Log In Sign up
The largest database of trusted experimental protocols
> Physiology > Molecular Function > RNA Cleavage

RNA Cleavage

RNA cleavage refers to the process of breaking down RNA molecules into smaller fragments.
This process is essential for various biological functions, such as gene expression regulation, RNA processing, and RNA degradation.
It is carried out by specialized enzymes called ribonucleases (RNases) and can occur through different mechanisms, including endonucleolytic cleavage, exonucleolytic cleavage, and RNA interference.
Identifying the optimal methods and products for RNA cleavage experiments is crucial for advancing research in fields like molecular biology, genetics, and biotechnology.
PubCompare.ai's AI-driven comparison platform can help streamline your RNA cleavage workflow by easily locating the best protocols from literature, pre-prints, and patents, and providing intelligent analysis to help you identify the optimal methods and products for your experiments.
Discovder the power of PubCompare.ai and take your RNA cleavage research to the next level.

Most cited protocols related to «RNA Cleavage»

1
Measuring Single-Gene Poly(A) Tail Lengths
Single-gene poly(A)-tail lengths were measured on RNA blots after
directed RNase H cleavage of the interrogated mRNA. Standard methods43 were modified to enable higher
resolution for shorter tails (<50 nt), such as those found on yeast
mRNAs. Total RNA (3–20 µg) was heat-denatured for 5 min at
65°C in the presence or absence of 33 pmol/µg total RNA of
(dT)18 (IDT), and in the presence of 25 pmol of a DNA
oligonucleotide (or gapmer oligonucleotide, which had 16 DNA nucleotides flanked
on each side by five 2′-O-methyl RNA nucleotides) that
was complementary to a segment within the 3′-terminal region of the
interrogated mRNA. After snap-cooling on ice, the RNA was treated with RNase H
(Invitrogen) for 30 min at 37°C in a 20 µl reaction according to
the manufacturer’s instructions. The reaction was stopped by addition of
gel loading buffer (95% formamide, 18 mM EDTA, 0.025% SDS, dyes)
and then analyzed on RNA blots resembling those used for small-RNA
detection44 (Detailed
RNA blot protocol available at http://bartellab.wi.mit.edu/protocols.html). Briefly, after
separation of the RNA on a denaturing polyacrylamide gel and transfer onto a
Hybond-NX membrane (GE Healthcare), the blot was treated with EDC
(N-(3-dimethylaminopropyl)-N′-ethylcarbodiimide;
Sigma-Aldrich), which crosslinked the 5′ phosphate of the
3′-terminal RNase H cleavage product to the membrane45 . The blot was then hybridized
to a probe designed to pair to the region spanning the RNase H cleavage site and
the poly(A) site. Comparison of these 3′-terminal fragments with and
without poly(A) tails revealed the length of the tails.
Subtelny A.O., Eichhorn S.W., Chen G.R., Sive H, & Bartel D.P. (2014). Poly(A)-tail profiling reveals an embryonic switch in translational control. Nature, 508(7494), 66-71.
Publication 2014
Buffers Cytokinesis Dyes Edetic Acid formamide Genes Nucleotides Oligonucleotides Phosphates Poly(A) Tail Poly A polyacrylamide gels Ribonuclease H RNA, Messenger RNA Cleavage Tail Tissue, Membrane
2
Cas9-Mediated Library Generation and Sequencing
To efficiently capture the blunt ends of the plasmid library generated by Cas9-guide RNA complex cleavage, a 3′ dA was added by incubating the completed digestion reactions with 2.5 U of DreamTaq DNA Polymerase (Thermo Fisher Scientific) and 0.5 μL of 10 mM dATP (or dNTP) for an additional 30 min. at 72 °C. Reaction products were purified using GeneJET PCR Purification Kit (Thermo Fisher Scientific). Next adapters with a 3′ dT overhang were generated by annealing TK-117 and phosphorylated TK-111 oligonucleotides. 100 ng of the resulting adapter was ligated to an equal concentration of the purified 3′ dA overhanging cleavage products for 1 h at 22 °C in a 25 μL reaction volume in ligation buffer (40 mM Tris–HCl pH 7.8 at 25 °C, 10 mM MgCl2, 10 mM DTT, 0.5 mM ATP, 5 % (w/v) PEG 4000, and 0.5 U T4 Ligase; Thermo Fisher Scientific). Next, to selectively enrich for cleaved products containing the PAM sequence, PCR amplification was performed with a forward primer, pUC-dir specific to the PAM-side of the cleaved pTZ57R/T plasmid vector and with a reverse primer, TK-117 specific to the ligated TK-117/TK-111 adapter sequence. PCR fragments were generated by Phusion High-Fidelity DNA Polymerase (Thermo Fisher Scientific) amplification (15 cycles of a two-step amplification protocol) with 10 μL of ligation reaction mixtures as a template (in 100 μL total volume). The resulting 131 bp PCR products amplified from the Cas9-guide RNA complex cleaved plasmid libraries were purified with GeneJET PCR Purification Kit (Thermo Fisher Scientific) and prepared for Illumina deep sequencing as described in the PAM library validation section except the barcode containing forward primers used in the primary reaction were specific to the TK-117/TK-111 adapter sequence. Illumina deep sequencing, post-processing, and position frequency matrices (PFMs) were performed as described in the PAM library validation section. WebLogos were generated as described by [23 (link)].
Karvelis T., Gasiunas G., Young J., Bigelyte G., Silanskas A., Cigan M, & Siksnys V. (2015). Rapid characterization of CRISPR-Cas9 protospacer adjacent motif sequence elements. Genome Biology, 16, 253.
Full text: Click here
Publication 2015
Buffers Cloning Vectors Cytokinesis Digestion DNA-Directed DNA Polymerase DNA Library Ligase Ligation Magnesium Chloride Oligonucleotide Primers Oligonucleotides Plasmids RNA Cleavage TK 117 Tromethamine
3
Target RNA Cleavage Assay

