Log In Sign up
The largest database of trusted experimental protocols
> Physiology > Organism Attribute > Kanamycin Resistance

Kanamycin Resistance

Kanamycin Resistance refers to the ability of organisms, such as bacteria, to withstand the effects of the antibiotic kanamycin.
This resistance can occur through various mechanisms, including the production of enzymes that inactivate the antibiotic, modifications to the antibiotic target, or changes in membrane permeability.
Understanding and studying Kanamycin Resistance is crucial for developing effective treatments, preventing the spread of resistant infections, and optimizing research protocols.
PubCompare.ai, an AI-driven platform, can assist researchers in locating the best protocols from literature, pre-prints, and patents, enhancing reproducibility and accuaracy with personalized recommendations tailored to their research needs.

Most cited protocols related to «Kanamycin Resistance»

1
Versatile GFP and LacZ Cloning System
A GFP gene was flanked by BsaI restriction sites using PCR amplification of a GFP coding sequence using primers bsgfp3 (ttt ggtctc a aggt atggtgagcaagggcgaggag) and bsgfp2 (ttt ggtctc a aagc ttacttgtacagctcgtcc). The PCR fragment was cloned in pGEM-T (Promega), resulting in construct pE-GFP. The LacZ cassette and the flanking BsaI sites present in pX-lacZ was obtained by PCR amplification from pUC19 DNA using primers laczins3 (tttcgtctctgtcg aggt a gagacc gaattcgcagctggcacgacaggtttc) and laczins6 (tttcgtctcttacc aagc t gagacc acggttgtgggtcacagcttgtctgtaagcg). The plasmid backbone of pX-lacZ contains a kanamycin resistance gene (derived from pBIN19) for selection in E.coli and Agrobacterium and does not contain any BsaI restriction site other than the two sites flanking the LacZ fragment. Other elements of the constructs (attB site, viral sequences) are as described in [2] (link). The GFP sequences in plasmids pE-GFP3 and pE-GFP2 were obtained by PCR amplification using primers pairs calgef3/bsgfp5 (ggtctc a tatggtgagcaagggcgaggag/ggtctc a cttgtacagctcgtccatgccg) and bsgfp3 (ttt ggtctc a aggt atggtgagcaagggcgaggag)/bsgfp5 and cloned in pUC19 digested with SmaI. pE-S was obtained by PCR amplification of a Nicotiana plumbaginifolia apoplast signal peptide from cloned sequences using primers calgef1 (ggtctc a aggtatggctactcaacgaagggc) and calgef2 (ggtctc a catacctgagacgacagcgacgag) and cloned in pUC19 digested with SmaI. pE-H was made by cloning an adapter (ggtct cacaa gggca gcagc cacca ccacc accac cacta agctt tgaga cc) into the SmaI site of pUC19.
Plasmid pECV was made by first amplifying a LacZ fragment by PCR from pUC19 using primers ecv1 (ttt gaagacttgtcgggtctcaaggtgcagctggcacgacaggtttc) and ecv2 (ttt gaagactttaccggtctcaaagccgcgcgtttcggtgatgac). The primers introduce the BsaI restriction site flanking the LacZ gene. This fragment is cloned using BpiI into a vector backbone fragment amplified from pUC19spec (pUC19spec is identical to pUC19 except that the bla gene was replaced by a spectinomycin resistance gene, this backbone was chosen because it does not contain an internal BsaI restriction site) using primers bpi191 (tttt cgacaagtcttcattaatgaatcggccaacgcgc) and bpi192 (tttt ggtaaagtcttccgggagctgcatgtgtcag).
Engler C., Kandzia R, & Marillonnet S. (2008). A One Pot, One Step, Precision Cloning Method with High Throughput Capability. PLoS ONE, 3(11), e3647.
Full text: Click here
Publication 2008
Agrobacterium Cloning Vectors Escherichia coli Genes HMN (Hereditary Motor Neuropathy) Proximal Type I Kanamycin Resistance LacZ Genes Nicotiana Oligonucleotide Primers Open Reading Frames Plasmids Promega prostaglandin M Signal Peptides Spectinomycin Vertebral Column
2
Construction of Engineered E. coli Strains
The λ prophage was obtained from strain DY33031 (link), modified to include the bla gene and introduced into wild-type MG1655 E. coli by P1 transduction at the bioA/bioB gene locus and selected on ampicillin to yield the strain EcNR1 (λ-Red+). Replacement of mutS with the chloramphenicol resistance gene (cmR cassette) in EcNR1 produced EcNR2 (mutS−, λ-Red+). EcNR2 was grown in low salt LB-min medium (10 g tryptone, 5 g yeast extract, 5 g NaCl in 1 l dH2O) for optimal electroporation efficiency. A premature stop codon was introduced into the cmR gene of EcNR2 with oligo cat_fwd_stop (Supplementary Table 3) to produce EcFI5, thus inactivating the cmR gene. An oligo (cat_fwd_restore) containing the wild-type sequence was used to restore the CmR phenotype. The pAC-LYC plasmid32 (link) containing genes crtE, crtB and crtI was electroporated into EcNR1 to generate EcHW1, which produces lycopene at basal levels. Replacement of mutS with a kanamycin resistance gene in EcHW1 produced EcHW2.
