Log In Sign up
The largest database of trusted experimental protocols
> Physiology > Organism Attribute > Chloramphenicol Resistance

Chloramphenicol Resistance

Chloramphenicol Resistance: A comprehensive overview of this critical research area.
Discover effective protocols and products to optimize your studies on the mechanisms, prevalence, and implications of chloramphenicol resistance in various biological systems.
Leverage PubCompare.ai's AI-driven platform to locate the best protocols from literature, pre-prints, and patents, and identify the most effective research tools to enhance reproducibility and advance your chloramphenicol resistance investigations.

Most cited protocols related to «Chloramphenicol Resistance»

1
Cloning and Characterization of an AND Gate Genetic Circuit
The Luria-Bertani (LB) media (10 g/L tryptone, 5 g/L yeast extract, 10 g/L NaCl) is obtained from Fisher Scientific (Pittsburgh, PA). The supplemented minimal media contains M9 minimal salts (6.8 g/L Na2PO4, 3 g/L KH2PO4, 0.5 g/L NaCl, 1 g/L NH4Cl) from Sigma, 2 mM MgSO4 (Fischer Scientific), 100 μM CaCl2 (Fischer Scientific), 0.4% glucose (Sigma), 0.05 g/L leucine (Acros Organics, Belgium), 5 μg/mL chloramphenicol (Acros Organics), and an adjusted pH of 7.4. The expression system is a ColE1 vector with chloramphenicol resistance (derived from pProTet, Clontech). The expression cassette contains a σ70 constitutive promoter (BioBrick J23100), the RBS sequence, followed by the mRFP1 fluorescent protein reporter. XbaI and SacI restriction sites are located before the RBS and after the start codon. An RBS with a desired sequence is inserted into the expression vector using standard cloning techniques. Pairs of complementary oligonucleotides are designed with XbaI and SacI overhangs and the vector is digested with XbaI and SacI restriction enzymes (NEB, Ipswich, MA). Ligation of the annealed oligonucleotides with cut vector results in a nicked plasmid, which is transformed into E. coli DH10B cells. Sequencing is used to verify a correct clone.
The AND gate genetic circuit is composed of three plasmids: pBACr-AraT7940, pBR939b, and pAC-SalSer914 with kanamycin, ampicillin, and chloramphenicol resistance markers, respectively. The PBAD promoter maximum expression level was modified by inserting designed synthetic RBSs on plasmid pBACr-AraT7940. Plasmid pBACr-AraT7940 was digested with BamHI and ApaLI enzymes and pairs of oligonucleotides were designed to contain the desired RBS sequence and corresponding overhangs. Ligation, transformation, selection, and sequencing proceeded as described above.
Salis H.M., Mirsky E.A, & Voigt C.A. (2009). Automated Design of Synthetic Ribosome Binding Sites to Precisely Control Protein Expression. Nature biotechnology, 27(10), 946-950.
Publication 2009
Ampicillin Cells Chloramphenicol Chloramphenicol Resistance Clone Cells Cloning Vectors Codon, Initiator DNA Restriction Enzymes Enzymes Escherichia coli Gene Circuits Glucose Kanamycin Leucine Ligation Mrfp1 protein Oligonucleotides Plasmids Saccharomyces cerevisiae Salts Sodium Chloride Sulfate, Magnesium
2
Construction of Engineered E. coli Strains
The λ prophage was obtained from strain DY33031 (link), modified to include the bla gene and introduced into wild-type MG1655 E. coli by P1 transduction at the bioA/bioB gene locus and selected on ampicillin to yield the strain EcNR1 (λ-Red+). Replacement of mutS with the chloramphenicol resistance gene (cmR cassette) in EcNR1 produced EcNR2 (mutS−, λ-Red+). EcNR2 was grown in low salt LB-min medium (10 g tryptone, 5 g yeast extract, 5 g NaCl in 1 l dH2O) for optimal electroporation efficiency. A premature stop codon was introduced into the cmR gene of EcNR2 with oligo cat_fwd_stop (Supplementary Table 3) to produce EcFI5, thus inactivating the cmR gene. An oligo (cat_fwd_restore) containing the wild-type sequence was used to restore the CmR phenotype. The pAC-LYC plasmid32 (link) containing genes crtE, crtB and crtI was electroporated into EcNR1 to generate EcHW1, which produces lycopene at basal levels. Replacement of mutS with a kanamycin resistance gene in EcHW1 produced EcHW2.