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2009
Biological Assay Calcium, Dietary Coordination Complexes Cytokinesis Edetic Acid Endopeptidase K Escherichia coli Ethanol Gels HEPES magnesium acetate Magnesium Chloride Metals Native Polyacrylamide Gel Electrophoresis Poly A-U polyacrylamide Polyadenylation Polynucleotide Adenylyltransferase Potassium Acetate Proteins Recombinant Proteins Ribonucleases RNA Cleavage Urea
4
In vitro Dicer Cleavage Assay for RNA Substrates

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2013
Antisense RNA Biological Assay Buffers Catalytic RNA Cytokinesis DICER1 protein, human Glycerin Magnesium Chloride piperazine-N,N'-bis(2-ethanesulfonic acid) Plasmids Polynucleotide 5'-Hydroxyl-Kinase prisma RNA, Small Interfering RNA Cleavage Sodium Chloride Transcription, Genetic Urea
5
Pachytene piRNA-Guided Cleavage Criteria
An intergenic pachytene piRNA cluster MIWI-immunoprecipitated small RNA (>28 nt) is a guide piRNA that targets a cleavage sequence (−11 nt to +10 nt of cleavage site) if it first overlaps the 5′ end of the corresponding 5′RACE tag in an antisense manner by exactly 10 nt, allowing for a mismatch in piRNA nucleotide 1. In addition, it must have perfect complementarity in the primary seed (piRNA nucleotides 2–11) and tolerate at most four mismatches in the secondary seed (piRNA nucleotides 12–21). The complementarity cutoff and seed definitions are based on criteria that allow mouse Bbs5 and Gm11837 to be targeted by only Hu6 human piRNAs but not a single native mouse piRNA and also take into consideration previous in vitro small RNA-based cleavage assays (Reuter et al. 2011 (link); Nakanishi et al. 2012 (link)).
Goh W.S., Falciatori I., Tam O.H., Burgess R., Meikar O., Kotaja N., Hammell M, & Hannon G.J. (2015). piRNA-directed cleavage of meiotic transcripts regulates spermatogenesis. Genes & Development, 29(10), 1032-1044.
Publication 2015
Biological Assay Complement System Proteins Cytokinesis Homo sapiens Mus Nucleotides Piwi-Interacting RNA RNA Cleavage

