Log In Sign up
The largest database of trusted experimental protocols
> Procedures > Laboratory Procedure > Electrophoresis

Electrophoresis

Electrophoresis is a powerful analytical technique used to separate and analyze complex mixtures of biomolecules, such as proteins, nucleic acids, and other charged particles.
It exploits the differential migration of these molecules through a porous medium under the influence of an applied electric field.
This process allows for the high-resolution separation and identification of specific components within a sample, enabling researchers to gain valuable insights into cellular processes, disease mechanisms, and molecular interactions.
Electrophoresis is widely employed in fields like biochemistry, molecular biology, and clinical diagnostics, contributing to advancements in areas like proteomics, genomics, and biomarker discovery.
By leveraging the power of this versatile technique, researchers can enhance the accuracy and depth of their electrophoresis-based investigations, leading to more informed decisions and impactful findings.

Most cited protocols related to «Electrophoresis»

1
Efficient Electroporation and Cryopreservation of Mouse ES Cells
The final targeting constructs were prepared for ES cell electroporation from 2 ml of culture (2X LB plus antibiotics) in 96-well format using the Qiagen Turboprep kit. Before electroporation, vectors were linearized with AsiSI and examined by gel electrophoresis. For most clones, the digested DNA migrated as a single high-molecular-mass band of the expected size (Supplementary Fig. 5). Occasionally, contaminating smaller molecular mass bands were also observed on the gel (DNA quality failures).
JM8 mouse ES cell lines derived from the C57BL/6N strain were grown either on a feeder layer of SNL6/7 fibroblasts (neomycin and/or puromycin resistant) or on gelatinized tissue culture plates16 (link). Both feeder-independent and feeder-dependent lines were maintained in Knockout DMEM (500 ml, Gibco) supplemented with 2 mM glutamine, 5 ml 100× β-mercaptoethanol (360 μl in 500 ml PBS, filter sterilized), 10–15% fetal calf serum respectively (Invitrogen) and 500 U ml−1 leukaemia-inhibitory factor (ESGRO, Millipore). Trypsin solution was prepared by adding 20 ml of 2.5% trypsin solution (Gibco) and 5 ml chicken serum (Gibco) to 500 ml filter-sterilized PBS containing 0.1 g EDTA (Sigma) and 0.5 g d-glucose (Sigma).
Electroporations of ES cells were carried out in a 25-well cuvette using the ECM 630 96-well electroporator /HT-200 automatic plate handler (BTX Harvard Apparatus; set at 700 V, 400 Ω, 25 μF). Immediately before electroporation, cell suspensions of ~1 × 107 cells and ~2 μg of linearized targeting vector DNA were mixed in a final volume of 120 μl PBS. Cells were seeded onto a 10-cm dish (with feeders or gelatin) and colonies were picked after 10 d of selection in 100 μg (active) per ml Geneticin (Invitrogen). To expand cells into duplicate wells for archiving and preparation of genomic DNA, confluent cultures of JM8 ES cells grown on feeder cells were washed twice with pre-warmed PBS and trypsinized for 15 min at 37 °C. Five volumes of pre-warmed media were added and the cells were gently dispersed by tituration and passed at a dilution of 1:4 into new plates containing feeder cells. Passage of cells grown on gelatinized plates was carried out in a similar manner except that the cells were trypsinized for 10 min and passed at a dilution of 1:6 into freshly gelatin-coated plates (0.1% gelatin, Sigma G1393). Culture medium was replaced daily and cells reached confluence 2 days after passage. To archive ES cell clones, trypsinized cells from confluent 96-well plates were transferred in 200 μl freezing medium (Knockout DMEM, 15% serum/ 10% DMSO) to 96-well cryovials (Matrix) and overlayed with sterile mineral oil. The cells were placed at −80 °C overnight and then transferred to liquid nitrogen.
Skarnes W.C., Rosen B., West A.P., Koutsourakis M., Bushell W., Iyer V., Mujica A.O., Thomas M., Harrow J., Cox T., Jackson D., Severin J., Biggs P., Fu J., Nefedov M., de Jong P.J., Stewart A.F, & Bradley A. (2011). A conditional knockout resource for the genome–wide study of mouse gene function. Nature, 474(7351), 337-342.
Publication 2011
2-Mercaptoethanol Antibiotics Cells Chickens Clone Cells Cloning Vectors Edetic Acid Electrophoresis Electroporation Embryonic Stem Cells Feeder Cell Layers Feeder Cells Fetal Bovine Serum Fibroblasts Gelatins Geneticin Genome Glucose Glutamine Hyperostosis, Diffuse Idiopathic Skeletal LIF protein, human Mus Neomycin Nitrogen Oil, Mineral PRSS2 protein, human Puromycin Serum Sterility, Reproductive Strains Sulfoxide, Dimethyl Technique, Dilution Tissues Trypsin
2
Genotyping-by-Sequencing Protocol with Barcoded Adapters
A basic schematic of the protocol used for performing GBS is shown in Figure 2. Oligonucleotides comprising the top and bottom strands of each barcode adapter and a common adapter were diluted (separately) in TE (50 µM each) and annealed in a thermocycler (95°C, 2 min; ramp down to 25°C by 0.1°C/s; 25°C, 30 min; 4°C hold). Barcode and common adapters were then quantified using an intercalating dye (PicoGreen®; Invitrogen, Carlsbad, CA), diluted in water to 0.6 ng/µL (∼02 pmol/µL), mixed together in a 1∶1 ratio, and 6 µL (∼0.06 pmol each adapter) of the mix was aliquoted into a 96-well PCR plate and dried down. DNA samples (100 ng in a volume of 10 µL) were added to individual adapter-containing wells and plates were, again, dried.
Samples (DNA plus adapters) were digested for 2 h at 75°C with ApeKI (New England Biolabs, Ipswitch, MA) in 20 µL volumes containing 1× NEB Buffer 3 and 3.6 U ApeKI. Adapters were then ligated to sticky ends by adding 30 µL of a solution containing 1.66× ligase buffer with ATP and T4 ligase (640 cohesive end units) (New England Biolabs) to each well. Samples were incubated at 22°C for 1 h and heated to 65°C for 30 min to inactivate the T4 ligase. Sets of 48 or 96 digested DNA samples, each with a different barcode adapter, were combined (5 µL each) and purified using a commercial kit (QIAquick PCR Purification Kit; Qiagen, Valencia, CA) according to the manufacturer's instructions. DNA samples were eluted in a final volume of 50 µL. Restriction fragments from each library were then amplified in 50 µL volumes containing 2 µL pooled DNA fragments, 1× Taq Master Mix (New England Biolabs), and 25 pmol, each, of the following primers: (A) 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT and (B) 5′-CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT. These primers contained complementary sequences for amplifying restriction fragments with ligated adapters, binding PCR products to oligonucleotides that coat the Illumina sequencing flow cell and priming subsequent DNA sequencing reactions [26] (link) (Figure 1).