Wang H.H., Isaacs F.J., Carr P.A., Sun Z.Z., Xu G., Forest C.R, & Church G.M. (2009). Programming cells by multiplex genome engineering and accelerated evolution. Nature, 460(7257), 894-898.
Publication 2009
Ampicillin Chloramphenicol Resistance Codon, Nonsense Electroporation Escherichia coli Genes Kanamycin Resistance Lycopene Oligonucleotides Phenotype Prophages Saccharomyces cerevisiae Salts Sodium Chloride Strains Transduction, Genetic
3
Integrative Plasmid Construction for Staphylococcus aureus
Bacterial strains and plasmids are listed in Table 1. The backbone for the integrative plasmid was the shuttle plasmid pMAD [7] (link). The kanamycin resistance gene aphA(3), originally from S. aureus[8] (link), was amplified from pSS4332 [9] (link) and inserted at the BglII site of pMAD, yielding plasmid pRP1179. Approximately 660 bp in the area of USA300HOU_1102 (annotated as a pseudogene in the sequenced USA300 strain TCH1516 [10] (link)) was amplified from the S. aureus USA300 strain NRS384 and inserted into BamHI/SalI-digested pRP1179, generating pRP1186. Next, a modified luxBADCE operon, originally from Photorhabdus luminescens[11] (link), was amplified from a derivative of pSS4530 [12] (link) such that the operon was under the control of a modified gapA promoter with consensus -35, extended -10, and -10 regions (TTGACACTGCGTAAGGTTTGTGTTATAAT) and inserted at the EagI site of pRP1186, yielding pRP1190. Separately, the chloramphenicol resistance gene cat (originally from pC194 [13] (link)) was amplified from pBT2 [14] (link), digested with KpnI, and inserted into similarly digested pMAD, generating plasmid pRP1192. Finally, a 6.8 kb BamHI-SalI fragment of pRP1190 (including the USA300HOU_1102 homology and the lux operon) was ligated with similarly digested pRP1192, generating pRP1195 (Fig. 1). Thus, pRP1190 (with aphA(3)) is suitable for use in S. aureus strains that are kanamycin-sensitive, whereas pRP1195 (with cat) is suitable for use in strains that are chloramphenicol-sensitive. Plasmids were transformed into RN4220 by electroporation as previously described [15] (link) followed by growth at 30°C. For integration into the bacterial chromosome, strains were grown at 30°C overnight in tryptic soy broth (TSB) with 10 µg/ml chloramphenicol, followed by subculture (1∶100 dilution) in TSB without antibiotics at 30°C for 1–2 h, shift to 43°C for 6–7 h, serial dilution, plating on tryptic soy agar (TSA) with 10 µg/ml chloramphenicol, and overnight incubation at 43°C. Plates were imaged, and luminescent colonies were selected for further passage and analysis. Integration at the intended site was confirmed by PCR. Freely replicating or integrated plasmids were transferred to clinical strains by phi80 phage transduction as previously described [16] .
Plaut R.D., Mocca C.P., Prabhakara R., Merkel T.J, & Stibitz S. (2013). Stably Luminescent Staphylococcus aureus Clinical Strains for Use in Bioluminescent Imaging. PLoS ONE, 8(3), e59232.