Wang H.H., Isaacs F.J., Carr P.A., Sun Z.Z., Xu G., Forest C.R, & Church G.M. (2009). Programming cells by multiplex genome engineering and accelerated evolution. Nature, 460(7257), 894-898.
Publication 2009
Ampicillin Chloramphenicol Resistance Codon, Nonsense Electroporation Escherichia coli Genes Kanamycin Resistance Lycopene Oligonucleotides Phenotype Prophages Saccharomyces cerevisiae Salts Sodium Chloride Strains Transduction, Genetic
3
Arabidopsis Transformation and Reporter Gene Assays
Transformations of Arabidopsis thaliana were performed by the floral dip method [2 (link)] using Agrobacterium tumefaciens strain GV3101 [15 (link)]. The following binary plasmids were used: pBINPLUS [5 (link)] which confers kanamycin resistance via the nptII gene; pSKI015 [7 (link)] which confers phosphinothricin resistance via the bar gene; and pBIG-HYG [8 (link)] which confers hygromycin B resistance via the hpt gene. The reporter genes uidA with added intron [6 (link)] and mGFP4 [4 (link)] were inserted into the binary vector pBINPLUS under the control of 707 bp of the 5' upstream sequence of the carbonic anhydrase 1 (CA1) gene (At3g01500). The following non-transformed Arabidopsis seeds, obtained from the Nottingham Arabidopsis stock centre (NASC), were used for transformations and as controls; Col-0 (NASC N1092), Col-2 (NASC N907), Col-7 (NASC N3731), Ws (NASC N1601) and Ler-0 (NASC NW20). Previously characterised transgenic lines were used as positive controls; for phosphinothricin-resistance NASC accessions N21504, N21443, N21461, N21821, N21824 and N850573 were used, and for hygromycin-resistance 5 lines transformed with pBIG-HYG containing mGFP4 (K. Parsley unpublished data) were used.
Harrison S.J., Mott E.K., Parsley K., Aspinall S., Gray J.C, & Cottage A. (2006). A rapid and robust method of identifying transformed Arabidopsis thaliana seedlings following floral dip transformation. Plant Methods, 2, 19.
Full text: Click here
Publication 2006
Agrobacterium tumefaciens Animals, Transgenic Arabidopsis Arabidopsis thalianas Cloning Vectors Dehydratase, Carbonate Gene Expression Regulation Genes Genes, Reporter hygromycin A Hygromycin B Introns Kanamycin Resistance Parsley phosphinothricin Plant Embryos Plasmids Strains
4
Construction of Gateway-Adapted Tn7 Delivery Plasmids
Plasmid pCW4 [22 (link)], containing tnsABCD, was digested with PacI and partially digested with DrdI, to liberate a 6636 bp PacI-DrdI fragment. The overhanging ends were made blunt with Klenow fragment and ligated to SmaI linearized pBAD18 [10 (link)]. The plasmid containing tnsABCD in the correct orientation relative to the PBAD promoter was named pGRG2. pGRG2 and pMAK700 [11 (link)], a pSC101 plasmid with a temperature-sensitive replicon, were digested with NaeI, releasing a 9541 bp tnsABCD containing fragment and a 2416 bp pSC101 origin-containing fragment, respectively. These two fragments were ligated together to create pGRG3, which contains the bla gene encoding β-lactamase, the araC gene and the PBAD-tnsABCD genes, and the temperature-sensitive pSC101 origin of replication. KanR and ChlR mini-Tn7s were inserted into pGRG3 using red-gam recombination as follows: The primers ATCATGGCAATTCTGGAAGAAATAGCGCTTTCAGCCtgtgggcggacaaaatagttgggaactggga and CATGAGCAGATCCTCTACGCCGGACGCATCGTGGCCtgtgggcggacaataaagtcttaaactgaa were used to amplify the KanR mini-Tn7 from pGPS1.1 and the ChlR mini-Tn7 from pGPS2.1 (both from New England Biolabs). The lower case letters are complementary to Tn7 and the upper case letters are homologous to sequences in pGRG3. The resulting PCR products were transformed into DH5α carrying the plasmid pTP223 [23 (link)], which expresses the phage λ red recombinase products, and KanR or ChlR recombinants were selected. The resulting KanR and ChlR mini-Tn7 containing plasmids were named pGRG8 and pGRG6. Both Tn7 inserts in the plasmids were sequenced to ensure that no mutations were inserted by PCR. Any mutations were corrected to the wildtype sequence by subcloning from samples that did not contain those mutations. pGRG17 was created by digesting pGRG8 with DraIII and EagI to remove the kanamycin resistance gene. This was replaced with the annealed oligonucleotides GGCCGTGGCGCGCCTCCTAGGTGCTCGAGTGGCGGCCGCTATTGAGGGATCTGATTAATTAAAAC and TTAATTAATCAGATCCCTCAATAGCGGCCGCCACTCGAGCACCTAGGAGGCGCGCCAC to create a multiple cloning site with the following unique restriction sites: AvrII, NotI, PacI, and XhoI.
