The largest database of trusted experimental protocols
> Physiology > Organism Function > Fertilization

Fertilization

Fertilization is the process by which a sperm cell (male) fuses with an oocyte (female) to form a zygote, initiating the development of a new individual organism.
This complex process involves the interaction of various hormones, chemical signals, and cellular mechanisms to ensure successful union of the male and female gametes.
Effective fertilization research is crucial for advancing understanding of human and animal reproduction, as well as for developing assisted reproductive technologies.
Optimizing fertilization protocols through AI-driven comparisons can help researchers achieve greater reproducibility and accuracy in their studies, unlocking new insights and driving progress in this vital field of study.

Most cited protocols related to «Fertilization»

This study was conducted among pregnant women participating in the “Puerto Rico Testsite for Exploring Contamination Threats (PROTECT)” project, an ongoing prospective birth cohort in the Northern Karst Region of Puerto Rico, which is designed to evaluate the relationship between environmental toxicants and risk of preterm delivery. Study participants were recruited at approximately 14±2 weeks of gestation at seven prenatal clinics and hospitals throughout Northern Puerto Rico during 2010-2012. Women were eligible if they were between the ages of 18 to 40 years, resided in a municipality within the Northern karst region, didn’t use oral contraceptives three months prior to pregnancy or in vitro fertilization as a method of assisted reproductive technology, and were free of known medical/obstetrics complications. Women provided spot urine samples at three separate study visits (20±2 weeks, 24±2 weeks, and 28±2 weeks of gestation). Questionnaires to collect demographic information and data on self-reported product use in the 48 hours preceding urine sample collection were also administered at each visit.
The present analysis reflects the first105 women recruited into the study who had urinary biomarker data as of June 2012. The research protocol was approved by the Ethics and Research Committees of the University of Puerto Rico and participating clinics, the University of Michigan School of Public Health, and Northeastern University. The involvement of the Centers for Disease Control and Prevention (CDC) laboratory was determined not to constitute engagement in human subjects research. The study was described in detail to all participants, and informed consent was obtained prior to study enrollment.
Publication 2013
Assisted Reproductive Technologies Biological Markers Birth Cohort Contraceptives, Oral Fertilization Fertilization in Vitro Homo sapiens In Vitro Techniques Pregnancy Pregnant Women Premature Birth Urine Urine Specimen Collection Woman
M-PER mammalian protein extraction reagent (Thermo Scientific, USA) was used to
lyse the human cell lines 24 hr post-transfection, zebrafish embryos at 24 hour
post-fertilization (hpf) and mouse liver 3 day post-injection (dpi). Each lysate
was separated by 12% sodium dodecyl sulfate polyacrylamide gel
electrophoresis (SDS-PAGE) and transferred to nitrocellulose membrane (Pall
Corporation; NY, USA). Subsequently, the membrane was probed with the indicated
primary antibody (anti-EGFP [1∶1000, Santa Cruz Biotechnology,
catalog # sc-9996] and anti-DsRed [1∶1000, Clontech, catalog #
632393]), washed with TBST (0.2 M Tris, 1.37 M NaCl,0.1% Tween-20,
pH7.6), probed with HRP-conjugated goat anti-mouse antibody (1∶4000, Santa
Cruz Biotechnology, catalog # sc-2005). The bound antibody was detected by
enhanced chemiluminescence (AniGen, Korea) and then exposed to X-ray film (AGFA,
Belgium).
Because anti-DsRed antibody has been successfully used to decorate mCherry
protein [12] (link),
anti-DsRed antibody was used to visualize the mCherry protein.
Full text: Click here
Publication 2011
Antibodies, Anti-Idiotypic Cell Lines Chemiluminescence Embryo Fertilization Goat Homo sapiens Immunoglobulins Liver Mammals Mus Nitrocellulose Proteins SDS-PAGE Sodium Chloride Tissue, Membrane Transfection Tromethamine Tween 20 X-Ray Film Zebrafish
Wild type adult male and female zebrafish, Danio rerio, were obtained from a commercial supplier (Ekkwill, Gibsonton, FL) and maintained in 30 gal aquaria at 28°C on a 14:10 light-dark cycle. Fertilized eggs were collected after natural spawning, washed, and distributed into 20 × 100 mm culture plates (Fisher Scientific). Embryos (150 embryos/50 ml egg water) were allowed to develop at 28°C on a 14L:10D cycle [36 ]. For developmental expression analysis embryos were collected after timed intervals: 2, 6, 12, 24, 48, 72, and 120 hours post-fertilization (hpf), quick-frozen on dry ice, and stored at -70°C until analysis (3 independent embryo pools, 50 embryos per pool, per time point from the same spawning group). For treatment expression analysis embryos were left untreated until 24 hpf and then exposed to 17β-estradiol (E2; 0.1 μM), testosterone (T; 1 μM), ICI 182,780 (ICI; 10 μM; Tocris Bioscience, Ellisville, MO), β-napthaflavone (BNF; 10 nM), or 2,3,7,8, tetrachlodibenzo-p-dioxin (TCDD; 1 nM; Ultra Scientific, N. Kingstown, RI) dissolved in dimethyl sulfoxide (DMSO). All chemicals were obtained from Sigma-Aldrich (St. Louis, MO) unless otherwise noted. Stock solutions of chemicals were added directly to egg water and replaced daily. In addition, embryos were treated with DMSO alone (final concentration, 0.0006%), EtOH alone (final concentration 0.0005%), or left untreated as a control. Embryos were collected at 96 hpf, quick-frozen on dry ice, and stored at -70°C until analysis (3 independent embryo pools per treatment). Treated embryo RNAs were used for both housekeeping gene expression analysis (Table 3) and gene of interest normalization (Figure 2). Tissues (brain, eye, heart, liver, muscle, gonad) were collected from adult male and female zebrafish, pooled by sex (3 pools per tissue type/sex, 5 fish per pool), quick-frozen on dry ice, and stored at -70°C. Adult fish were reproductively active stock from our breeding colony.
Full text: Click here
Publication 2008
Adult Brain Dioxins Dry Ice Embryo Embryonic Development Estradiol Ethanol Females Fertilization Fishes Freezing Gene Expression Profiling Genes Gonads Heart Histocompatibility Testing ICI 182780 Liver Males Muscle Tissue RNA Sulfoxide, Dimethyl Testosterone Tetrachlorodibenzodioxin Tissues Zebrafish Zygote