Full text: Click here
Publication 2013
Agar Antibiotics Bacteria Bacteriophages Chloramphenicol Chloramphenicol Resistance Chromosomes, Bacterial Electroporation Genes Kanamycin Kanamycin Resistance Luminescence Operon Photorhabdus luminescens Plasmids Pseudogenes Staphylococcus aureus Strains Technique, Dilution Trypsin tryptic soy broth Vertebral Column
4
Genetic Manipulation in Bacteria
All oligonucleotides used are listed in Table 1. Template plasmid pWRG100 was generated using pKD3 [1] (link) as template in a PCR with primers pKD-for and pKD3-I-SceI-XbaI-rev. The resulting fragment harboring the chloramphenicol resistance gene and an I-SceI recognition site was cloned into pKD3 backbone via XbaI. The orientation of the resistance gene according to original pKD3 and its integrity was verified by restriction analysis and sequencing (not shown). Functionality of I-SceI recognition site was proven by digestion with recombinant I-SceI (Fermentas, St. Leon-Rot, Germany) (data not shown). The λ Red- and I-SceI-expressing plasmids pWRG24 and pWRG99 are derivatives of pKD46 [1] (link). The gene for I-SceI under control of a tetracycline-inducible promoter (PtetA/tetR) was amplified by PCR from plasmid pST98-AS [14] (link) using primers NcoI-tetR-for and NcoI-I-SceI-rev and cloned in pKD46. Clones of both orientations, pWRG24 (tetR-I-SceI) and pWRG99 (I-SceI-tetR), were isolated and approved by sequencing. For complementation of strains WRG6 and WRG23 a low-copy plasmid harboring phoPQ under its natural promoter was generated. A fragment containing PphoP-phoPQ was amplified by PCR from wild-type (WT) genomic DNA using primers XhoI-PhoPQ-for and PhoPQ-HindIII-rev. The PCR product was cloned into low-copy pWSK29 [26] (link) leading to pWRG103. All constructs were verified by restriction analysis and DNA sequencing and introduced in competent cells by electroporation (MicroPulser, Bio-Rad, Munich, Germany).
Blank K., Hensel M, & Gerlach R.G. (2011). Rapid and Highly Efficient Method for Scarless Mutagenesis within the Salmonella enterica Chromosome. PLoS ONE, 6(1), e15763.
Full text: Click here
Publication 2011
Cells Chloramphenicol Resistance derivatives Digestion DNA Fingerprinting Electroporation Genes Genome Mental Orientation Oligonucleotide Primers Oligonucleotides Plasmids Strains Tetracycline Vertebral Column
5
Gateway Lentiviral Vector for ISG Expression
To generate a lentiviral-based, Gateway-compatible destination vector for ISG expression, a Gateway expression cassette (containing the tetracyline-inducible-hybrid CMV promoter, chloramphenicol resistance gene, and ccdB suicide gene) from pLenti4.TO.V5-DEST (Invitrogen) was subcloned into the XhoI-NdeI sites of pTRIP-EGFP41 . Overlap extension PCR followed by a three-fragment ligation was used to insert the EMCV IRES and TagRFP (Evrogen) downstream of the Gateway module
(EMCV IRES 5′ oligo:
5′-GATATCTCGAGGCCCCTCTCCCTCCCCCCCCCCTAA-3′,
EMCV IRES 3′ oligo:
5′-CACGATGATAATATGGCCACAACCCCGCGGATATG-3′,
TagRFP 5′ oligo:
5′-CATAGCTAGCATGGTGTCTAAGGGCGAAGAGCTG,
TagRFP 3′ oligo:
5′-CTAGCAAACTGGGGCACAAACTTAATTGACCGCGGGGTACCTGCG-3′.
To enhance gene expression, the β-globin intron (IVSβ) was subcloned from pLenti6-TR (Invitrogen) into the SpeI site between the CMV promoter and the Gateway cassette
(IVSβ 5′ oligo:
5′-GACCCACTAGTGTGAGTTTGGGGACCCTTGATTG-3′,
IVSβ 3′ oligo:
5′-CATGCCTTCTTCTTTTTCCTACAGACTAGTCCCAG-3′).