To provide conjugation as an alternative way to introduce these plasmids into bacterial strains, we cloned the oriT site from the RP4 plasmid sequences in the strain SM10 [24 (link)]. oriT was amplified by PCR using primers GGCGCCGGCCAGCCTCGCAGAGCA and GGCGCCGGGCAGGATAGGTGAAGT, and cloned into pCR2.1-topo using the Topo TA cloning kit (Invitrogen). The sequence and transfer activity was confirmed, then the oriT sequence was moved by moving the 113 bp SfoI fragment into the NaeI site (resulting in the plasmid in parentheses) of pGRG6 (pGRG19), pGRG8 (pGRG20), and pGRG17 (pGRG25). pGRG36 is identical to pGRG25, except that it contains a SmaI site in the multiple cloning site. Both pGRG25 and pGRG36 sequences can be downloaded at GenBank using NCBI accession # DQ460223. The ability of the delivery plasmids to be transferred by conjugation was confirmed using pGRG25-containing SM10 as donor in a standard conjugation assay at 32°C [25 ].
To facilitate the cloning of large fragments into the delivery vehicle we cloned the RfC.1 element from the Gateway cloning system (Invitrogen) into the SmaI site of pGRG36, yielding pGRG37. This allows in vitro movement of transgenes cloned in Gateway cloning vectors into pGRG37, bypassing the need for standard cloning techniques [26 (link)].
McKenzie G.J, & Craig N.L. (2006). Fast, easy and efficient: site-specific insertion of transgenes into Enterobacterial chromosomes using Tn7 without need for selection of the insertion event. BMC Microbiology, 6, 39.
Full text: Click here
Publication 2006
Bacteria Bacteriophages beta-Lactamase Biological Assay Cloning Vectors DNA Polymerase I Genes Genes, araC HMN (Hereditary Motor Neuropathy) Proximal Type I Homologous Sequences Kanamycin Resistance Movement Mutation Obstetric Delivery Oligonucleotide Primers Oligonucleotides Plasmids Recombinase Recombination, Genetic Replication Origin Replicon Strains Tissue Donors Topotecan Transgenes
5
Plasmid and Chromosomal Transcriptional Reporters
Experiments with plasmid-borne reporters were performed in Escherichia coli strain DH5α [F−, λ−, φ80lacZΔM15, Δ(lacZYA-argF)U169, deoR, recA1, endA1, hsdR17(rk−, mk+), phoA, supE44, thi-1, gyrA96, relA1], whereas experiments with chromosomally encoded reporters were performed in E. coli strain W3110 [F−, λ−, IN(rrnD-rrnE), rph-1]. With the exception of assays for promoter function on the chromosome, all experiments utilized plasmid pSB3C5 and the construct of interest was cloned via standard procedures between the BioBrick cloning sites (35 (link)). Each construct contained the Bba_B0032 ribosome binding site and the Bba_B0015 transcriptional terminator. The sequences for the fluorescent reporter proteins, GFP (Bba_E0040), dsRed (Bba_E1010), Gemini (Bba_E0051), the ribosome binding site (Bba_B0032) and the terminator (Bba_B0015) can be found at the Registry of Standard Biological Parts (www.partsregistry.org).
Plasmid constructs contained the following elements: promoter-TACTAGAG-B0032-TACTAG-ORF(dsRed, GFP, Gemini)-TACTAGAG-B0015, where the ORF was exchanged using standard PCR-based techniques. For chromosomal insertions, test constructs were fused to a kanamycin resistance marker (Bba_P1003, Registry of Standard Biological Parts, www.partsregistry.org) using SOEing PCR (36 (link)). PCR products were recombined onto the chromosome using the λ-red recombination system, encoded on the plasmid vector pSIM5, as described earlier (37 (link)). After verification of successful cassette insertion by sequencing, pSIM5 was cured from the strain. For the tonB locus, the SOEing primers used are as follows (with homology to the locus listed in bold).