Temperature cycling consisted of 72°C for 5 min, 98°C for 30 s followed by 18 cycles of 98°C for 30 s, 65°C for 30 s, 72°C for 30 s with a final Taq extension step at 72°C for 5 min. These amplified sample pools constitute a sequencing “library.” Libraries were purified as above (except that the final elution volume is 30 µL) and 1 µL was loaded onto an Experion® automated electrophoresis station (BioRad, Hercules, CA) for evaluation of fragment sizes. Libraries were considered suitable for sequencing if adapter dimers (∼128 bp in length) were minimal or absent and the majority of other DNA fragments were between 170–350 bp. If adapter dimers were present in excess of 0.5% (based on the Experion® output), libraries were constructed again using a few DNA samples and decreasing adapter amounts. Guidelines for adapting the protocol to different species including details for performing adapter titrations and are provided in Supporting Information (Text S1, Figure S1 and Figure S2).
Once the appropriate quantity of adapters was empirically determined for a particular enzyme/species combination, no further adapter titration was necessary. Single-end sequencing (86 bp reads) of one 48- or 96-plex library per flowcell channel, was performed on a Genome Analyzer II (Illumina, Inc., San Diego, CA). See Bentley et al. [26] (link) for details of the sequencing process and chemistry.
Elshire R.J., Glaubitz J.C., Sun Q., Poland J.A., Kawamoto K., Buckler E.S, & Mitchell S.E. (2011). A Robust, Simple Genotyping-by-Sequencing (GBS) Approach for High Diversity Species. PLoS ONE, 6(5), e19379.
Full text: Click here
Publication 2011
Buffers Cells DNA Library Electrophoresis Enzymes Genome Ligase Oligonucleotide Primers Oligonucleotides PicoGreen Titrimetry
3
Identification of Housekeeping Genes
Microarray expression data of 13,629 publicly available samples hybridized to Affymetrix HG-U133A and HG-U133 Plus 2.0 GeneChips (Affymetrix, Santa Clara, Ca.) were downloaded from the Gene Expression Omnibus.[14] (link) This set of samples comprises gene expression data of a wide variety of different tissues (e.g. primary patient material, cell lines, diseased as well as normal tissues, stem cells etc.) and varying experimental conditions (e.g. transfected/transduced cells, cytokine stimulated, cells under hypoxic conditions, ultraviolet treated cells, cells treated with chemotherapeutics or non cytotoxic drugs etc.). Probesets that were available on both platforms were converted to official gene symbols, averaging expression values of multiple probesets targeting the same gene. Next, quantile normalization was applied to the log2 transformed expression values.[15] (link) For each gene the CV of the expression was calculated. The CV equals the standard deviation divided by the mean (expressed as a percentage). The CV is used as a statistic for comparing the degree of variation between genes, even if the mean expressions are drastically different from each other.[16] (link) The calculated CVs for all genes were ranked. In addition, the MFC was calculated to reflect the minor variation in expression of those candidate housekeeping genes within the large dataset. For validation 2,543 publicly available mouse samples hybridized to Affymetrix Mouse Genome 430 2.0 GeneChips (Affymetrix) were downloaded from the Gene Expression Omnibus.[14] (link). Again, this validation set comprises a wide variety of different mouse tissues and varying experimental conditions.
Total RNA was extracted with Absolutely RNA Miniprep Kit (Stratagene, Amsterdam, The Netherlands), and reverse-transcribed to cDNA with random hexamer and RevertAidTM M-MuLV Reverse Transcriptase (Fermentas, Burlington, Ontario, Canada) according to the manufacturer's protocols. Table 4 shows primer sequences for RPL27, RPL30, OAZ1, RPL22 and RPS29. The same annealing temperature (i.e. 60 °C) and number of cycles (i.e. 25) was used for all primers. The PCR products were analyzed by electrophoresis in a 1.0% agarose gel.
de Jonge H.J., Fehrmann R.S., de Bont E.S., Hofstra R.M., Gerbens F., Kamps W.A., de Vries E.G., van der Zee A.G., te Meerman G.J, & ter Elst A. (2007). Evidence Based Selection of Housekeeping Genes. PLoS ONE, 2(9), e898.
Full text: Click here
Publication 2007
Cell Lines Cells Cytokine DNA, Complementary Electrophoresis Gene Expression Genes Genetic Diversity Genome Hypoxia Microarray Analysis Moloney Leukemia Virus Mus Oligonucleotide Primers Patients Pharmaceutical Preparations Pharmacotherapy RNA-Directed DNA Polymerase RPL22 protein, human Sepharose Stem Cells Tissues
4
RNA Integrity Assessment Methodology
For classification of RNA integrity, ten categories were defined from 1 (totally degraded RNA) to 10 (fully intact RNA). Figure 2 illustrates qualitatively the differences between the categories. Each of the 1208 samples was assigned manually to one of the categories by experienced expert users.
The categorical values provide the target values for the adaptive learning steps. The assignment to categories was very carefully done as it is critical for the performance of the resulting algorithm. Especially for RNA samples at the borderline of two adjacent integrity categories, the assignment to each of the two categories could be justified but one had to be selected. This reflects a natural randomness which is inherent in a gradual process like RNA degradation. However, such random noise in the target values can easily be handled by the learning model, which assumes noise in the target data.