Most recents protocols related to «RNA Cleavage»

1
Analyzing piRNA Ping-Pong Signature
Secondary piRNA biogenesis associated with piRNA-targeted post-transcriptional TE silencing produces a distinctive “ping-pong signature” in the piRNA pool, which consists of a 10 bp overlap between the 5’ ends of antisense and sense piRNAs. The ping-pong signature for each individual was analyzed using the following approach: First, TE transcripts that were not mapped by both sense-oriented and antisense-oriented piRNAs were filtered out using Bowtie, allowing 0 mismatches for sense mapping under the assumption that piRNAs derived directly from an RNA target should have the identical sequence (Teefy et al., 2020 (link)) and three mismatches for antisense mapping because cleavage of RNA targets can occur with imperfect base-pairing (Zhang et al., 2015 (link)). Second, the fractions of overlapping pairs of sense/antisense piRNAs corresponding to specific lengths, as well as the Z-score measuring the significance of each ping-pong signature, were generated using the 1_piRNA_and_Degradome_Counts.Rmd and 3_Ping_Pong_Phasing. Rmd scripts (Teefy et al., 2020 (link)).
Wang J., Yuan L., Tang J., Liu J., Sun C., Itgen M.W., Chen G., Sessions S.K., Zhang G, & Mueller R.L. (2023). Transposable element and host silencing activity in gigantic genomes. Frontiers in Cell and Developmental Biology, 11, 1124374.
Full text: Click here
Publication 2023
Anabolism Piwi-Interacting RNA RNA Cleavage Transcription, Genetic
2
Inhibition of Ap4A-cleaving Nudix Enzymes
To test the inhibition of AtNUDT6, AtNUD7 and AtNUDT27 enzymes in the presence of Ap4A we measured the cleavage of Ap4A-RNA at 37 °C in 10 μL reaction using 1 μM of purified Ap4A-RNA and increased concentrations of Ap4A (1, 2 and 4 μM). The concentration used for AtNUDT6 and AtNUD7 was 500 nM while for AtNUDT27 was 50 nM. The reaction was stopped using 2× RNA Loading Dye (NEB).
Mititelu M.B., Hudeček O., Gozdek A., Benoni R., Nešuta O., Krasnodębski S., Kufel J, & Cahová H. (2023). Arabidopsis thaliana NudiXes have RNA-decapping activity. RSC Chemical Biology, 4(3), 223-228.
Publication 2023
diadenosine tetraphosphate Enzymes Psychological Inhibition RNA Cleavage
3
CRISPR-Cas9 Deletion of clr4 in Mucor
Every strain used in this work derives from the natural isolate M. lusitanicus CBS277.49. The parental strain of all the mutant strains is the leucine and uridine double auxotroph MU402 (Ura-, Leu-). This strain was used for clr4 deletion mutant transformation following a CRISPR-Cas9 procedure as previously described (28 , 82 (link)). Briefly, we designed two guide RNAs (gRNA) to generate breaks upstream and downstream of the reannotated clr4 locus (gRNA_clr4_5′: CTCCTGGTGACTGGTGAAAGTGG, and gRNA_clr4_3′: GGGTTTTCATTGGCCGTGTCTCC), and a linear DNA construct containing the selectable marker pyrG flanked by 1-kb upstream and downstream regions of the gRNA cleavage sites (SI Appendix, Table S4). Ribonucleoprotein complexes with Cas9 and gRNAs were assembled in vitro following the supplier instructions (Alt-R™ CRISPR Custom Guide RNAs and Cas9 enzyme, Integrated DNA Technologies). The DNA cassette and the ribonucleoprotein complexes were electroporated into