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2013
Assisted Reproductive Technologies Birth Cohort Contraceptives, Oral Fertilization Fertilization in Vitro Homo sapiens In Vitro Techniques Mothers phthalate Pregnancy Pregnant Women Premature Birth Urine
Fertilized eggs of medaka and zebrafish were routinely collected as described previously [11] (link), [14] (link), [17] (link). The embryos were incubated at 28°C until 6 days (zebrafish) or 7 days (for medaka) post fertilization. Except for the Heino strain, all the strains and transgenic lines of both medaka and zebrafish embryos were incubated with 5×PTU to prevent pigmentation. The embryos were fixed with 4%PFA at 4°C overnight. For fluorescent immunostaining of either cryosecctions or whole mount embryos, fixed embryos were dechorionated (for medaka) and equilibrated in 1×PTw (1×PBS at pH 7.3, 0.1% Tween), followed by appropriate steps including the heating method for either cyrosection or whole mount immunostaining (see below for details). Prior to perform combined whole mount in situ hybridization and immunostaining, dechorionated medaka embryos were washed with 1×PTw for 5 min several times, and then stored in 100% MeOH at −20°C at least two days. Those embryos were subjected to fluorescent whole mount in situ hybridization including the heating method and immunostaining (see below for details).
Full text: Click here
Publication 2011
Animals, Transgenic Embryo Fertilization Fluorescent in Situ Hybridization In Situ Hybridization Oryzias latipes Pigmentation Strains Tweens Zebrafish Zygote

Most recents protocols related to «Fertilization»

Example 2

A. Seed Treatment with Isolated Microbe

In this example, an isolated microbe from Tables 1-3 will be applied as a seed coating to seeds of corn (Zea mays). Upon applying the isolated microbe as a seed coating, the corn will be planted and cultivated in the standard manner.

A control plot of corn seeds, which did not have the isolated microbe applied as a seed coating, will also be planted.

It is expected that the corn plants grown from the seeds treated with the seed coating will exhibit a quantifiably higher biomass than the control corn plants.

The biomass from the treated plants may be about 1-10% higher, 10-20% higher, 20-30% higher, 30-40% higher, 40-50% higher, 50-60% higher, 60-70% higher, 70-80% higher, 80-90% higher, or more.

The biomass from the treated plants may equate to about a 1 bushel per acre increase over the controls, or a 2 bushel per acre increase, or a 3 bushel per acre increase, or a 4 bushel per acre increase, or a 5 bushel per acre increase, or more.

In some aspects, the biomass increase is statistically significant. In other aspects, the biomass increase is not statistically significant, but is still quantifiable.

B. Seed Treatment with Microbial Consortia

In this example, a microbial consortium, comprising at least two microbes from Tables 1-3 will be applied as a seed coating to seeds of corn (Zea mays). Upon applying the microbial consortium as a seed coating, the corn will be planted and cultivated in the standard manner.

A control plot of corn seeds, which did not have the microbial consortium applied as a seed coating, will also be planted.

It is expected that the corn plants grown from the seeds treated with the seed coating will exhibit a quantifiably higher biomass than the control corn plants.

The biomass from the treated plants may be about 1-10% higher, 10-20% higher, 20-30% higher, 30-40% higher, 40-50% higher, 50-60% higher, 60-70% higher, 70-80% higher, 80-90% higher, or more.

The biomass from the treated plants may equate to about a 1 bushel per acre increase over the controls, or a 2 bushel per acre increase, or a 3 bushel per acre increase, or a 4 bushel per acre increase, or a 5 bushel per acre increase, or more.

In some aspects, the biomass increase is statistically significant. In other aspects, the biomass increase is not statistically significant, but is still quantifiable.

C. Treatment with Agricultural Composition Comprising Isolated Microbe

In this example, an isolated microbe from Tables 1-3 will be applied as an agricultural composition, administered to the corn seed at the time of sowing.

For example, it is anticipated that a farmer will apply the agricultural composition to the corn seeds simultaneously upon planting the seeds into the field. This can be accomplished, for example, by applying the agricultural composition to a hopper/bulk tank on a standard 16 row planter, which contains the corn seeds and which is configured to plant the same into rows. Alternatively, the agricultural composition can be contained in a separate bulk tank on the planter and sprayed into the rows upon planting the corn seed.