Detecting abnormalities in the electropherogram is another important preprocessing step to get a clean set of training samples. Various anomalies can disturb the usual shape of an electropherogram, e.g., ghost peaks, spikes, wavy baseline, and unexpected sample type. They were observed in approx. 5% of the samples. To separate anomalies from normal samples, several simple detectors were constructed. Each detector performs a linear classification based on a threshold value. Spikes, for example, can have a large peak height but have very narrow peak width; they appear as very sharp peaks. Normally, the largest peaks in the electrophoretic traces are located at the 18S and 28S bands but compared to a spike are significantly broader. If a high peak does not cover the minimal requested area, it is rejected as a spike and marked as abnormal. Applying these detection criteria to the data set returned 117 electropherograms as abnormal. Eleven abnormal samples could not be detected for example, because a spike arose near the 28S peak and could not be identified as such. All of them were assigned a sensible label and put in the test set. This reflects the natural occurrence of such effects in the test phase.
In the application phase we distinguish between critical and non-critical anomalies based on their influence on the computation of the RIN. The former are anomalies of baseline and anomalies in the 5S-region, the latter anomalies in the pre-region, precursor-region and post-region (cf. fig. 8).
If a critical anomaly is detected, the RIN is not computed. Instead, an error message appears to the user. If a non-critical anomaly is detected, the RIN is computed and a warning to the user is displayed [10 ,11 ]. Baseline correction and normalization are applied to the electropherogram prior to the actual feature extraction process. These functions are standard features of Agilent's Expert Software [12 ]. The baseline is a constant background signal of the electropherogram and its level may significantly differ between different electropherograms. The baseline-corrected signal is then normalized. For height related features it is normalized to the global maximum of the 5S-region to precursor-region. For area related features it is normalized to the global signal area in the 5S-region to precursor-region. The pre-region, marker-region and post-region are intentionally not considered critical elements of the electrophoretic trace since they don't contain critical information about the RNA degradation process.
Schroeder A., Mueller O., Stocker S., Salowsky R., Leiber M., Gassmann M., Lightfoot S., Menzel W., Granzow M, & Ragg T. (2006). The RIN: an RNA integrity number for assigning integrity values to RNA measurements. BMC Molecular Biology, 7, 3.
Full text: Click here
Publication 2006
Acclimatization Congenital Abnormality Electrophoresis Red Cell Ghost RNA Degradation Trace Elements
5
Random Transposon Mutagenesis in S. aureus
The mariner-based transposon (Tn) bursa aurealis was used to generate random Tn insertion mutations in S. aureus strain JE2 essentially as described by Bae et al. (4 (link), 43 (link)). First, bacteriophage ϕ11 was used to transduce the bursa aurealis delivery plasmid pBursa into JE2 containing the transposase-encoding plasmid pFA545, with selection on TSA medium containing chloramphenicol (Cm) (10 µg/ml) and Tet (5 µg/ml). After growth for 48 h at 30°C to allow for transposition events, one colony was resuspended in 100 µl of prewarmed 45°C water and then 10 µl was plated onto TSA plates containing erythromycin (Erm) (25 µg/ml) and grown at 45°C for 12 to 24 h. Resulting colonies, irrespective of colony size, were then screened for loss of the temperature-sensitive plasmids pBursa and pFA545 by patching them on TSA-Erm (25 µg/ml), TSA-Cm (10 µg/ml), and TSA-Tet (5 µg/ml). Those colonies that were Cm and Tet susceptible but resistant to Erm were arrayed into 1-ml deep-well plates containing 400 µl of TSB-Erm (5 µg/ml) and grown at 37°C overnight. The next day, 400 µl of 50% glycerol was added to each well and the plates were stored in a −80°C freezer.
To identify the locations of the bursa aurealis transposon insertions, 400 µl of TSB-Erm (5 µg/ml) was inoculated into 96-well plates using a 96-prong replicator. After overnight growth, the Wizard genomic DNA purification kit (Promega) was used to isolate genomic DNA from the cultures with the following modifications. Briefly, after centrifugation at 4,100 rpm for 5 min in a Sorvall (Newtown, CT) Legend tabletop centrifuge, supernatants were removed, the content of each well was resuspended in 110 µl of 50 mM EDTA (pH 8.0), and 5 µl of 10-mg/ml lysostaphin was added. After incubation at 37°C for 60 min, 600 µl of Nuclei Lysis solution was added and the genomic DNA was collected according to the manufacturer’s instructions. After resuspension in Tris-EDTA (TE) buffer, approximately 2 µg of genomic DNA was digested with 10 units of AciI (New England Biolabs) at 37°C for 4 h. AciI was then heat inactivated at 65°C for 30 min; T4 DNA ligase (200 U) (Monserate Biotechnologies, San Diego, CA) was then added to each sample and ligated overnight at 4°C, followed by heat inactivation at 65°C for 30 min. DNA fragments spanning the bursa aurealis insertion sites in each sample were amplified using the Buster (5′ GCTTTTTCTAAATGTTTTTTAAGTAAATCAAGTACC 3′) and Martn-ermR (5′ AAACTGATTTTTAGTAAACAGTTGACGATATTC 3′) primer set. PCR conditions included 30 cycles with an annealing temperature of 63°C and an extension time of 3 min. Once amplified, samples of the DNA products were separated in a 1% agarose gel by electrophoresis, and the remainder was purified for sequencing using Exo-SAP-IT (GE Healthcare) according to the manufacturer’s instructions. Finally, determination of the nucleotide sequences of the genomic DNA flanking the transposons was achieved using the Buster primer at the DNA Microarray and Sequencing Core Facility at the University of Nebraska Medical Center.
Fey P.D., Endres J.L., Yajjala V.K., Widhelm T.J., Boissy R.J., Bose J.L, & Bayles K.W. (2013). A Genetic Resource for Rapid and Comprehensive Phenotype Screening of Nonessential Staphylococcus aureus Genes. mBio, 4(1), e00537-12.
Publication 2013
Bacteriophages Cell Nucleus Centrifugation Chloramphenicol DNA Chips DNA Primers Edetic Acid Electrophoresis Erythromycin Genome Glycerin Jumping Genes Lysostaphin Microarray Analysis Obstetric Delivery Oligonucleotide Primers Plasmids Promega Sepharose Sequence Determinations, DNA Strains Synovial Bursa T4 DNA Ligase Transposase Tromethamine