All DEST vector variants were grown in DB3.1 cells (Invitrogen) under ampicillin-chloramphenicol double selection. The final vector was named pTRIP.CMV.IVSb.ires.TagRFP-DEST.
Sequence-validated, Gateway-compatible ORFEXPRESS shuttle clones corresponding to 387 ISGs were obtained from Genecopoeia. Two additional ISG entry clones encoding RSAD2 and ZC3HAV1 and two control clones encoding Firefly luciferase (Fluc) or Gaussia luciferase (Gluc) were generated as follows. Genes encoding RSAD2, ZC3HAV1/ZAP, Fluc, and Gluc were PCR-amplified with oligos containing attB sites flanking gene-specific sequences
(RSAD2 5′ oligo:
5′-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACCATGTGGGTGCTTACACCTGC-3′,
RSAD2 3′ oligo:
5′-GGGGACCACTTTGTACAAGAAAGCTGGGTCTACCAATCCAGCTTCAGAT-3′,
ZCHAV1 5′ oligo:
5′-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACCATGGCGGACCCGGAG GTGTG-5′,
ZCHAV1 3′ oligo:
5′-GGGGACCACTTTGTACAAGAAAGCTGGGTTTACTCTGGCCCTCTCTTCATCT-3′,
Fluc 5′ oligo:
5′-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACCATGGAAGATGCCAAAAACATTAAGAA-3′,
Fluc 3′ oligo:
5′-GGGGACCACTTTGTACAAGAAAGCTGGGTTTACACGGCGATCTTGCCGCCCTTC-3′,
Gluc 5′ oligo:
5′-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACCATGGGAGTCAAAGTTCTGTTTGCCC-3′,
Gluc 3′ oligo:
5′-GGGGACCACTTTGTACAAGAAAGCTGGGTTTAGTCACCACCGGCCCCCTTGATC-3′.
PCR products were purified over GFX columns (GE Healthcare) and cloned into pDONR (Invitrogen) with BP Clonase. BP reactions were transformed into OMNIMax competent E. coli (Invitrogen) and colonies were screened by restriction digest and sequencing.
The ISG-encoding sequences from pENTR clones were moved into pTRIP.CMV.IVSb.ires.TagRFP-DEST using LR Clonase II (Invitrogen) according to manufacturer’s instructions. LR reaction products were transformed into MDS42Rec reduced genome E. coli. (Scarab Genomics). One or two colonies for each clone were grown in 3 ml Luria broth (LB) plus ampicillin and transfection-quality plasmid DNA was purified over anion-exchange columns (Qiagen). All pTRIP.CMV.IVSb.ISG.ires.TagRFP constructs were sequenced at the 5′ end of the expression cassette to verify gene insertion (sequencing oligo: 5′-CCTGCCTTTCTCTTTATGG-3′).
Schoggins J.W., Wilson S.J., Panis M., Murphy M.Y., Jones C.T., Bieniasz P, & Rice C.M. (2011). A diverse array of gene products are effectors of the type I interferon antiviral response. Nature, 472(7344), 481-485.