A control plot of corn seeds, which are not administered the agricultural composition, will also be planted.

It is expected that the corn plants grown from the seeds treated with the agricultural composition will exhibit a quantifiably higher biomass than the control corn plants.

The biomass from the treated plants may be about 1-10% higher, 10-20% higher, 20-30% higher, 30-40% higher, 40-50% higher, 50-60% higher, 60-70% higher, 70-80% higher, 80-90% higher, or more.

The biomass from the treated plants may equate to about a 1 bushel per acre increase over the controls, or a 2 bushel per acre increase, or a 3 bushel per acre increase, or a 4 bushel per acre increase, or a 5 bushel per acre increase, or more.

In some aspects, the biomass increase is statistically significant. In other aspects, the biomass increase is not statistically significant, but is still quantifiable.

D. Treatment with Agricultural Composition Comprising Microbial Consortia

In this example, a microbial consortium, comprising at least two microbes from Tables 1-3 will be applied as an agricultural composition, administered to the corn seed at the time of sowing.

For example, it is anticipated that a farmer will apply the agricultural composition to the corn seeds simultaneously upon planting the seeds into the field. This can be accomplished, for example, by applying the agricultural composition to a hopper/bulk tank on a standard 16 row planter, which contains the corn seeds and which is configured to plant the same into rows. Alternatively, the agricultural composition can be contained in a separate bulk tank on the planter and sprayed into the rows upon planting the corn seed.

A control plot of corn seeds, which are not administered the agricultural composition, will also be planted.

It is expected that the corn plants grown from the seeds treated with the agricultural composition will exhibit a quantifiably higher biomass than the control corn plants.

The biomass from the treated plants may be about 1-10% higher, 10-20% higher, 20-30% higher, 30-40% higher, 40-50% higher, 50-60% higher, 60-70% higher, 70-80% higher, 80-90% higher, or more.

The biomass from the treated plants may equate to about a 1 bushel per acre increase over the controls, or a 2 bushel per acre increase, or a 3 bushel per acre increase, or a 4 bushel per acre increase, or a 5 bushel per acre increase, or more.

In some aspects, the biomass increase is statistically significant. In other aspects, the biomass increase is not statistically significant, but is still quantifiable.

A. Seed Treatment with Isolated Microbe

In this example, an isolated microbe from Tables 1-3 will be applied as a seed coating to seeds of corn (Zea mays). Upon applying the isolated microbe as a seed coating, the corn will be planted and cultivated in the standard manner.

A control plot of corn seeds, which did not have the isolated microbe applied as a seed coating, will also be planted.

It is expected that the corn plants grown from the seeds treated with the seed coating will exhibit a quantifiable and superior ability to tolerate drought conditions and/or exhibit superior water use efficiency, as compared to the control corn plants.

The drought tolerance and/or water use efficiency can be based on any number of standard tests from the art, e.g leaf water retention, turgor loss point, rate of photosynthesis, leaf color and other phenotypic indications of drought stress, yield performance, and various root morphological and growth patterns.

B. Seed Treatment with Microbial Consortia

In this example, a microbial consortium, comprising at least two microbes from Tables 1-3 will be applied as a seed coating to seeds of corn (Zea mays). Upon applying the microbial consortium as a seed coating, the corn will be planted and cultivated in the standard manner.

A control plot of corn seeds, which did not have the microbial consortium applied as a seed coating, will also be planted.

It is expected that the corn plants grown from the seeds treated with the seed coating will exhibit a quantifiable and superior ability to tolerate drought conditions and/or exhibit superior water use efficiency, as compared to the control corn plants.

The drought tolerance and/or water use efficiency can be based on any number of standard tests from the art, e.g leaf water retention, turgor loss point, rate of photosynthesis, leaf color and other phenotypic indications of drought stress, yield performance, and various root morphological and growth patterns.

C. Treatment with Agricultural Composition Comprising Isolated Microbe

In this example, an isolated microbe from Tables 1-3 will be applied as an agricultural composition, administered to the corn seed at the time of sowing.

For example, it is anticipated that a farmer will apply the agricultural composition to the corn seeds simultaneously upon planting the seeds into the field. This can be accomplished, for example, by applying the agricultural composition to a hopper/bulk tank on a standard 16 row planter, which contains the corn seeds and which is configured to plant the same into rows. Alternatively, the agricultural composition can be contained in a separate bulk tank on the planter and sprayed into the rows upon planting the corn seed.

A control plot of corn seeds, which are not administered the agricultural composition, will also be planted.

It is expected that the corn plants grown from the seeds treated with the with the agricultural composition will exhibit a quantifiable and superior ability to tolerate drought conditions and/or exhibit superior water use efficiency, as compared to the control corn plants.

The drought tolerance and/or water use efficiency can be based on any number of standard tests from the art, e.g leaf water retention, turgor loss point, rate of photosynthesis, leaf color and other phenotypic indications of drought stress, yield performance, and various root morphological and growth patterns.

D. Treatment with Agricultural Composition Comprising Microbial Consortia

In this example, a microbial consortium, comprising at least two microbes from Tables 1-3 will be applied as an agricultural composition, administered to the corn seed at the time of sowing.

For example, it is anticipated that a farmer will apply the agricultural composition to the corn seeds simultaneously upon planting the seeds into the field. This can be accomplished, for example, by applying the agricultural composition to a hopper/bulk tank on a standard 16 row planter, which contains the corn seeds and which is configured to plant the same into rows. Alternatively, the agricultural composition can be contained in a separate bulk tank on the planter and sprayed into the rows upon planting the corn seed.