Most recents protocols related to «Electrophoresis»

1
Optimizing Antibody Expression and Pharmacokinetics
Not available on PMC !

Example 1

The sequence coding for the light chain variable region of the antibody was inserted into vector pFUSE2ss-CLIg-hK (Invivogen, Catalog Number: pfuse2ss-hclk) using EcoRI and BsiWI restriction sites to construct a light chain expression vector. The sequence coding for the heavy chain variable region of the antibody was inserted into vector pFUSEss-CHIg-hG2 (Invivogen, Catalog Number: pfusess-hchg2) or vector pFUSEss-CHIg-hG4 (Invivogen, Catalog Number: pfusess-hchg4) using EcoRI and NheI restriction sites to construct a heavy chain expression vector.

The culture and transfection of Expi293 cells were performed in accordance with the handbook of Expi293™ Expression System Kit from Invitrogen (Catalog Number: A14635). The density of the cells was adjusted to 2×106 cells/ml for transfection, and 0.6 μg of the light chain expression vector as described above and 0.4 μg of the heavy chain expression vector as described above were added to each ml of cell culture, and the supernatant of the culture was collected four days later.

The culture supernatant was subjected to non-reduced SDS-PAGE gel electrophoresis in accordance with the protocol described in Appendix 8, the Third edition of the “Molecular Cloning: A Laboratory Manual”.

Pictures were taken with a gel scanning imaging system from BEIJING JUNYI Electrophoresis Co., LTD and in-gel quantification was performed using Gel-PRO ANALYZER software to determine the expression levels of the antibodies after transient transfection. Results were expressed relative to the expression level of control antibody 1 (control antibody 1 was constructed according to U.S. Pat. No. 7,186,809, which comprises a light chain variable region as set forth in SEQ ID NO: 10 of U.S. Pat. No. 7,186,809 and a heavy chain variable region as set forth in SEQ ID NO: 12 of U.S. Pat. No. 7,186,809, the same below) (control antibody 2 was constructed according to U.S. Pat. No. 7,638,606, which comprises a light chain variable region as set forth in SEQ ID NO: 6 of U.S. Pat. No. 7,638,606 and a variable region as set forth in SEQ ID NO: 42 of U.S. Pat. No. 7,638,606, the same below). See Tables 2a-2c below for the results.

TABLE 2a
Expression levels of the antibodies of the present
invention after transient transfection (antibodies whose
expression levels are significantly higher than that of control antibody 1):
Number ofExpression level vsNumber of Expression level vs
the antibodycontrol antibody 1the antibodycontrol antibody 1
L1021H10002.08L1000H10281.27
L1020H10001.58L1000H10151.19
L1000H10271.56L1000H10321.18
L1000H10241.51L1000H10261.15
L1000H10251.48L1021H10291.12
L1001H10001.48L1000H10301.1
L1021H10161.43L1024H10311.08
L1000H10141.35L1000H10161.05

TABLE 2b
Expression levels of the antibodies of the present
invention after transient transfection (antibodies whose
expression levels are slightly lower than that of control antibody 1):
Number of Expression level vsNumber of Expression level vs
the antibodycontrol antibody 1the antibodycontrol antibody 1
L1000H10310.99L1017H10000.85
L1021H10310.99L1020H10160.84
L1020H10290.96L1000H10090.81
control anti-0.93L1000H10070.8
body 2
L1012H10000.89L1000H10230.8
L1019H10000.87L1020H10270.78
L1020H10310.87L1024H10070.77
L1021H10200.87L1000H10130.75
L1000H10290.86L1020H10070.74
L1008H10000.86L1021H10070.74
L1000H10010.85L1000H10210.71