Publication 2011
2',5'-oligoadenylate Ampicillin Anions beta-Globins Cells Chloramphenicol Chloramphenicol Resistance Clone Cells Cloning Vectors Encephalomyocarditis virus Escherichia coli Gene Expression Gene Insertion Genes Genome Hybrids Internal Ribosome Entry Sites Introns Ligation Luciferases Luciferases, Firefly Oligonucleotides Plasmids Transfection

Most recents protocols related to «Chloramphenicol Resistance»

1
Constructing pts Gene Deletion Mutants
Gene pts promoter–deleted mutants were constructed to resemble those in Keio knockout collection. KanR cassette was amplified by using pKD13 as a template with sequences homologous to the 5′ and 3′ ends of the target genes in the chromosome. Primer pairs used for gene deletion are listed in table S2. Amplified DNA was electroporated into clinically isolated antibiotic-sensitive E. coli S2 and S13 harboring pSIM5 that expresses the lambda red genes from a high-temperature–inducible promoter (pSIM5). Recombinants were selected on LB agar plate supplemented with kanamycin (50 μg/ml). The KanR mutants were transformed with pCP20, and chloramphenicol-resistant transformants were selected at 30°C, after which a few were colony-purified once nonselective at 43°C and then tested for loss of kanamycin and chloramphenicol resistances. The majority lost the FRT (FLP recognition target) flanked resistance gene and the FLP helper plasmid simultaneously.
Jiang M., Su Y.B., Ye J.Z., Li H., Kuang S.F., Wu J.H., Li S.H., Peng X.X, & Peng B. (2023). Ampicillin-controlled glucose metabolism manipulates the transition from tolerance to resistance in bacteria. Science Advances, 9(10), eade8582.
Publication 2023
Agar Antibiotics Chloramphenicol Chloramphenicol Resistance Chromosomes Escherichia coli Fever Gene Deletion Genes Kanamycin Oligonucleotide Primers Plasmids Promoter, Genetic
2
Construction of Nissle 1917 dsdC Mutant
A Nissle 1917 mutant lacking dsdC was constructed using standard procedures [79 (link)]. Briefly, Nissle 1917 WT was transformed with pKD46. A single colony was cultured at 37°C in LB supplemented with 100 µg/ml ampicillin and 100 mM L-Arabinose to an OD600 nm of 0.4. The cells were then washed and resuspended three times with ice-cold distilled water. A linear deletion fragment was prepared by amplifying the chloramphenicol resistance cassette from pKD3 with oligonucleotides bearing 50 bp 5'-end flanking regions homolgous to the 50 bp regions immediately upstream and downstream of dsdC, Table S5. One microgram of PCR product (phenol-chloroform extracted, before ethanol precipitation and resuspension in 10 μl nuclease-free water) was electroporated at 2500 V into an aliquot of competent Nissle 1917 cells using an Eppendorf Eporator. Insertional mutants grown under chloramphenicol selection were verified by PCR using check primers, Table S5. Resistance cassettes were removed by expression of FLP-recombinase under transient temperature shift to 42°C after transformation of insertional mutants with pCP20. Excision of the resistance cassette was confirmed by PCR.
Hallam J.C., Sandalli S., Floria I., Turner N.C., Tang-Fichaux M., Oswald E., O'Boyle N, & Roe A.J. (2023). D-Serine reduces the expression of the cytopathic genotoxin colibactin. Microbial Cell, 10(3), 63-77.
Full text: Click here
Publication 2023
Ampicillin Arabinose Cells Chloramphenicol Chloramphenicol Resistance Chloroform Cold Temperature Deletion Mutation Ethanol FLP recombinase Ice Oligonucleotide Primers Oligonucleotides Phenol Transients
3
Site-Directed Mutagenesis of Fis Binding Site
Site-directed mutagenesis was performed using the Quikchange II (Stratagene) site-directed mutagenesis kit, according to the manufacturer’s recommendations. The oligonucleotides used to mutate the Fis binding site (FBSFOR2 and FBSREV2) are described in Table 2, and were supplied by MWG Biotech. Plasmid pMMC108 [20 (link)] was used as the substrate for the mutagenesis. The method of allele replacement was as described previously [24 (link)]. Briefly, the mutated Fis binding site was introduced to the chromosome by cloning an MfeI-SnaBI fragment of fimS, containing the disrupted site into pSGS501, a plasmid containing the cat chloramphenicol resistance gene (Table 1). The resulting plasmid was digested with EcoRV and an 8 kb fragment containing the mutated fimS region was gel extracted. Two micrograms of this fragment were electroporated into strain VL386recD. Loss of plasmid sequences following homologous recombination with the chromosome was confirmed by testing the transformants for chloramphenicol sensitivity. The presence of the disrupted Fis binding site in the chromosomal fimS element was confirmed by PCR amplification followed by DNA sequencing.