A control plot of corn seeds, which are not administered the agricultural composition, will also be planted.

It is expected that the corn plants grown from the seeds treated with the with the agricultural composition will exhibit a quantifiable and superior ability to tolerate drought conditions and/or exhibit superior water use efficiency, as compared to the control corn plants.

The drought tolerance and/or water use efficiency can be based on any number of standard tests from the art, e.g leaf water retention, turgor loss point, rate of photosynthesis, leaf color and other phenotypic indications of drought stress, yield performance, and various root morphological and growth patterns.

A. Seed Treatment with Isolated Microbe

In this example, an isolated microbe from Tables 1-3 will be applied as a seed coating to seeds of corn (Zea mays). Upon applying the isolated microbe as a seed coating, the corn will be planted and cultivated in the standard manner.

A control plot of corn seeds, which did not have the isolated microbe applied as a seed coating, will also be planted.

It is expected that the corn plants grown from the seeds treated with the seed coating will exhibit a quantifiable and superior ability to utilize nitrogen, as compared to the control corn plants.

The nitrogen use efficiency can be quantified by recording a measurable change in any of the main nitrogen metabolic pool sizes in the assimilation pathways (e.g., a measurable change in one or more of the following: nitrate, nitrite, ammonia, glutamic acid, aspartic acid, glutamine, asparagine, lysine, leucine, threonine, methionine, glycine, tryptophan, tyrosine, total protein content of a plant part, total nitrogen content of a plant part, and/or chlorophyll content), or where the treated plant is shown to provide the same or elevated biomass or harvestable yield at lower nitrogen fertilization levels compared to the control plant, or where the treated plant is shown to provide elevated biomass or harvestable yields at the same nitrogen fertilization levels compared to a control plant.

B. Seed Treatment with Microbial Consortia

In this example, a microbial consortium, comprising at least two microbes from Tables 1-3 will be applied as a seed coating to seeds of corn (Zea mays). Upon applying the microbial consortium as a seed coating, the corn will be planted and cultivated in the standard manner.

A control plot of corn seeds, which did not have the microbial consortium applied as a seed coating, will also be planted.

It is expected that the corn plants grown from the seeds treated with the seed coating will exhibit a quantifiable and superior ability to utilize nitrogen, as compared to the control corn plants.

The nitrogen use efficiency can be quantified by recording a measurable change in any of the main nitrogen metabolic pool sizes in the assimilation pathways (e.g., a measurable change in one or more of the following: nitrate, nitrite, ammonia, glutamic acid, aspartic acid, glutamine, asparagine, lysine, leucine, threonine, methionine, glycine, tryptophan, tyrosine, total protein content of a plant part, total nitrogen content of a plant part, and/or chlorophyll content), or where the treated plant is shown to provide the same or elevated biomass or harvestable yield at lower nitrogen fertilization levels compared to the control plant, or where the treated plant is shown to provide elevated biomass or harvestable yields at the same nitrogen fertilization levels compared to a control plant.

C. Treatment with Agricultural Composition Comprising Isolated Microbe

In this example, an isolated microbe from Tables 1-3 will be applied as an agricultural composition, administered to the corn seed at the time of sowing.

For example, it is anticipated that a farmer will apply the agricultural composition to the corn seeds simultaneously upon planting the seeds into the field. This can be accomplished, for example, by applying the agricultural composition to a hopper/bulk tank on a standard 16 row planter, which contains the corn seeds and which is configured to plant the same into rows. Alternatively, the agricultural composition can be contained in a separate bulk tank on the planter and sprayed into the rows upon planting the corn seed.

A control plot of corn seeds, which are not administered the agricultural composition, will also be planted.

It is expected that the corn plants grown from the seeds treated with the agricultural composition will exhibit a quantifiable and superior ability to utilize nitrogen, as compared to the control corn plants.

The nitrogen use efficiency can be quantified by recording a measurable change in any of the main nitrogen metabolic pool sizes in the assimilation pathways (e.g., a measurable change in one or more of the following: nitrate, nitrite, ammonia, glutamic acid, aspartic acid, glutamine, asparagine, lysine, leucine, threonine, methionine, glycine, tryptophan, tyrosine, total protein content of a plant part, total nitrogen content of a plant part, and/or chlorophyll content), or where the treated plant is shown to provide the same or elevated biomass or harvestable yield at lower nitrogen fertilization levels compared to the control plant, or where the treated plant is shown to provide elevated biomass or harvestable yields at the same nitrogen fertilization levels compared to a control plant.

D. Treatment with Agricultural Composition Comprising Microbial Consortia

In this example, a microbial consortium, comprising at least two microbes from Tables 1-3 will be applied as an agricultural composition, administered to the corn seed at the time of sowing.

For example, it is anticipated that a farmer will apply the agricultural composition to the corn seeds simultaneously upon planting the seeds into the field. This can be accomplished, for example, by applying the agricultural composition to a hopper/bulk tank on a standard 16 row planter, which contains the corn seeds and which is configured to plant the same into rows. Alternatively, the agricultural composition can be contained in a separate bulk tank on the planter and sprayed into the rows upon planting the corn seed.

A control plot of corn seeds, which are not administered the agricultural composition, will also be planted.