TABLE 2c
Expression levels of the antibodies of the present
invention after transient transfection (antibodies whose
expression levels are significantly lower than that of control antibody 1):
Number ofExpression level vsNumber of Expression level vs
the antibodycontrol antibody 1the antibodycontrol antibody 1
L1000H10200.69L1024H10000.52
L1010H10000.69L1000H10080.51
L1000H10220.67L1000H10370.5
L1000H10120.64L1007H10000.49
L1022H10000.64L1016H10000.49
L1011H10000.63L1000H10170.47
L1000H10110.62L1000H10350.46
L1000H10330.62L1012H10270.46
L1020H10200.61L1018H10000.44
L1000H10360.6L1023H10000.43
L1021H10270.6L1012H10160.42
L1012H10070.59L1013H10000.41
L1009H10000.57L1000H10340.4
L1012H10200.57L1000H10180.35
L1012H10310.56L1000H10190.34
L1000H10380.54L1015H10000.27
L1012H10290.54L1014H10000.17
L1000H10100.53

Example 4

6-8 week-old SPF Balb/c mice were selected and injected subcutaneously with antibodies (the antibodies of the present invention or control antibody 2) in a dose of 5 mg/kg (weight of the mouse). Blood samples were collected at the time points before administration (0 h) and at 2, 8, 24, 48, 72, 120, 168, 216, 264, 336 h after administration. For blood sampling, the animals were anesthetized by inhaling isoflurane, blood samples were taken from the orbital venous plexus, and the sampling volume for each animal was about 0.1 ml; 336 h after administration, the animals were anesthetized by inhaling isoflurane and then euthanized after taking blood in the inferior vena cava.

No anticoagulant was added to the blood samples, and serum was isolated from each sample by centrifugation at 1500 g for 10 min at room temperature within 2 h after blood sampling. The collected supernatants were immediately transferred to new labeled centrifuge tubes and then stored at −70° C. for temporary storage. The concentrations of the antibodies in the mice were determined by ELISA:

1. Preparation of Reagents

sIL-4Rα (PEPRO TECH, Catalog Number: 200-04R) solution: sIL-4Rα was taken and 1 ml ddH2O was added therein, mixed up and down, and then a solution of 100 μg/ml was obtained. The solution was stored in a refrigerator at −20° C. after being subpacked.

Sample to be tested: 1 μl of serum collected at different time points was added to 999 μl of PBS containing 1% BSA to prepare a serum sample to be tested of 1:1000 dilution.

Standard sample: The antibody to be tested was diluted to 0.1 μg/ml with PBS containing 1% BSA and 0.1% normal animal serum (Beyotime, Catalog Number: ST023). Afterwards, 200, 400, 600, 800, 900, 950, 990 and 1000 μl of PBS containing 1% BSA and 0.1% normal animal serum were respectively added to 800, 600, 400, 200, 100, 50, 10 and 0 μl of 0.1 μg/ml antibodies to be tested, and thus standard samples of the antibodies of the present invention were prepared with a final concentration of 80, 60, 40, 20, 10, 5, 1, or 0 ng/ml respectively.

2. Detection by ELISA

250 μl of 100 μg/ml sIL-4Rα solution was added to 9.75 ml of PBS, mixed up and down, and then an antigen coating buffer of 2.5 μg/ml was obtained. The prepared antigen coating buffer was added to a 96-well ELISA plate (Corning) with a volume of 100 μl per well. The 96-well ELISA plate was incubated overnight in a refrigerator at 4° C. after being wrapped with preservative film (or covered). On the next day, the 96-well ELISA plate was taken out and the solution therein was discarded, and PBS containing 2% BSA was added thereto with a volume of 300 μl per well. The 96-well ELISA plate was incubated for 2 hours in a refrigerator at 4° C. after being wrapped with preservative film (or covered). Then the 96-well ELISA plate was taken out and the solution therein was discarded, and the plate was washed 3 times with PBST. The diluted standard antibodies and the sera to be detected were sequentially added to the corresponding wells, and three duplicate wells were made for each sample with a volume of 100 μl per well. The ELISA plate was wrapped with preservative film (or covered) and incubated for 1 h at room temperature. Subsequently, the solution in the 96-well ELISA plate was discarded and then the plate was washed with PBST for 3 times. Later, TMB solution (Solarbio, Catalog Number: PR1200) was added to the 96-well ELISA plate row by row with a volume of 100 μl per well. The 96-well ELISA plate was placed at room temperature for 5 minutes, and 2 M H2SO4 solution was added in immediately to terminate the reaction. The 96-well ELISA plate was then placed in flexstation 3 (Molecular Devices), the values of OD450 were read, the data were collected and the results were calculated with Winnonlin software. The pharmacokinetic results were shown in FIG. 1 and Table 6 below.

TABLE 6
Pharmacokinetic results of the antibodies of the present invention in mouse
Area
TimeUnder the
HalftoPeakdrug-timeVolume ofClearance
lifepeakconcentrationCurvedistributionrate
Numberhhμg/mlh*μg/mlml/kgml/h/kg
L1020H1031Mean269.347233.797679.28138.920.38
value
Standard105.730.000.42163.9122.480.09
deviation
L1012H1031Mean167.274845.59852.391.30.38
value
Standard8.520.001.86448.345.580.00
deviation
ControlMean56.67367.881132.68288.923.79
antibody 2value
Standard25.8416.970.2594.4249.451.12
deviation

Example 5

A series of pharmacokinetic experiments were carried out in Macaca fascicularises to further screen antibodies.