Conway C., Beckett M.C, & Dorman C.J. (2023). The DNA relaxation-dependent OFF-to-ON biasing of the type 1 fimbrial genetic switch requires the Fis nucleoid-associated protein. Microbiology, 169(1), 001283.
Full text: Click here
Publication 2023
Alleles Binding Sites Chloramphenicol Chloramphenicol Resistance Chromosomes Chromosome Structures Genes Homologous Recombination Hypersensitivity Mutagenesis Mutagenesis, Site-Directed Oligonucleotides Plasmids Strains
4
Modular CRISPR/Cas9 Editing Cassette Construction
Seven modularized parts were prepared with optimized 4‐nt linkers that could be processed using type IIS restriction enzymes for assembly, which included a left homologous arm (L) from the ddpX gene on the genome, the left half of the ampicillin resistance gene (ampr_L), two CRISPR/Cas9 recognition regions (N20PAM), a chloramphenicol resistance gene (cat), the right half of ampicillin resistance gene (ampr_R), and a right homologous arm (R) from the dosP gene on the chromosome. There were two identical sequences of 40 bp at the end of ampr_L and at the front of ampr_R, which were used to reconstruct the entire ampicillin resistance gene after CRISPR/Cas9 cleavage induced homologous recombination. A Golden Gate reaction was performed to assemble these parts into the editing cassette. The L and R homologous arms (about 500 bp each) were amplified from the genomic DNA of E. coli MG1655. The selection marker genes (ampr_L, ampr_R, and cat) with the CRISPR/Cas9 recognition region (N20PAM) were PCR‐amplified from plasmids pETDuet1 and pACYCDuet1 with the N20PAM sequence embedded in the reverse primer.
All the DNA templates were PCR‐amplified using Phusion polymerase (New England Biolabs, USA). PCR products were purified by preparative agarose gel electrophoresis using the AxyPrep DNA Gel Extraction Kit (Axygen Biosciences, USA), and the template was digested with DpnI before assembly. Primers for the construction of the plasmid and editing cassette, as well as other primers are summarized in Table S2, Supporting Information.
Wang P., Zhao D., Li J., Su J., Zhang C., Li S., Fan F., Dai Z., Liao X., Mao Z., Bi C, & Zhang X. (2023). Artificial Diploid Escherichia coli by a CRISPR Chromosome‐Doubling Technique. Advanced Science, 10(7), 2205855.
Full text: Click here
Publication 2023
Arm, Upper Chloramphenicol Resistance Chromosomes Clustered Regularly Interspaced Short Palindromic Repeats Cytokinesis DNA Restriction Enzymes Electrophoresis, Agar Gel Escherichia coli Genes Genes, vpr Genome Homologous Recombination Oligonucleotide Primers Plasmids
5
Engineered Cyanobacterium for Sucrose Production
The sucrose-secreting Synechococcus elongatus FL130 (FL130) was a generous gift from Prof. Xuefeng Lu (Qingdao Institute of Bioenergy and Bioprocess Technology, Chinese Academy of Sciences, China). FL130 was an engineered cyanobacterium capable of co-overexpressing cscB (encoding a sucrose transporter) and native sps (encoding a natively fused protein of sucrose phosphate synthase SPS and sucrose phosphate phosphatase SPP), with chloramphenicol resistance and spectinomycin resistance. The expression of both cscB and sps was driven by isopropyl-d-1-thiogalactopyranoside (IPTG)-inducible promoters [21 (link)]. For standard cultivation, FL130 cells were grown in 100 mL Erlenmeyer flasks containing 40 mL BG-11 medium supplemented with 10 μg/mL chloramphenicol and 20 μg/mL spectinomycin. Flasks were incubated in a horizontal rotary shaker at 100 rpm and 30 °C, supplied with 1% CO2 (v/v). Illumination was provided by cool-white fluorescent lamps to give a light intensity of 100 μmol m−2 s−1 with a 16:8 h light/dark cycle.