It is expected that the corn plants grown from the seeds treated with the agricultural composition will exhibit a quantifiable and superior ability to utilize nitrogen, as compared to the control corn plants.

The nitrogen use efficiency can be quantified by recording a measurable change in any of the main nitrogen metabolic pool sizes in the assimilation pathways (e.g., a measurable change in one or more of the following: nitrate, nitrite, ammonia, glutamic acid, aspartic acid, glutamine, asparagine, lysine, leucine, threonine, methionine, glycine, tryptophan, tyrosine, total protein content of a plant part, total nitrogen content of a plant part, and/or chlorophyll content), or where the treated plant is shown to provide the same or elevated biomass or harvestable yield at lower nitrogen fertilization levels compared to the control plant, or where the treated plant is shown to provide elevated biomass or harvestable yields at the same nitrogen fertilization levels compared to a control plant.

The inoculants were prepared from isolates grown as spread plates on R2A incubated at 25° C. for 48 to 72 hours. Colonies were harvested by blending with sterile distilled water (SDW) which was then transferred into sterile containers. Serial dilutions of the harvested cells were plated and incubated at 25° C. for 24 hours to estimate the number of colony forming units (CFU) in each suspension. Dilutions were prepared using individual isolates or blends of isolates (consortia) to deliver 1×105 cfu/microbe/seed and seeds inoculated by either imbibition in the liquid suspension or by overtreatment with 5% vegetable gum and oil.

Seeds corresponding to the plants of table 15 were planted within 24 to 48 hours of treatment in agricultural soil, potting media or inert growing media. Plants were grown in small pots (28 mL to 200 mL) in either a controlled environment or in a greenhouse. Chamber photoperiod was set to 16 hours for all experiments on all species. Air temperature was typically maintained between 22-24° C.

Unless otherwise stated, all plants were watered with tap water 2 to 3 times weekly. Growth conditions were varied according to the trait of interest and included manipulation of applied fertilizer, watering regime and salt stress as follows:

    • Low N—seeds planted in soil potting media or inert growing media with no applied N fertilizer
    • Moderate N—seeds planted in soil or growing media supplemented with commercial N fertilizer to equivalent of 135 kg/ha applied N
    • Insol P—seeds planted in potting media or inert growth substrate and watered with quarter strength Pikovskaya's liquid medium containing tri-calcium phosphate as the only form phosphate fertilizer.
    • Cold Stress—seeds planted in soil, potting media or inert growing media and incubated at 10° C. for one week before being transferred to the plant growth room.
    • Salt stress—seeds planted in soil, potting media or inert growing media and watered with a solution containing between 100 to 200 mg/L NaCl.

Untreated (no applied microbe) controls were prepared for each experiment. Plants were randomized on trays throughout the growth environment. Between 10 and 30 replicate plants were prepared for each treatment in each experiment. Phenotypes were measured during early vegetative growth, typically before the V3 developmental stage and between 3 and 6 weeks after sowing. Foliage was cut and weighed. Roots were washed, blotted dry and weighed. Results indicate performance of treatments against the untreated control.