tonB-BioBrickPrefix-fwd

AAGCAGAAAGTCAAAAGCCTCCGACCGGAGGCTTTTGACTgaattcgcggccgcttctag

BioBrickSuffix-rev

cgaacttttgctgagttgaaggatcagCTGCAGCGGCCGCTACTAGTA

BioBrickSuffix-fwd

TACTAGTAGCGGCCGCTGCAGctgatccttcaactcagcaaaagttcg

P1003-tonB-rev

GATCCTGAAGGAAAACCTCGCGCCTTACCTGTTGAGTAATttattagaaaaactcatcga

The UP sequence (GAGAAAATTATTTTAAATTTCCTC) was introduced upstream of the promoter constructs using standard techniques resulting in a BioBrick scar (ACTAGA) between the UP sequence and the promoter. The anti-sequence (ATCCGGAATCCTCTGGATCCTC) was introduced in a similar fashion resulting in constructs of the form: promoter-TACTAGAG-anti-B0032-TACTAG-GFP-TACTAGAG-B0015.
Two strains were used to control for cellular auto-fluorescence. DH5α transformed with pSB3C5 was used as a negative control for experiments using plasmid-based constructs. For experiments testing promoter function from the tonB locus, the kanamycin resistance marker with no reporter construct was recombined downstream of the tonB locus using primers tonB-BioBrickPrefix-fwd, P1003-tonB-rev.
Davis J.H., Rubin A.J, & Sauer R.T. (2010). Design, construction and characterization of a set of insulated bacterial promoters. Nucleic Acids Research, 39(3), 1131-1141.
Publication 2010
Amino Acid Sequence Binding Sites Biological Assay Biopharmaceuticals Cells Chromosomes Cicatrix Cloning Vectors E1010 Escherichia coli Fluorescence Kanamycin Resistance Oligonucleotide Primers Plasmids Recombination, Genetic Ribosomes Strains Transcription, Genetic

Most recents protocols related to «Kanamycin Resistance»

1
Sepsis Modeling in Mice Using N. meningitidis Strains
Not available on PMC !

Example 7

Sepsis modeling was performed as described by Gorringe A. R., Reddin, K. M., Voet P. and Poolman J. T. (Methods Mol. Med. 66, 241 (Jan. 1, 2001)) and Johswich, K. O. et al. (Infect. Immun. 80, 2346 (Jul. 1, 2012)). Groups of 6 eight-week-old C57BL/6 mice (Charles River Laboratories) were inoculated via intraperitoneal injection with N. meningitidis strain B16B6, B16B6 Δtbpb, or B16B6 Δnmb0313 (N=2 independent experiments). To prepare inoculums, bacterial strains for infection were grown overnight on GC agar, resuspended and then grown for 4 h in 10 ml of Brain Heart Infusion (BHI) medium at 37° C. with shaking. Cultures were adjusted such that each final 500 μl inoculum contained 1×106 colony forming units and 10 mg human holo-transferrin. Mice were monitored at least every 12 h starting 48 h before infection to 48 h after infection for changes in weight, clinical symptoms and bacteremia. Mice were scored on a scale of 0-2 based on the severity of the following clinical symptoms: grooming, posture, appearance of eyes and nose, breathing, dehydration, diarrhea, unprovoked behavior, and provoked behavior. Animals reaching endpoint criteria were humanely euthanized. Animal experiments were conducted in accordance with the Animal Ethics Review Committee of the University of Toronto.