Mucor protoplasts. After transformation, colonies were plated on selective minimal medium with casamino acids (MMC) at pH of 3.2 to positively select prototrophic colonies. DNA deletion allele integration and heterokaryosis was assessed by PCR using primers that generate discriminatory amplicons (SI Appendix, Table S4), as described previously (28 ). At least 10 vegetative passages were conducted in an attempt to achieve homokaryotic mutants, consisting of collecting spores from a single asexual sporangium and subsequent plating in MMC medium. Lethality of the clr4Δ allele was assessed by dissecting spores from a heterokaryotic mutant onto rich, nonselective yeast-peptone-dextrose (YPD) medium, and analyzing the clr4 locus as described above. RNAi mutants analyzed in this study include single Dicer mutant dcl1Δ (strain MU406), dcl2Δ (MU410), and double-mutant dcl1Δ/dcl2Δ (MU411) (31 (link), 32 (link)), Argonaute mutants ago1Δ, ago2Δ, and ago3Δ (MU413, MU416 and MU414, respectively) (34 (link)), RdRP mutants rdrp1Δ, rdrp2Δ, and rdrp3Δ (MU419, MU420 and MU439, respectively) (29 (link), 57 (link)), and the alternative ribonuclease R3B2 mutant r3b2Δ (MU412) (35 (link)). Media were supplemented with uridine (200 mg/L) or leucine (20 mg/L) when needed to supplement auxotrophic requirements, and cultures were grown at room temperature unless otherwise stated.
Navarro-Mendoza M.I., Pérez-Arques C, & Heitman J. (2023). Heterochromatin and RNAi act independently to ensure genome stability in Mucorales human fungal pathogens. Proceedings of the National Academy of Sciences of the United States of America, 120(7), e2220475120.
Publication 2023
Alleles Alleles, Lethal Argonaute Proteins casamino acids Clustered Regularly Interspaced Short Palindromic Repeats CRISPR-Associated Protein 9 Deletion Mutation DICER1 protein, human Dietary Supplements Glucose Leucine Mucor Oligonucleotide Primers Parent Peptones Protoplasts Recombinant DNA Ribonucleases Ribonucleoproteins RNA RNA, CRISPR Guide RNA Cleavage RNA Interference Saccharomyces cerevisiae Sporangia Spores Strains Uridine
4
RNA-guided ssDNA cleavage assay
RNA-activated ssDNA cleavage was assayed in 10 μL reactions in the cleavage buffer (50 mM Tris-HCl, 10 mM MgCl2, 50 mM KCl, 0.1 mg/mL BSA, and pH 7.0) containing 50 nM LdCsm complex, 50 nM 5′ FAM-labeled ssDNA substrate, and 500 nM target RNA or unspecific RNA. Nucleic acid cleavage was conducted at 37 °C for 10 min and stopped by addition of 2 × RNA loading dye (New England Biolabs, Ipswich, MA, USA). Before loading, samples were heated for 3 min at 95 °C and analyzed by denaturing polyacrylamide gel electrophoresis. Cleavage products were visualized by fluorescence imaging with xx.
Yu Z., Xu J, & She Q. (2023). Harnessing the LdCsm RNA Detection Platform for Efficient microRNA Detection. International Journal of Molecular Sciences, 24(3), 2857.
Full text: Click here
Publication 2023
2-(2-(2-chloro-3-(2-(3,3-dimethyl-5-sulfo-1-(4-sulfo-butyl)-3H-indol-2-yl)-vinyl)-cyclohex-2-enylidene)-ethylidene)-3,3-dimethyl-1-(4-sulfo-butyl)-2,3-dihydro-1H-indole-5-carboxylic acid Buffers Cytokinesis DNA, Single-Stranded Magnesium Chloride Nucleic Acids Polyacrylamide Gel Electrophoresis RNA Cleavage Tromethamine