TABLE 15
StrainShootRoot
Microbe sp.IDCropAssayIOC (%)IOC (%)
Bosea thiooxidans123EfficacyEfficacy
overall100%100%
Bosea thiooxidans54522WheatEarly vigor - insol P30-40 
Bosea thiooxidans54522RyegrassEarly vigor50-60 50-60 
Bosea thiooxidans54522RyegrassEarly vigor - moderate P0-100-10
Duganella violaceinigra111EfficacyEfficacy
overall100%100%
Duganella violaceinigra66361TomatoEarly vigor0-100-10
Duganella violaceinigra66361TomatoEarly vigor30-40 40-50 
Duganella violaceinigra66361TomatoEarly vigor20-30 20-30 
Herbaspirillum huttiense222Efficacy
overall100%
Herbaspirillum huttiense54487WheatEarly vigor - insol P30-40 
Herbaspirillum huttiense60507MaizeEarly vigor - salt stress0-100-10
Janthinobacterium sp.222Efficacy
Overall100%
Janthinobacterium sp.54456WheatEarly vigor - insol P30-40 
Janthinobacterium sp.54456WheatEarly vigor - insol P0-10
Janthinobacterium sp.63491RyegrassEarly vigor - drought0-100-10
stress
Massilia niastensis112EfficacyEfficacy
overall80%80%
Massilia niastensis55184WheatEarly vigor - salt stress0-1020-30 
Massilia niastensis55184WinterEarly vigor - cold stress0-1010-20 
wheat
Massilia niastensis55184WinterEarly vigor - cold stress20-30 20-30 
wheat
Massilia niastensis55184WinterEarly vigor - cold stress10-20 10-20 
wheat
Massilia niastensis55184WinterEarly vigor - cold stress<0<0
wheat
Novosphingobium rosa211EfficacyEfficacy
overall100%100%
Novosphingobium rosa65589MaizeEarly vigor - cold stress0-100-10
Novosphingobium rosa65619MaizeEarly vigor - cold stress0-100-10
Paenibacillus amylolyticus111EfficacyEfficacy
overall100%100%
Paenibacillus amylolyticus66316TomatoEarly vigor0-100-10
Paenibacillus amylolyticus66316TomatoEarly vigor10-20 10-20 
Paenibacillus amylolyticus66316TomatoEarly vigor0-100-10
Pantoea agglomerans323EfficacyEfficacy
33%50%
Pantoea agglomerans54499WheatEarly vigor - insol P40-50 
Pantoea agglomerans57547MaizeEarly vigor - low N<00-10
Pantoea vagans55529MaizeEarly vigor<0<0
(formerly P. agglomerans)
Polaromonas ginsengisoli111EfficacyEfficacy
66%100%
Polaromonas ginsengisoli66373TomatoEarly vigor0-100-10
Polaromonas ginsengisoli66373TomatoEarly vigor20-30 30-40 
Polaromonas ginsengisoli66373TomatoEarly vigor<010-20 
Pseudomonas fluorescens122Efficacy
100%
Pseudomonas fluorescens54480WheatEarly vigor - insol P>100 
Pseudomonas fluorescens56530MaizeEarly vigor - moderate N0-10
Rahnella aquatilis334EfficacyEfficacy
80%63%
Rahnella aquatilis56532MaizeEarly vigor - moderate N10-20 
Rahnella aquatilis56532MaizeEarly vigor - moderate N0-100-10
Rahnella aquatilis56532WheatEarly vigor - cold stress0-1010-20 
Rahnella aquatilis56532WheatEarly vigor - cold stress<00-10
Rahnella aquatilis56532WheatEarly vigor - cold stress10-20 <0
Rahnella aquatilis57157RyegrassEarly vigor<0
Rahnella aquatilis57157MaizeEarly vigor - low N0-100-10
Rahnella aquatilis57157MaizeEarly vigor - low N0-10<0
Rahnella aquatilis58013MaizeEarly vigor0-1010-20 
Rahnella aquatilis58013MaizeEarly vigor - low N0-10<0
Rhodococcus erythropolis313Efficacy
66%
Rhodococcus erythropolis54093MaizeEarly vigor - low N40-50 
Rhodococcus erythropolis54299MaizeEarly vigor - insol P>100 
Rhodococcus erythropolis54299MaizeEarly vigor<0<0
Stenotrophomonas chelatiphaga611EfficacyEfficacy
60%60%
Stenotrophomonas chelatiphaga54952MaizeEarly vigor0-100-10
Stenotrophomonas chelatiphaga47207MaizeEarly vigor<0 0
Stenotrophomonas chelatiphaga64212MaizeEarly vigor0-1010-20 
Stenotrophomonas chelatiphaga64208MaizeEarly vigor0-100-10
Stenotrophomonas chelatiphaga58264MaizeEarly vigor<0<0
Stenotrophomonas maltophilia612EfficacyEfficacy
43%66%
Stenotrophomonas maltophilia54073MaizeEarly vigor - low N50-60 
Stenotrophomonas maltophilia54073MaizeEarly vigor<00-10
Stenotrophomonas maltophilia56181MaizeEarly vigor0-10<0
Stenotrophomonas maltophilia54999MaizeEarly vigor0-100-10
Stenotrophomonas maltophilia54850MaizeEarly vigor 00-10
Stenotrophomonas maltophilia54841MaizeEarly vigor<00-10
Stenotrophomonas maltophilia46856MaizeEarly vigor<0<0
Stenotrophomonas rhizophila811EfficacyEfficacy
12.5%37.5%
Stenotrophomonas rhizophila50839MaizeEarly vigor<0<0
Stenotrophomonas rhizophila48183MaizeEarly vigor<0<0
Stenotrophomonas rhizophila45125MaizeEarly vigor<0<0
Stenotrophomonas rhizophila46120MaizeEarly vigor<00-10
Stenotrophomonas rhizophila46012MaizeEarly vigor<0<0
Stenotrophomonas rhizophila51718MaizeEarly vigor0-100-10
Stenotrophomonas rhizophila66478MaizeEarly vigor<0<0
Stenotrophomonas rhizophila65303MaizeEarly vigor<00-10
Stenotrophomonas terrae221EfficacyEfficacy
50%50%
Stenotrophomonas terrae68741MaizeEarly vigor<0<0
Stenotrophomonas terrae68599MaizeEarly vigor<00-10
Stenotrophomonas terrae68599Capsicum *Early vigor20-30 20-30 
Stenotrophomonas terrae68741Capsicum *Early vigor10-20 20-30 

The data presented in table 15 describes the efficacy with which a microbial species or strain can change a phenotype of interest relative to a control run in the same experiment. Phenotypes measured were shoot fresh weight and root fresh weight for plants growing either in the absence of presence of a stress (assay). For each microbe species, an overall efficacy score indicates the percentage of times a strain of that species increased a both shoot and root fresh weight in independent evaluations. For each species, the specifics of each independent assay is given, providing a strain ID (strain) and the crop species the assay was performed on (crop). For each independent assay the percentage increase in shoot and root fresh weight over the controls is given.