FIG. 7 shows the results obtained. FIG. 7A shows a solid phase binding assay consisting of N.men cells fixed with paraformaldehyde (PFA) or lysed with SDS and were spotted onto nitrocellulose and probed with α-TbpB antibodies. ΔSLAM/tn5 refers to the original strain of SLAM deficient cells obtained through transposon insertion. ΔSLAM describes the knockout of SLAM in Neisseria meningitidis obtained by replacing the SLAM ORF with a kanamycin resistance cassette. FIG. 7B shows a Proteinase K digestion assay showing the degradation of TbpB, LbpB and fHbp only when Nm cells are SLAM deficient (ΔSLAM). Nm cells expressing individual SLPs alone and with SLAM were incubated with proteinase K and Western blots were used to detect levels of all three SLPs levels with and without protease digestion (−/+). Flow cytometry was used to confirm that ΔSLAM cells could not display TbpB (FIG. 7C) or fHbp (FIG. 7D) on the cell surface. Antibodies against TbpB and fHbp were used to bind surface exposed SLPs followed by incubation with a α-Rabbit antibody linked to phycoerythrin to provide fluorescence. The mean fluorescent intensity (MFI) of each sample was measured using the FL2 detector of a BD FACS Calibur. The signal obtained from wildtype cells was set to 100% for comparison with signals from knockout cells. Error bars represent the standard error of the mean (SEM) from three experiments. Shown in FIG. 7E are the results of mice infections with various strains. Mice were infected via intraperitoneal injection with 1×106 CFU of wildtype N. meningitidis strain B16B6, B16B6 with a knockout of TbpB (ΔtbpB), or B16B6 with a knockout of nmb0313 Δslam and monitored for survival and disease symptoms every 12 h starting 48 hr pre-infection to 48 h post-infection and additionally monitored at 3 hr post-infection. Statistical differences in survival were assessed by a Mantel-Cox log rank test (GraphPad Prism 5) (*p<0.05, n.s. not significant). These results show a marked reduction in post-infection mortality in mice infected with the knockout of nmb0313 Δslam strain.