3-5 year-old Macaca fascicularises each weighting 2-5 Kg were selected and injected subcutaneously with antibodies (the antibodies of the present invention or control antibody 2) in a dose of 5 mg/kg (weight of the Macaca fascicularis). The antibody or control antibody 2 to be administered was accurately extracted with a disposable aseptic injector, and multi-point injections were made subcutaneously on the inner side of the thigh of the animal, and the injection volume per point was not more than 2 ml. Whole blood samples were collected from the subcutaneous vein of the hind limb of the animal at the time points before administration (0 h) and at 0.5, 2, 4, 8, 24, 48, 72, 120, 168, 240, 336 h, 432 h, 504 h, 600 h, 672 h after administration. The blood volume collected from each animal was about 0.1 ml each time.

No anticoagulant was added to the blood samples, and serum was isolated from each sample by centrifugation at 1500 g for 10 min at room temperature within 2 h after blood sampling. The collected supernatants were immediately transferred to new labeled centrifuge tubes and then stored at −70° C. for temporary storage. The concentrations of the antibodies in the Macaca fascicularises were determined according the method as described in Example 4. The pharmacokinetic results are shown in FIG. 2 and Table 7 below.

TABLE 7
Pharmacokinetic results of the antibodies of the present invention in macaca fascicularis
Area
TimeUnder the
HalftoPeakdrug-timeVolume ofClearance
lifepeakconcentrationCurvedistributionrate
Numberhhμg/mlh*μg/mlml/kgml/h/kg
L1020H1031Mean254.9548.0089.6522189.9175.940.22
value
Standard44.5733.9444.298557.1522.950.10
deviation
L1012H1031Mean185.75486516185.7373.410.28
value
Standard42.5433.944.52506.980.810.06
deviation
ControlMean37.031637.822773.2193.971.78
antibody 2value
Standard18.0311.316.75155.8442.470.07
deviation

Example 10

In vivo pharmacokinetics of the antibodies of the invention are further detected and compared in this Example, in order to investigate the possible effects of specific amino acids at specific positions on the pharmacokinetics of the antibodies in animals. The specific experimental method was the same as that described in Example 4, and the results are shown in Table 9 below.

TABLE 9
Detection results of in vivo pharmacokinetics of the antibodies of the present invention
Area
TimeUnder the
HalftoPeakdrug-timeVolume ofClearance
lifepeakconcentrationCurvedistributionrate
hhug/mlh*ug/mlml/kgml/h/kg
L1020H1031Mean185.494038.948188.8114.280.43
value
Standard18.5213.862.33510.476.50.05
deviation
L1012H1001Mean161.2648.0012.362491.19332.791.47
value
Standard54.300.002.26165.1676.910.20
deviation
L1001H1031Mean171.4156.0042.749273.7399.170.40
value
Standard6.1213.867.381868.6618.690.07
deviation
L1020H1001Mean89.0064.0020.113481.40164.141.30
value
Standard16.7013.862.14268.3922.860.20
deviation

From the specific sequence, the amino acid at position 103 in the sequence of the heavy chain H1031 (SEQ ID NO. 91) of the antibody (in CDR3) is Asp (103Asp), and the amino acid at position 104 is Tyr (104Tyr). Compared with antibodies that have no 103Asp and 104Tyr in heavy chain, the present antibodies which have 103Asp and 104Tyr have a 2- to 4-fold higher area under the drug-time curve and an about 70% reduced clearance rate.

The expression levels of the antibodies of the present invention are also detected and compared, in order to investigate the possible effects of specific amino acids at specific positions on the expression of the antibodies. Culture and transfection of Expi293 cells were conducted according to Example 1, and the collected culture supernatant was then passed through a 0.22 μm filter and then purified by GE MabSelect Sure (Catalog Number: 11003494) Protein A affinity chromatography column in the purification system GE AKTA purifier 10. The purified antibody was collected and concentrated using Amicon ultrafiltration concentrating tube (Catalog Number: UFC903096) and then quantified. The quantitative results are shown in Table 10 below.

TABLE 10
Detection results of the expression
levels of the antibodies of the present invention
Expression level
Antibody(×10−2 mg/ml culture medium)
L1020H10318.39
L1001H10311.79
L1020H10014.04
L1012H10015.00
L1023H10014.63
L1001H10011.75

From the specific sequence, the amino acid at position 31 in the sequence of the light chain L1012 (SEQ ID NO. 44), L1020 (SEQ ID NO. 55) or L1023 (SEQ ID NO. 51) of the antibody (in CDR1) is Ser (31Ser). Compared with antibodies that have no 31Ser in light chain, the present antibodies which have 31Ser have a 2- to 5-fold higher expression level.

The above description for the embodiments of the present invention is not intended to limit the present invention, and those skilled in the art can make various changes and variations according to the present invention, which are within the protection scope of the claims of the present invention without departing from the spirit of the same.

US11866491B2. Antibody for binding to interleukin 4 receptor (2024-01-09). SUZHOU CONNECT BIOPHARMACEUTICALS, LTD. [CN]. Inventors: Wei Zheng [US], Wubin Pan [CA], Xin Yang [CN], Yang Chen [CN], Limin Zhang [CN], Jie Jiang [CN].
Full text: Click here
Patent 2024
Amino Acids Animals Antibodies Anticoagulants Antigens Asepsis BLOOD Blood Volume Buffers Cell Culture Techniques Cells Centrifugation Chromatography Chromatography, Affinity Cloning Vectors Culture Media Deoxyribonuclease EcoRI Drug Kinetics Electrophoresis Enzyme-Linked Immunosorbent Assay Hindlimb Human Body Immunoglobulin Heavy Chains Immunoglobulin Light Chains Immunoglobulins Interleukin-1 Isoflurane Light Macaca Macaca fascicularis Medical Devices Metabolic Clearance Rate Mice, Inbred BALB C Mus Open Reading Frames Pharmaceutical Preparations Pharmaceutical Preservatives SDS-PAGE Serum Staphylococcal Protein A Technique, Dilution Thigh Transfection Transients Ultrafiltration Veins Vena Cavas, Inferior
2
Pseudouridylation of mRNA by psEONs
Not available on PMC !