Full text: Click here
Patent 2024
Ammonia Asparagine Aspartic Acid Biological Assay Bosea thiooxidans Calcium Phosphates Capsicum Cells Chlorophyll Cold Shock Stress Cold Temperature Crop, Avian Dietary Fiber DNA Replication Droughts Drought Tolerance Embryophyta Environment, Controlled Farmers Fertilization Glutamic Acid Glutamine Glycine Growth Disorders Herbaspirillum Herbaspirillum huttiense Leucine Lolium Lycopersicon esculentum Lysine Maize Massilia niastensis Methionine Microbial Consortia Nitrates Nitrites Nitrogen Novosphingobium rosa Paenibacillus Paenibacillus amylolyticus Pantoea agglomerans Pantoea vagans Phenotype Phosphates Photosynthesis Plant Development Plant Embryos Plant Leaves Plant Proteins Plant Roots Plants Polaromonas ginsengisoli Pseudoduganella violaceinigra Pseudomonas Pseudomonas fluorescens Rahnella Rahnella aquatilis Retention (Psychology) Rhodococcus erythropolis Rosa Salt Stress Sodium Chloride Sodium Chloride, Dietary Stenotrophomonas chelatiphaga Stenotrophomonas maltophilia Stenotrophomonas rhizophila Stenotrophomonas terrae Sterility, Reproductive Strains Technique, Dilution Threonine Triticum aestivum Tryptophan Tyrosine Vegetables Zea mays
Not available on PMC !

Example 3

Two samples of catalysts have been prepared, one by co-precipitation (CP) and the other one by deposition impregnation (DI). H2-TPD was performed at 5.0 MPa (FIG. 6) resulting in a temperature of around 313 K for the material prepared by DI versus 293 K for the material prepared by CP.

Full text: Click here
Patent 2024
Fertilization
Not available on PMC !

Example 24

The catalyst included 1 wt % of Pt and 3 wt % of Sn supported on CeO2, based on the weight of the CeO2. The CeO2 support was made by calcining cerium (III) nitrate hexahydrate (Sigma-Aldrich 202991). The catalyst was made by incipient wetness impregnation of 3 g of CeO2 with 0.788 g of 8 wt % chloroplatinic acid in water (Sigma Aldrich, 262587) and 0.266 g of tin (IV) chloride pentahydrate (Acros Organics 22369), followed by drying and calcination at 800° C. for 12 h.

The data in Table 9 shows that catalyst 2 was stable over 42 cycles.

TABLE 9
Ex. 24
Catalyst2
Mcat (g)0.5
Trxn (° C.)540
trxn (min)10
Frxn (sccm)12.3
Svol (vol %)NA
Tred (° C.)NA
tred (min)NA
Tregen (° C.)540
tregen (min)10
Cycles42
First cycleYave15
Save84.3
Last cycleYave14.8
Save89.7

Full text: Click here
Patent 2024
Cerium Chlorides chloroplatinic acid Fertilization Nitrates

Example 4

A conductive composite fiber bundle was prepared whose central portion was coated with PDMS in the same manner as Example 4-4. However, the aforementioned conductive composite fiber bundle was impregnated with glycerol before being coated with the PDMS. Upon measuring drug delivery speed in the same manner as Example 4-4 using this conductive composite fiber bundle, the concentration of the Lucifer yellow in the dish increased at a rate of 6.7 μM/day (in FIG. 36, the ▪ plot and the solid line). From this result, it is shown that drug delivery speed is increased by adding glycerol to the conductive composite fibers.

As one reason for the improvement in drug delivery speed due to impregnation of conductive composite fibers with glycerol, it would seem that when the conductive composite fibers are coated with PDMS, the glycerol prevents the PDMS from penetrating (infiltrating) to the interior of the conductive composite fiber bundle, and the condition of the flow path constituted by the conductive composite fiber bundle is maintained in a condition suited to drug transport.

Full text: Click here
Patent 2024
Drug Delivery Systems Electric Conductivity Fertilization Fibrosis Glycerin Hyperostosis, Diffuse Idiopathic Skeletal lucifer yellow Pharmaceutical Preparations
Embryos were obtained by natural mating and cultured in embryo medium. The staging of embryos was carried out according to Kimmel et al [88 (link)]. SMARCE1-specific morpholino oligonucleotides (5′ - CGCTTTGACATCTTGATTGTAGGGT - 3′) were obtained from Gene Tools (Philomath, OR, USA). Morpholinos were injected at a concentration of 0.5 ng. The injection dose was an estimated amount received by a single embryo. At different post-fertilization stages, the wild-type (WT) and morpholino (MO) embryo groups were imaged using a microscope (Nikon SMZ18, Japan), including chromatophores in the eyes, dorsal, and ventral. We compared the chromatophore density of these three parts between two groups at the same stage and in the same field of view based on microscopy imaging.
Full text: Click here
Publication 2023
Chromatophore Culture Media Embryo Eye Fertilization Genes Microscopy Morpholinos SMARCE1 protein, human

Top products related to «Fertilization»