US11872275B2. SLAM polynucleotides and polypeptides and uses thereof (2024-01-16). ENGINEERED ANTIGENS INC. [CA]. Inventors: Trevor F. Moraes [CA], Christine Chieh-Lin Lai [CA], Yogesh Hooda [CA], Andrew Judd [CA], Anthony B. Schryvers [CA], Scott D. Gray-Owen [CA].
Full text: Click here
Patent 2024
Agar Animals Antibodies Bacteremia Bacterial Infections Biological Assay Brain Cells Cultured Cells Dehydration Diarrhea Digestion Endopeptidase K Eye Flow Cytometry Fluorescence Genes Heart Homo sapiens Immunoglobulins Infection Injections, Intraperitoneal Jumping Genes Kanamycin Resistance Mice, Inbred C57BL Mus Neisseria Neisseria meningitidis Nitrocellulose Nose paraform Peptide Hydrolases Phycoerythrin prisma Rabbits Rivers Sepsis Strains Transferrin Virulence Western Blot
2
Chromosomal Gene Deletion in E. coli
The method described by Datsenko and Wanner was used for chromosomal gene deletion (20 (link)). In brief, the genetic fragment containing the kanamycin resistance gene aph flanked by FLP Recognition Target (FRT) sites was amplified by PCR using the template plasmid pKD4 and the hybrid primers LBMAF:5′-GGCAG ATCCCGATTAGCGCCGCGCGTTTCTGGTCGTTGGATTTCCGTGTAGGCTGGAGCTGCTTC-3′ and LBMAR: 5′-CTCGCGTACCGTAGGCGGCGTCGCGCGCGTGGCATCGTCTTCACCCATATGAATATCCTCCTTAG-3′, which consisted of 20 nucleotides (nt) of the helper plasmid pKD4 and 45 nt on the 5′ and 3′ ends of the inactivated sbmA. The PCR fragment (1,567 bp) was purified, digested with DpnI, repurified and transferred into E. coli ATCC 25922 by electroporation, in which the Red recombinase expression plasmid pKD46 was previously transformed and induced by L-arabinose. Transformants were selected on Luria-Bertani (LB) agar containing 50 μg/ml of kanamycin at 37°C. The inserted sequence was amplified from the kanamycin-resistant strains by using the primers SBMF: 5′-GCACGGCAGAAAAAAGCA-3′ and SBMR: 5′-GACGGAAACAGCAAGAACAAA-3′ which is located outside of inactivated gene. The length of the PCR product of sbmA using the primers set SBMF and SBMR in E. coli ATCC 25922 is 1,404 bp. When sbmA is successfully inactivated, the PCR product (2,198 bp) was amplified and sequenced for the verification of the gene deletion.
Shen S., Sun Y., Ren F., Blair J.M., Siasat P., Fan S., Hu J, & He J. (2023). Characteristics of antimicrobial peptide OaBac5mini and its bactericidal mechanism against Escherichia coli. Frontiers in Veterinary Science, 10, 1123054.
Full text: Click here
Publication 2023
Agar Arabinose Autosomal Recessive Polycystic Kidney Disease Bulbo-Spinal Atrophy, X-Linked Chromosome Deletion Electroporation Escherichia coli Genes Hybrids Kanamycin Kanamycin Resistance Nucleotides Oligonucleotide Primers Plasmids Recombinase Reproduction Sequence Deletion Strains
3
Genetic Engineering of M. bovis BCG Strains
M. bovis BCG Pasteur (IP1173P2) and Moreau (TMC1013 (BCG Brazilian), ATCC35736) strains were cultivated in Middlebrook 7H9 broth supplemented with 10% (v/v) OADC, 0.4% (v/v) glycerol and 0.05% (v/v) Tween 80. Minimum inhibitory concentrations (MICs) of test compounds for M. bovis strains were determined as described above except that M. bovis was cultivated in Middlebrook 7H9 broth supplemented with 10% (v/v) OADC, 0.4% (v/v) glycerol and 0.05% (v/v) Tween 80 (Middlebrook 7H9 broth supplemented with 0.2% glycerol, 0.05% Tween 80; 0. 6% v/v oleic acid, 2 mg/mL dextrose, 5 mg/mL bovine serum albumin, 3 μg/mL catalase). The erm37 ORF was PCR amplified using oligonucleotides 1: CTCGATCATATGGTGTCCGCCCTCGGACGGTC and 2: CATACTAAGCTTTTACC GCCCCTGCCAGTCAC and genomic DNA from M. bovis Moreau strain. The Rv0560c promoter (1021 bp upstream the ATG start codon) was PCR amplified using oligonucleotides 3: ATCGTTGACGTCGCGG CCGCATCGTGGGTTGCGGATGAGC and 4: ATCGCTGAATTCGTGTTCATATATATCAACGGC and genomic DNA from M. bovis BCG Pasteur as a matrix. The erm37 ORF was cloned in between the NdeI and HindIII sites under the control of the Rv0560c promoter inserted between the NotI and NdeI sites in a shuttle vector (a kind gift from E. Liauzun) containing an origin of replication for Mycobateria (OriM), an origin of replication for E. coli (OriC) and the kanamycin resistance cassette. Another promoter, MMAR5083, corresponding to the gene upstream of lpqE in M. marinum, was inserted in place of Rv0560c in the same vector and led to the same results.