5
Transcriptome Analysis of Monoterpenoid Biosynthesis
For RNA library construction, poly-T oligo-attached magnetic beads were used to purify the RNA from total RNA (approximately 5μg) with twice purification. Next, the mRNA was fragmented into small pieces via divalent cations at high temperature. Then the final cDNA library was established by reverse-transcribed of the cleavage RNA pieces in accordance with the guidance for the mRNASeq Sample Preparation Kit RS-122-2103 (Illumina, San Diego, USA). The average insert size for the libraries was 300 bp (±50 bp). The prepared libraries were then sequenced on an IlluminaHiseq 2000 (LC Sciences, San Diego, USA) platform according to the vendor’s recommended protocol, and 150bp paired-end reads were generated. After filtering the primers, adapters and reads with low-quality and >5% bases using Cutadapt software [38 ], de novo assembling of the transcriptome was performed by Trinity 2.4.0 [39 ] with default parameters on the foundation of an overall 60.61GB RNA-seq data. Benchmarking Universal Single-Copy Orthologs (BUSCO) [40 (link)] were used to assess transcriptome assembly and annotation completeness. Unigenes were then queried against the Swiss-Prot, Non-redundant (Nr), Protein family (Pfam), Kyoto Encyclopedia of Genes and Genomes (KEGG), eukaryotic Orthologous Groups (KOG), Gene Ontology (GO) public databases by BLASTx with an E-value <10−5 to obtain annotation. RPKM (Reads Per Kilobase per Million mapped reads) were employed to evaluate genetic expressing levels. Differential expression analysis were performed using edgeR [41 (link)] to obtain p value, and Benjamini-Hochberg (BH) algorithm was used to adjust p value for controlling false discovery rate (FDR). To define differentially expressed genes, we used fold change (FC) ≥1.5 and FDR ≤0.05 as cutoff. Subsequently, GO and KEGG enrichment analyses and the heatmaps of differential expressed genes (DEGs) among four tissues were performed using the OmicStudio tools at https://www.omicstudio.cn/tool.
GeneMANIA app in cytoscape version 3.7 was employed to discover genes modulated by identified transcription factors (TFs) [42 (link)]. Genes screened and annotated as monoterpenoid biosynthesis related genes (TPs) along with TFs activities were adopted for the purpose of drawing a co-expressing network. Arabidopsis co-expression network was employed as a reference to query [43 (link)], genes with the greatest normalized weight (high associated genes) were forecasted to be related genes correlated with a specific role. The normalized weight was calculated by default weighting method of GeneMANIA app.
Xu P., Li Q., Liang W., Hu Y., Chen R., Lou K., Zhan L., Wu X, & Pu J. (2023). A tissue-specific profile of miRNAs and their targets related to paeoniaflorin and monoterpenoids biosynthesis in Paeonia lactiflora Pall. by transcriptome, small RNAs and degradome sequencing. PLOS ONE, 18(1), e0279992.
Full text: Click here
Publication 2023
Anabolism Arabidopsis Birth Weight Cations, Divalent cDNA Library Eukaryota Fever Genes Genome Monoterpenes Oligonucleotide Primers Oligonucleotides Poly T Proteins RNA, Messenger RNA-Seq RNA Cleavage Tissues Transcription Factor Transcriptome

