseq 500 by Illumina
Sourced in United States, Germany, China, United Kingdom, Australia, France, Italy, Canada, Japan, Austria, India, Spain, Switzerland, Cameroon, Netherlands, Czechia, Sweden, Denmark
The NextSeq 500 is a high-throughput sequencing system designed for a wide range of applications, including gene expression analysis, targeted resequencing, and small RNA discovery. The system utilizes reversible terminator-based sequencing technology to generate high-quality, accurate DNA sequence data.
6
Generacer kit by Thermo Fisher Scientific
Sourced in United States, China, Japan, United Kingdom
The GeneRacer kit is a tool used for rapid amplification of cDNA ends (RACE). It is designed to facilitate the cloning of full-length cDNA sequences from small amounts of total RNA. The kit provides a simple and efficient method for adding known sequences to the 5' and 3' ends of cDNA, which can then be used as priming sites for PCR amplification.
7
Mmessage mmachine sp6 kit by Thermo Fisher Scientific
Sourced in United States, Netherlands, Switzerland
The MMessage mMachine SP6 kit is a tool used for in vitro transcription of RNA. It enables the synthesis of capped and polyadenylated mRNA from DNA templates using the T7 RNA polymerase. The kit provides the necessary reagents and protocols to perform this process.
8
Rneasy mini kit by Qiagen
Sourced in Germany, United States, United Kingdom, Netherlands, Spain, Japan, Canada, France, China, Australia, Italy, Switzerland, Sweden, Belgium, Denmark, India, Jamaica, Singapore, Poland, Lithuania, Brazil, New Zealand, Austria, Hong Kong, Portugal, Romania, Cameroon, Norway
The RNeasy Mini Kit is a laboratory equipment designed for the purification of total RNA from a variety of sample types, including animal cells, tissues, and other biological materials. The kit utilizes a silica-based membrane technology to selectively bind and isolate RNA molecules, allowing for efficient extraction and recovery of high-quality RNA.
9
Lipofectamine 2000 by Thermo Fisher Scientific
Sourced in United States, China, Germany, United Kingdom, Canada, Japan, France, Italy, Switzerland, Australia, Spain, Belgium, Denmark, Singapore, India, Netherlands, Sweden, New Zealand, Portugal, Poland, Lithuania, Hong Kong, Argentina, Ireland, Austria, Israel, Czechia, Cameroon, Taiwan, Province of China, Morocco
Lipofectamine 2000 is a cationic lipid-based transfection reagent designed for efficient and reliable delivery of nucleic acids, such as plasmid DNA and small interfering RNA (siRNA), into a wide range of eukaryotic cell types. It facilitates the formation of complexes between the nucleic acid and the lipid components, which can then be introduced into cells to enable gene expression or gene silencing studies.
10
Daf 15 raptor by Horizon Discovery
The Daf-15/Raptor is a lab equipment product from Horizon Discovery. It is a tool used for the study and manipulation of the Daf-15 gene and its associated signaling pathways. The core function of this product is to provide researchers with the ability to investigate the role of the Daf-15 gene in various biological processes.

More about "Transcription Initiation, Genetic"

Transcription initiation, the critical first step in gene expression, involves the complex interplay of RNA polymerase, transcription factors, and regulatory elements binding to specific DNA sequences.
This process kickstarts the synthesis of messenger RNA (mRNA), which carries the genetic instructions for protein production.
Understanding the mechanisms governing transcription initiation is pivotal for studying gene regulation and developing potential therapeutic interventions for transcriptional dysregulation-related diseases.
Researchers can leverage powerful AI-driven literature analysis tools like PubCompare.ai to efficiently identify the most relevant protocols, products, and methods to accelerate their genetic transcription initiation research.
These platforms allow scientists to easily locate the best techniques from publications, preprints, and patents, enabling them to pinpoint the most effective products and methods.
For example, techniques like the SMARTer RACE cDNA Amplification Kit, Dual-Luciferase Reporter Assay System, and GeneRacer kit can be used to study transcription initiation.
Microinjectors and the NextSeq 500 sequencing platform can also be employed to further investigate this critical process.
Additionally, the MMessage mMachine SP6 kit, RNeasy Mini Kit, and Lipofectamine 2000 transfection reagent can facilitate gene expression studies related to transcription initiation.
Integrating the insights from Daf-15/Raptor, a key regulator of cell growth and metabolism, can also provide valuable context for understanding the broader cellular mechanisms underlying transcription initiation.
By leveraging the power of AI-driven literature analysis and a diverse toolkit of research methods and products, scientists can accelerate their investigations into the fundamental mechanisms of genetic transcription initiation.