Sourced in United States
The FD Rapid GolgiStain Kit is a laboratory tool designed for the rapid and efficient staining of neuronal morphology in biological samples. It utilizes a modified Golgi staining technique to selectively visualize the intricate structures of individual neurons within a given tissue.
Sourced in United States, Germany, United Kingdom, China, France, Switzerland, Italy, Macao, Japan
Tricaine is a laboratory equipment product manufactured by Merck Group. It is a chemical compound commonly used as an anesthetic for fish and amphibians in research and aquaculture settings. Tricaine functions by inhibiting sodium ion channels, resulting in a reversible state of unconsciousness in the organism.
Sourced in United States, Germany, Spain, China, United Kingdom, Sao Tome and Principe, France, Denmark, Italy, Canada, Japan, Macao, Belgium, Switzerland, Sweden, Australia
MS-222 is a chemical compound commonly used as a fish anesthetic in research and aquaculture settings. It is a white, crystalline powder that can be dissolved in water to create a sedative solution for fish. The primary function of MS-222 is to temporarily immobilize fish, allowing for safe handling, examination, or other procedures to be performed. This product is widely used in the scientific community to facilitate the study and care of various fish species.
Sourced in United States, Germany, Switzerland, Sao Tome and Principe
1-phenyl-2-thiourea (PTU) is a chemical compound used in laboratory settings. It serves as a core functional component in various research and analytical applications. The product specifications and technical details are available upon request.
Sourced in United States, Germany, Switzerland, United Kingdom, Australia
1-phenyl-2-thiourea is a chemical compound used as a laboratory reagent. It is a crystalline solid with a melting point of approximately 176°C. The compound is soluble in various organic solvents. No further details about its core function or intended use are provided.
Sourced in United States, China, Japan, Germany, United Kingdom, Canada, France, Italy, Australia, Spain, Switzerland, Netherlands, Belgium, Lithuania, Denmark, Singapore, New Zealand, India, Brazil, Argentina, Sweden, Norway, Austria, Poland, Finland, Israel, Hong Kong, Cameroon, Sao Tome and Principe, Macao, Taiwan, Province of China, Thailand
TRIzol reagent is a monophasic solution of phenol, guanidine isothiocyanate, and other proprietary components designed for the isolation of total RNA, DNA, and proteins from a variety of biological samples. The reagent maintains the integrity of the RNA while disrupting cells and dissolving cell components.
Sourced in Switzerland, Germany, Italy, France, United States, Spain, Netherlands, United Kingdom, Australia, Japan, Denmark, Brazil, China
Gonal-F is a recombinant human follicle-stimulating hormone (r-hFSH) produced by recombinant DNA technology. It is used as a fertility medication to stimulate follicular development and maturation in the ovary as part of an assisted reproductive technology (ART) program.
Sourced in United States, Germany, United Kingdom, China, Italy, Japan, France, Sao Tome and Principe, Canada, Macao, Spain, Switzerland, Australia, India, Israel, Belgium, Poland, Sweden, Denmark, Ireland, Hungary, Netherlands, Czechia, Brazil, Austria, Singapore, Portugal, Panama, Chile, Senegal, Morocco, Slovenia, New Zealand, Finland, Thailand, Uruguay, Argentina, Saudi Arabia, Romania, Greece, Mexico
Bovine serum albumin (BSA) is a common laboratory reagent derived from bovine blood plasma. It is a protein that serves as a stabilizer and blocking agent in various biochemical and immunological applications. BSA is widely used to maintain the activity and solubility of enzymes, proteins, and other biomolecules in experimental settings.
Sourced in United States, Germany, United Kingdom, China, Italy, Sao Tome and Principe, France, Macao, India, Canada, Switzerland, Japan, Australia, Spain, Poland, Belgium, Brazil, Czechia, Portugal, Austria, Denmark, Israel, Sweden, Ireland, Hungary, Mexico, Netherlands, Singapore, Indonesia, Slovakia, Cameroon, Norway, Thailand, Chile, Finland, Malaysia, Latvia, New Zealand, Hong Kong, Pakistan, Uruguay, Bangladesh
DMSO is a versatile organic solvent commonly used in laboratory settings. It has a high boiling point, low viscosity, and the ability to dissolve a wide range of polar and non-polar compounds. DMSO's core function is as a solvent, allowing for the effective dissolution and handling of various chemical substances during research and experimentation.
Sourced in United States, Germany, China, Japan, United Kingdom, Canada, France, Italy, Australia, Spain, Switzerland, Belgium, Denmark, Netherlands, India, Ireland, Lithuania, Singapore, Sweden, Norway, Austria, Brazil, Argentina, Hungary, Sao Tome and Principe, New Zealand, Hong Kong, Cameroon, Philippines
TRIzol is a monophasic solution of phenol and guanidine isothiocyanate that is used for the isolation of total RNA from various biological samples. It is a reagent designed to facilitate the disruption of cells and the subsequent isolation of RNA.

More about "Fertilization"

Fertilization is the fundamental biological process where a sperm cell (male gamete) fuses with an oocyte (female gamete) to form a zygote, initiating the development of a new individual organism.
This complex process involves the intricate interaction of various hormones, chemical signals, and cellular mechanisms to ensure the successful union of the male and female reproductive cells.
Effective fertilization research is crucial for advancing our understanding of human and animal reproduction, as well as for developing assisted reproductive technologies (ART) such as in vitro fertilization (IVF) and artificial insemination.
Optimizing fertilization protocols through AI-driven comparisons can help researchers achieve greater reproducibility and accuracy in their studies, unlocking new insights and driving progress in this vital field of study.
The FD Rapid GolgiStain Kit, Tricaine (MS-222), 1-phenyl-2-thiourea (PTU), TRIzol reagent, Gonal-F, Bovine serum albumin (BSA), and DMSO are some of the important tools and reagents used in fertilization research and related fields.
These materials play crucial roles in various aspects of the fertilization process, such as staining, anesthesia, inhibition of pigment formation, RNA extraction, hormone stimulation, protein stabilization, and cryopreservation.
By leveraging the power of artificial intelligence (AI) and data-driven comparisons, researchers can identify the most effective fertilization protocols from the available literature, preprints, and patents, leading to improved reproducibility, accuracy, and ultimately, advancements in the understanding and optimization of this fundamental biological process.