Example 5

Further to what has been shown in Example 4, it was then tested whether a psEON, as outlined in detail herein, could also yield pseudouridylation using the substrate GL-IDUA swap plasmids after transfection in cells. For this, HEK293T cells were transfected at 90-100% confluency, using PEI in a 6-well dish, with 500 ng GL-IDUA swap substrate plasmid and 2.5 μg the pugIntron-IDUA guide RNA expressing plasmid or transfected with 100 pmol Cy3-IDUA-A psEON oligonucleotide. Four days after transfection cells were washed and incubated at for 24 h. Total RNA was isolated as described and RT-PCR was performed as outlined above, except that 21 cycles were performed for all samples. RT-PCR products were separated by gel electrophoresis. Results are shown in FIG. 18. These indicate that when no DNA was transfected (meaning no plasmid or psEON, on top of the transfected substrate plasmid) that no GL39 RT-PCR product was detectable, although the 5S control was abundant. However, after co-transfection of the pugIntron-IDUA guide RNA-expressing plasmid and also after co-transfection with the Cy3-iDUA-A psEON, the product was detectable, indicating that read-through of the mRNA occurred, and that NMD was inhibited. This shows that the inventors of the present invention were able to obtain pseudouridylation not only by using intronically-embedded guide RNAs, but also with the short psEONs of the present invention.

US11866702B2. Nucleic acid molecules for pseudouridylation (2024-01-09). University of Rochester [US], ProQR Therapeutics II B.V. [NL]. Inventors: Bart Klein [NL], Janne Juha Turunen [NL], Lenka Van Sint Fiet [NL], Pedro Duarte Morais Fernandes Arantes Da Silva [NL], Julien Auguste Germain Boudet [NL], Yi-Tao Yu [US], Hironori Adachi [US], Meemanage De Zoysa [US].
Full text: Click here
Patent 2024
Cells Electrophoresis Hyperostosis, Diffuse Idiopathic Skeletal IDUA protein, human Introns Inventors Oligonucleotides Plasmids Reverse Transcriptase Polymerase Chain Reaction RNA RNA, Messenger Transfection
3
Measuring Surface Potential of Hematopoietic Cells
Not available on PMC !

Example 3

Testing Surface Potential of Haematopoietic Cells and Neutrophils

Electrophoresis is used to investigate the surface potential variation in haematopoietic cells (e.g. haematopoietic stem cells, and/or precursor cells) and neutrophils by measuring the electrophoretic mobility. The suspended cells are collected from culture, by mechanical detachment and collection from the culture substrate. Collected cells are redistributed in an electrophoresis buffer solution containing 10 mM Tris-HCl and 291 mM glucose, and are introduced into a rectangular glass electrophoresis chamber. 200V DC is applied across the electrophoresis chamber. The electrophoretic velocity of cells, u, is measured by recording the time needed for cells passing a fixed length with 3 mA under a microscope with a CCD camera. The electrophoretic mobility, p, is calculated by μ=ugS/I, where g is the conductivity of medium, S is the cross-sectional area of the electrophoresis chamber, and/is the current. For each condition typically at least 9 readings are performed to calculate cell electrophoretic mobility.

US11878033B2. Cancer-killing cells (2024-01-23). LIFT BIOSCIENCES LTD [GB]. Inventors: Alex Blyth [GB], Nico Bruyniks [GB].
Full text: Click here
Patent 2024
Buffers Cells Electric Conductivity Electrophoresis Glucose Hematopoietic System Malignant Neoplasms Microscopy Neutrophil Range of Motion, Articular Stem Cells, Hematopoietic Tromethamine
4
Copper-Infused Carbon Nanotube Composite Wire
Not available on PMC !

Example 4

Although example 4 is provided with regard to copper, it should be understood that aspects herein are not limited as such, and any metal can be used instead of, or in addition to copper.

In this example, a structure comprises a thread infused with copper by electroplating to create a substrate, which can then optionally be further coated with CNT and infused. In several embodiments, the CNT thread includes a metal core.

The carbon nanotube thread can be, for example, floating catalyst chemical vapor deposition grown and formed, pulled form VACNT forests, etc. radially from the substrate, as discussed above.

More carbon nanotubes can be grown radially aligned using NAHF-X IP or deposited by methods such electrophoresis, e.g., as described more fully herein.

An indefinite number of identical concentric layers can be built up until the wire is at a desired diameter or ratio of copper to carbon.

Additionally, in some embodiments, the finished wire can be further mechanically drawn down to resize, reshape, refine, alter, combinations thereof, etc., the properties of the wire.

In some embodiments, multiple wires can be combined into a finished cable or further carbon nanotube coatings and copper electroplating can continue.

US11866839B2. Composite carbon nanotube structures (2024-01-09). University of Dayton Research Institute [US]. Inventors: Paul Kladitis [US], Brian Rice [US], Lingchuan Li [US].
Full text: Click here
Patent 2024
Carbon Copper Electrophoresis Forests Metals Nanotubes, Carbon
5
DNA Separation and Electroelution Protocol
Not available on PMC !