The entire erm37 gene, including its own promoter, was PCR amplified using oligonucleotides 2 and 5: ATCGTCGCGGCCGCGATATCGCCTCATTGGC, as described above, and cloned in between the NotI and HindIII sites in the same vector. All the molecular biology cloning experiments were performed according to the manufacturer recommendations. We used E. coli Top10 cells (Invitrogen) for cloning experiments. We prepared and transformed M. bovis BCG by electroporation as described,56 (link) using 200μl aliquots stored in 10% glycerol at -80°C, except that bacteria were recovered in 1ml SOC medium (Sigma) for 6h at 37°C. Then, M. bovis BCG transformed bacteria were cultivated in the presence of 20μg/ml kanamycin.
Zhang J., Lair C., Roubert C., Amaning K., Barrio M.B., Benedetti Y., Cui Z., Xing Z., Li X., Franzblau S.G., Baurin N., Bordon-Pallier F., Cantalloube C., Sans S., Silve S., Blanc I., Fraisse L., Rak A., Jenner L.B., Yusupova G., Yusupov M., Zhang J., Kaneko T., Yang T.J., Fotouhi N., Nuermberger E., Tyagi S., Betoudji F., Upton A., Sacchettini J.C, & Lagrange S. (2023). Discovery of natural-product-derived sequanamycins as potent oral anti-tuberculosis agents. Cell, 186(5), 1013-1025.e24.
Full text: Click here
Publication 2023
Bacteria Catalase Cells Cloning Vectors Codon, Initiator Electroporation Escherichia coli Genes Genome Glucose Glycerin Kanamycin Kanamycin Resistance Minimum Inhibitory Concentration Oleic Acid Oligonucleotides Replication Origin Serum Albumin, Bovine Shuttle Vectors Strains Tween 80
4
Recombinant PTP1B Expression and Purification
All experiments used the same PTP1B construct as was used previously: residues 1–321, WT* (C32S/C92V double mutation), in the pET24b vector carrying a kanamycin resistance gene (Keedy et al., 2018 (link)). Expression and purification were also performed as previously described (Keedy et al., 2018 (link)). PTP1B was transformed into BL21 Escherichia coli competent cells. The cultures were grown overnight in a 5 mL LB media containing 35 mg/L (final) kanamycin at 37°C shaking continuously at 150 rpm. Next, this overnight culture was used to inoculate 1 L LB media containing 35 mg/L (final) kanamycin. This culture was grown until the optical density at 600 nm (OD600) reached between 0.6 and 0.8. PTP1B expression was then immediately induced by adding IPTG to 100 µM (final) and incubating for about 18–20 hr at 18°C shaking continuously at 200–250 rpm. The culture was then pelleted by centrifugation, the supernatant discarded, and the cell pellets (‘cellets’) harvested and stored at –80°C for subsequent purification.
Skaist Mehlman T., Biel J.T., Azeem S.M., Nelson E.R., Hossain S., Dunnett L., Paterson N.G., Douangamath A., Talon R., Axford D., Orins H., von Delft F, & Keedy D.A. (2023). Room-temperature crystallography reveals altered binding of small-molecule fragments to PTP1B. eLife, 12, e84632.
Full text: Click here
Publication 2023
Cells Centrifugation Cloning Vectors Escherichia coli Genes Isopropyl Thiogalactoside Kanamycin Kanamycin Resistance Mutation Pellets, Drug PTPN1 protein, human Vision
5
Recombinant Glutamine Synthetase Production
The coding sequence for E.coli glutamine synthetase (GS) was inserted into the Kpn1/Xho1-digested pET-45b(+) expression vector (GenScript Biotech, The Netherlands), containing a hexahistidine tag at its N-terminus and an ampicillin resistance gene on the plasmid. Single-mutant variants of glutamine synthetase were prepared by site-directed mutagenesis using the QuikChange Lightning kit (Agilent Technologies, USA).
The gene coding for γ-glutamyl phosphate reductase was ligated into the pHTP1 expression vector (GenScript Biotech) producing a recombinant protein that contains an N-terminal hexahistidine and Kanamycin resistance.
All the recombinant proteins were transformed and expressed in E.coli BL21 (DE3) (Invitrogen, USA).
Medina-Carmona E., Gutierrez-Rus L.I., Manssour-Triedo F., Newton M.S., Gamiz-Arco G., Mota A.J., Reiné P., Cuerva J.M., Ortega-Muñoz M., Andrés-León E., Ortega-Roldan J.L., Seelig B., Ibarra-Molero B, & Sanchez-Ruiz J.M. (2023). Cell Survival Enabled by Leakage of a Labile Metabolic Intermediate. Molecular Biology and Evolution, 40(3), msad032.
Publication 2023
Cloning Vectors Escherichia coli Genes Glutamate-Ammonia Ligase His-His-His-His-His-His Kanamycin Resistance Mutagenesis, Site-Directed Open Reading Frames Oxidoreductase Phosphates Plasmids Recombinant Proteins