Top products related to «RNA Cleavage»

1
Trizol reagent by Thermo Fisher Scientific
Sourced in United States, China, Japan, Germany, United Kingdom, Canada, France, Italy, Australia, Spain, Switzerland, Netherlands, Belgium, Lithuania, Denmark, Singapore, New Zealand, India, Brazil, Argentina, Sweden, Norway, Austria, Poland, Finland, Israel, Hong Kong, Cameroon, Sao Tome and Principe, Macao, Taiwan, Province of China, Thailand
TRIzol reagent is a monophasic solution of phenol, guanidine isothiocyanate, and other proprietary components designed for the isolation of total RNA, DNA, and proteins from a variety of biological samples. The reagent maintains the integrity of the RNA while disrupting cells and dissolving cell components.
2
Massarray platform by Labcorp
Sourced in United States, China, Germany
The MassARRAY platform is a high-throughput genetic analysis system designed for sensitive and accurate detection of genetic variations. It utilizes matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry technology to analyze DNA and RNA samples. The platform is capable of processing multiple samples simultaneously, making it suitable for applications such as genotyping, mutation detection, and gene expression analysis.
3
Epityper software version 1 by Labcorp
Sourced in United States
The Epityper software version 1.0 is a tool designed for data analysis and processing. Its core function is to facilitate the interpretation and management of raw data generated from various analytical instruments.
4
Typhoon phosphorimager by GE Healthcare
Sourced in United States, United Kingdom, Sweden
The Typhoon phosphorimager is a laboratory instrument used for the detection and quantification of radioactively labeled samples. It utilizes a laser-based scanning technology to capture high-resolution images of phosphor-labeled proteins, nucleic acids, and other biomolecules.
5
Rna loading dye by New England Biolabs
Sourced in United States
2× RNA loading dye is a buffer solution used to prepare RNA samples for gel electrophoresis. It facilitates the loading of RNA samples onto agarose or polyacrylamide gels and helps track the progress of the electrophoresis run.
6
Prism 8 by GraphPad
Sourced in United States, Austria, Canada, Belgium, United Kingdom, Germany, China, Japan, Poland, Israel, Switzerland, New Zealand, Australia, Spain, Sweden
Prism 8 is a data analysis and graphing software developed by GraphPad. It is designed for researchers to visualize, analyze, and present scientific data.
7
Ez dna methylation kit by Zymo Research
Sourced in United States, Germany, United Kingdom, France, China
The EZ DNA Methylation Kit is a product offered by Zymo Research for the bisulfite conversion of DNA. The kit is designed to convert unmethylated cytosine residues to uracil, while leaving methylated cytosines unchanged, enabling the detection of DNA methylation patterns.
8
Gel loading buffer 2 by Thermo Fisher Scientific
Sourced in United States, United Kingdom
Gel Loading Buffer II is a laboratory reagent designed for use in gel electrophoresis. It is formulated to facilitate the loading of DNA, RNA, or protein samples into agarose or polyacrylamide gels. The buffer contains a tracking dye and a glycerol-based density agent to help samples sink into the wells of the gel.
9
2100 bioanalyzer by Agilent Technologies
Sourced in United States, Germany, Canada, United Kingdom, France, China, Japan, Spain, Ireland, Switzerland, Singapore, Italy, Australia, Belgium, Denmark, Hong Kong, Netherlands, India
The 2100 Bioanalyzer is a lab equipment product from Agilent Technologies. It is a microfluidic platform designed for the analysis of DNA, RNA, and proteins. The 2100 Bioanalyzer utilizes a lab-on-a-chip technology to perform automated electrophoretic separations and detection.
10
Rnase t1 by Thermo Fisher Scientific
Sourced in United States, China
RNase T1 is an enzyme that specifically cleaves single-stranded RNA molecules after guanine residues. It is commonly used in molecular biology research for the analysis and manipulation of RNA samples.

More about "RNA Cleavage"

RNA cleavage, also known as RNA degradation or RNA fragmentation, is the process of breaking down RNA molecules into smaller segments.
This essential biological process is carried out by specialized enzymes called ribonucleases (RNases) and is crucial for regulating gene expression, RNA processing, and RNA turnover.
Various mechanisms are involved in RNA cleavage, including endonucleolytic cleavage, exonucleolytic cleavage, and RNA interference (RNAi).
Endonucleases like RNase T1 target internal phosphodiester bonds within the RNA, while exonucleases degrade RNA from the 5' or 3' end.
RNAi utilizes small interfering RNA (siRNA) or microRNA (miRNA) to induce the cleavage of specific RNA transcripts.
Optimizing RNA cleavage experiments is crucial for advancements in molecular biology, genetics, and biotechnology.
Researchers often employ techniques like TRIzol reagent for RNA extraction, the MassARRAY platform for high-throughput analysis, and the Epityper software version 1.0 for data processing.
Visualization tools like the Typhoon phosphorimager and the 2100 Bioanalyzer can be used to analyze the resulting RNA fragments.
To prepare samples for analysis, researchers may use 2× RNA loading dye and Gel Loading Buffer II.
Data analysis can be facilitated by Prism 8 and the EZ DNA Methylation Kit.
By leveraging the power of PubCompare.ai's AI-driven comparison platform, researchers can streamline their RNA cleavage workflows, identify the best protocols from literature, pre-prints, and patents, and optimize their experiments to take their research to new heights.