The polyketide neosartoricin B-producing fungal strain Aspergillus nidulans TWY1.1 (TWY1.1) [22 (link)] was grown at 37 °C on glucose minimum medium (GMM) [34 (link)] supplemented with 0.5 μM pyridoxine HCl. Spores were collected from GMM agar plates in sterile water, filtered, and maintained as a suspension at 4 °C for up to one month.
Co-culture medium (BG-11[co]) of FL130 and TWY1.1 was designed based on BG-11. Compared to BG-11, BG-11[co] contains 3 g/L NaNO3, fivefold of KH2PO4, fivefold of MgSO4, fivefold of trace elements, 0.5 μM pyridoxine HCl, and 3 g/L HEPES (pH 8.0). For mono-cultures of FL130 and co-cultures of FL130 together with TWY1.1, exponential-phase FL130 cells (1.6 × 107 per mL in initial culture) and TWY1.1 spore suspension (1 × 105 spores per mL in initial culture) were transferred into each flask containing BG-11[co] medium, which was supplemented with NaCl in various concentrations. If necessary, 1 mM IPTG was also supplied. Flasks with cultures were weighed before incubation and were added with distilled water before each sampling to correct for water evaporation. Cultures were incubated at 35 °C, 100 rpm, and 1% CO2, under the illumination of 100 μmol photons m−2 s−1 with a 16:8 h light/dark cycle.
Feng J., Li J., Liu D., Xin Y., Sun J., Yin W.B, & Li T. (2023). Generation and comprehensive analysis of Synechococcus elongatus–Aspergillus nidulans co-culture system for polyketide production. Biotechnology for Biofuels and Bioproducts, 16, 32.
Full text: Click here
Publication 2023
Agar Aspergillus nidulans Cells Chinese Chloramphenicol Chloramphenicol Resistance Coculture Techniques Glucose HEPES Light Lighting Membrane Transport Proteins Phosphates Polyketides Proteins Pyridoxine Hydrochloride Sodium Chloride Spectinomycin Spores Sterility, Reproductive Sucrose sucrose-phosphatase sucrose-phosphate synthase Sulfate, Magnesium Synechococcus elongatus Trace Elements

Top products related to «Chloramphenicol Resistance»

1
Chloramphenicol by Merck Group
Sourced in United States, Germany, France, United Kingdom, Italy, China, Australia, Israel, Switzerland, Spain, India, Sao Tome and Principe, Brazil, Canada, Belgium, Czechia, Mexico, Poland, Ireland
Chloramphenicol is a bacteriostatic antibiotic that inhibits protein synthesis in bacteria. It is commonly used in microbiology laboratories for selective cultivation and identification of bacterial species.
2
Pgem t easy by Promega
Sourced in United States, Germany, United Kingdom, Japan, France, China, Italy, Australia
The pGEM-T Easy Vector is a linear plasmid vector used for cloning PCR products. It contains T7 and SP6 RNA polymerase promoters flanking a multiple cloning region within the α-peptide coding region of the enzyme β-galactosidase. The vector is supplied pre-cut with a single 3' terminal thymidine (T) to the multiple cloning region, which greatly improves the efficiency of ligation of PCR products by preventing recircularization of the vector and providing a compatible overhang for PCR products generated by certain thermostable DNA polymerases.
3
T4 dna ligase by New England Biolabs
Sourced in United States, China, United Kingdom, Germany, Japan, France, Canada, Morocco, Switzerland, Australia
T4 DNA ligase is an enzyme that catalyzes the formation of phosphodiester bonds between adjacent 3'-hydroxyl and 5'-phosphate termini in DNA. It is commonly used in molecular biology for the joining of DNA fragments.