Top products related to «Kanamycin Resistance»

1
Kanamycin by Merck Group
Sourced in United States, Germany, United Kingdom, France, Spain, China, Israel, India, Canada, Macao, Australia, Sao Tome and Principe, Belgium, Sweden, Poland, Japan, Switzerland, Brazil, Italy, Ireland
Kanamycin is a broad-spectrum antibiotic derived from the bacterium Streptomyces kanamyceticus. It is commonly used as a selective agent in molecular biology and microbiology laboratories for the growth and selection of bacteria that have been genetically modified to express a gene of interest.
2
Pgem t easy vector by Promega
Sourced in United States, China, Germany, United Kingdom, Japan, France, Italy, Australia, Switzerland, Spain, Israel, Canada
The pGEM-T Easy Vector is a high-copy-number plasmid designed for cloning and sequencing of PCR products. It provides a simple, efficient method for the insertion and analysis of PCR amplified DNA fragments.
3
Pgem t easy by Promega
Sourced in United States, Germany, United Kingdom, Japan, France, China, Italy, Australia
The pGEM-T Easy Vector is a linear plasmid vector used for cloning PCR products. It contains T7 and SP6 RNA polymerase promoters flanking a multiple cloning region within the α-peptide coding region of the enzyme β-galactosidase. The vector is supplied pre-cut with a single 3' terminal thymidine (T) to the multiple cloning region, which greatly improves the efficiency of ligation of PCR products by preventing recircularization of the vector and providing a compatible overhang for PCR products generated by certain thermostable DNA polymerases.
4
Gibson assembly by New England Biolabs
Sourced in United States, United Kingdom, Denmark, France
Gibson Assembly is a molecular biology technique used for the seamless cloning and assembly of multiple DNA fragments. It allows the joining of DNA sequences with high efficiency, without the need for restriction enzymes or ligase. The core function of Gibson Assembly is to enable the rapid and precise construction of recombinant DNA molecules from multiple overlapping DNA fragments.
5
Geneart by Thermo Fisher Scientific
Sourced in United States, Germany, United Kingdom, France, Italy, New Zealand
The GeneArt is a laboratory equipment product designed for genetic engineering and molecular biology applications. It provides tools and functionalities for DNA synthesis, assembly, and modification. The core function of the GeneArt is to enable researchers and scientists to create and manipulate genetic constructs for various experimental and research purposes.
6
Phusion high fidelity dna polymerase by Thermo Fisher Scientific
Sourced in United States, Finland, Germany, Lithuania, France, United Kingdom, Spain, Canada, Switzerland, Sweden, Belgium
Phusion High-Fidelity DNA Polymerase is a thermostable DNA polymerase engineered for high-fidelity DNA amplification. It possesses 3'→5' exonuclease proofreading activity, resulting in an error rate up to 50-fold lower than Taq DNA polymerase.
7
Pvax1 by Thermo Fisher Scientific
Sourced in United States, Germany
The PVAX1 is a versatile laboratory centrifuge designed for a wide range of applications. It features a fixed-angle rotor with a maximum speed of 6,000 RPM and a maximum RCF of 3,345 x g. The unit is powered by a brushless DC motor and includes an integrated electronic control system for precise speed and time settings. The PVAX1 is compatible with a variety of sample tube sizes and can accommodate both fixed-angle and swing-out rotors.
8
Micropulser by Bio-Rad
Sourced in United States, China
The MicroPulser is a lab equipment product designed for electroporation, a technique used to introduce foreign molecules into cells. The device generates high-voltage electrical pulses that create temporary pores in cell membranes, facilitating the uptake of desired substances. The MicroPulser is a compact and versatile instrument suitable for a range of electroporation applications in research and laboratory settings.
9
In fusion hd cloning kit by Takara Bio
Sourced in United States, Japan, China, France, Germany, Canada
The In-Fusion HD Cloning Kit is a versatile DNA assembly method that allows for the rapid and precise seamless cloning of multiple DNA fragments. The kit provides a high-efficiency, directional cloning solution for a wide range of applications.
10
Q5 site directed mutagenesis kit by New England Biolabs
Sourced in United States, United Kingdom, Germany, China, Canada, Singapore, Japan, Morocco, France
The Q5 Site-Directed Mutagenesis Kit is a laboratory tool designed for introducing precise mutations into DNA sequences. It provides a streamlined workflow for generating site-specific changes in plasmid or linear DNA templates.

More about "Kanamycin Resistance"

Kanamycin Resistance, also known as Kan-R or KanR, refers to the ability of organisms, such as bacteria, to withstand the effects of the antibiotic kanamycin.
This resistance can occur through various mechanisms, including the production of enzymes that inactivate the antibiotic, modifications to the antibiotic target, or changes in membrane permeability.
Understanding and studying Kanamycin Resistance is crucial for developing effective treatments, preventing the spread of resistant infections, and optimizing research protocols.
The PGEM-T Easy vector and PGEM-T Easy are commonly used plasmids that confer Kanamycin Resistance, allowing for the selection of transformed bacterial cells.
Similarly, the Gibson Assembly and GeneArt methods can be employed to construct DNA sequences with Kanamycin Resistance genes.
Phusion High-Fidelity DNA Polymerase and the Q5 Site-Directed Mutagenesis Kit are valuable tools for amplifying and modifying DNA, including Kanamycin Resistance genes.
Researchers can utilize the AI-driven platform PubCompare.ai to locate the best protocols from literature, preprints, and patents related to Kanamycin Resistance.
This platform can enhance reproducibility and accuaracy by providing personalized recommendations tailored to their specific research needs.
The PVAX1 vector and the MicroPulser electroporation device are additional resources that may be relevant for Kanamycin Resistance research and applications.
By understanding the various aspects of Kanamycin Resistance, scientists can develop more effective treatments, prevent the spread of resistant infections, and optimize their research protocols, ultimately contributing to advancements in the field of microbiology and biotechnology.