4
Pgem t easy vector by Promega
Sourced in United States, China, Germany, United Kingdom, Japan, France, Italy, Australia, Switzerland, Spain, Israel, Canada
The pGEM-T Easy Vector is a high-copy-number plasmid designed for cloning and sequencing of PCR products. It provides a simple, efficient method for the insertion and analysis of PCR amplified DNA fragments.
5
Gibson assembly master mix by New England Biolabs
Sourced in United States, Germany, United Kingdom
The Gibson Assembly Master Mix is a laboratory reagent used for the assembly of DNA fragments. It enables the seamless joining of multiple DNA segments in a single isothermal reaction. The product functions to facilitate the cloning and construction of recombinant DNA molecules.
6
Geneart by Thermo Fisher Scientific
Sourced in United States, Germany, United Kingdom, France, Italy, New Zealand
The GeneArt is a laboratory equipment product designed for genetic engineering and molecular biology applications. It provides tools and functionalities for DNA synthesis, assembly, and modification. The core function of the GeneArt is to enable researchers and scientists to create and manipulate genetic constructs for various experimental and research purposes.
7
T4 dna ligase by Thermo Fisher Scientific
Sourced in United States, Germany, China, Lithuania, Canada, Spain, France, United Kingdom, Denmark, Netherlands, India, Switzerland, Hungary
T4 DNA ligase is an enzyme used in molecular biology and genetics to join the ends of DNA fragments. It catalyzes the formation of a phosphodiester bond between the 3' hydroxyl and 5' phosphate groups of adjacent nucleotides, effectively sealing breaks in double-stranded DNA.
8
Infinite 200 pro nanoquant by Tecan
Sourced in Switzerland, France, United States, Austria
The Infinite 200 PRO NanoQuant is a microvolume plate reader designed for precise measurement of nucleic acid and protein samples. It can accurately quantify low-volume samples from 2 μL to 8 μL using fluorescent and absorbance-based detection methods.
9
Sanger sequencing by Eurofins
Sourced in Germany, United States, France, India, Japan, United Kingdom, Luxembourg, Sweden
Sanger sequencing is a method for determining the nucleotide sequence of DNA. It is a widely used technique in genomic research and molecular biology. The core function of Sanger sequencing is to provide accurate DNA sequence information.
10
Pentr d topo by Thermo Fisher Scientific
Sourced in United States, Germany, United Kingdom
The PENTR/D-TOPO is a vector system designed for the efficient cloning of Polymerase Chain Reaction (PCR) products. It facilitates the direct insertion of PCR amplicons into a plasmid vector without the need for restriction enzyme digestion or ligase. The vector is pre-linearized and contains complementary 3' single-stranded overhangs, allowing for the seamless ligation of PCR products.

More about "Chloramphenicol Resistance"

Chloramphenicol resistance is a critical research area that has significant implications for various biological systems.
This topic encompasses the study of the mechanisms, prevalence, and impact of resistance to the antibiotic chloramphenicol.
Understanding chloramphenicol resistance is crucial for optimizing research protocols and enhancing reproducibility in related studies.
Researchers can leverage the AI-driven platform of PubCompare.ai to locate the best protocols from literature, pre-prints, and patents, as well as identify the most effective research tools to support their chloramphenicol resistance investigations.
This includes exploring related terms such as Chloramphenicol, PGEM-T Easy, T4 DNA ligase, PGEM-T Easy vector, Gibson Assembly Master Mix, GeneArt, Infinite 200 PRO NanoQuant, Sanger sequencing, and PENTR/D-TOPO.
By utilizing the insights and resources available, researchers can optimize their studies on chloramphenicol resistance and advance the field through improved protocols and effective research tools.
The comprehensive overview provided by PubCompare.ai can help researchers navigate this critical research area and enhance the overall reproducibility and impact of their work.