Example 2

Samples of DNA markers (1 kb Extend marker, New England Biolabs) was loaded into sample well of two lanes of a SageHLS cassette. The DNA was separated and electroeluted in using the following electrophoresis conditions: 0.75% agarose, 50 mM Tris, 29 mM TAPS, 0.1 mM EDTA, pH 8.7, 55 V continuous field (DC), 50 minutes, gel temperature 30° C. Electroeluted fractions from all elution wells were analyzed on an analytical agarose slab gel (FIGS. 11A-11B). Evidence of electrophoretic mobility compression in the HLS separation run is seen in Fraction #2 (that is, fragments 10-48.5 kb comigrate and are found together in fraction #2, and no DNA is found in Fraction #1). Therefore, due to the compression phenomenon, under these conditions, all DNA greater than 10 kb will be found in fraction #2. Fractions #5 and #6 contain fragments ranging from 1-2 kb.

US11867661B2. Systems and methods for detection of genetic structural variation using integrated electrophoretic DNA purification (2024-01-09). Sage Science, Inc. [US]. Inventors: T. Christian Boles [US].
Full text: Click here
Patent 2024
Edetic Acid Electrophoresis Figs Markers, DNA Range of Motion, Articular Sepharose Tromethamine Vision

Top products related to «Electrophoresis»

1
Pvdf membrane by Merck Group
Sourced in United States, Germany, China, United Kingdom, Morocco, Ireland, France, Italy, Japan, Canada, Spain, Switzerland, New Zealand, India, Hong Kong, Sao Tome and Principe, Sweden, Netherlands, Australia, Belgium, Austria
PVDF membranes are a type of laboratory equipment used for a variety of applications. They are made from polyvinylidene fluoride (PVDF), a durable and chemically resistant material. PVDF membranes are known for their high mechanical strength, thermal stability, and resistance to a wide range of chemicals. They are commonly used in various filtration, separation, and analysis processes in scientific and research settings.
2
Trizol reagent by Thermo Fisher Scientific
Sourced in United States, China, Japan, Germany, United Kingdom, Canada, France, Italy, Australia, Spain, Switzerland, Netherlands, Belgium, Lithuania, Denmark, Singapore, New Zealand, India, Brazil, Argentina, Sweden, Norway, Austria, Poland, Finland, Israel, Hong Kong, Cameroon, Sao Tome and Principe, Macao, Taiwan, Province of China, Thailand
TRIzol reagent is a monophasic solution of phenol, guanidine isothiocyanate, and other proprietary components designed for the isolation of total RNA, DNA, and proteins from a variety of biological samples. The reagent maintains the integrity of the RNA while disrupting cells and dissolving cell components.
3
Rneasy mini kit by Qiagen
Sourced in Germany, United States, United Kingdom, Netherlands, Spain, Japan, Canada, France, China, Australia, Italy, Switzerland, Sweden, Belgium, Denmark, India, Jamaica, Singapore, Poland, Lithuania, Brazil, New Zealand, Austria, Hong Kong, Portugal, Romania, Cameroon, Norway
The RNeasy Mini Kit is a laboratory equipment designed for the purification of total RNA from a variety of sample types, including animal cells, tissues, and other biological materials. The kit utilizes a silica-based membrane technology to selectively bind and isolate RNA molecules, allowing for efficient extraction and recovery of high-quality RNA.
4
Trizol by Thermo Fisher Scientific
Sourced in United States, Germany, China, Japan, United Kingdom, Canada, France, Italy, Australia, Spain, Switzerland, Belgium, Denmark, Netherlands, India, Ireland, Lithuania, Singapore, Sweden, Norway, Austria, Brazil, Argentina, Hungary, Sao Tome and Principe, New Zealand, Hong Kong, Cameroon, Philippines
TRIzol is a monophasic solution of phenol and guanidine isothiocyanate that is used for the isolation of total RNA from various biological samples. It is a reagent designed to facilitate the disruption of cells and the subsequent isolation of RNA.
5
Zetasizer nano z by Malvern Panalytical
Sourced in United Kingdom, Germany, United States, France, Japan, China, Netherlands, Morocco, Spain, Cameroon
The Zetasizer Nano ZS is a dynamic light scattering (DLS) instrument designed to measure the size and zeta potential of particles and molecules in a sample. The instrument uses laser light to measure the Brownian motion of the particles, which is then used to calculate their size and zeta potential.
6
Ripa lysis buffer by Beyotime
Sourced in China, United States, Switzerland, Germany, Japan, United Kingdom
RIPA lysis buffer is a detergent-based buffer solution designed for the extraction and solubilization of proteins from cells and tissues. It contains a mixture of ionic and non-ionic detergents that disrupt cell membranes and solubilize cellular proteins. The buffer also includes additional components that help to maintain the stability and activity of the extracted proteins.
7
Pvdf membrane by Bio-Rad
Sourced in United States, Germany, China, United Kingdom, Japan, France, Canada, Spain, Italy, Australia, Switzerland, Austria, Belgium
PVDF membranes are a type of laboratory equipment used for protein transfer and detection in Western blot analysis. They provide a stable and durable surface for the immobilization of proteins, enabling effective identification and quantification of target proteins in complex biological samples.
8
Bca protein assay kit by Thermo Fisher Scientific
Sourced in United States, China, Germany, United Kingdom, Japan, Belgium, France, Switzerland, Italy, Canada, Australia, Sweden, Spain, Israel, Lithuania, Netherlands, Denmark, Finland, India, Singapore
The BCA Protein Assay Kit is a colorimetric detection and quantification method for total protein concentration. It utilizes bicinchoninic acid (BCA) for the colorimetric detection and quantification of total protein. The assay is based on the reduction of Cu2+ to Cu1+ by protein in an alkaline medium, with the chelation of BCA with the Cu1+ ion resulting in a purple-colored reaction product that exhibits a strong absorbance at 562 nm, which is proportional to the amount of protein present in the sample.
9
Nitrocellulose membrane by Bio-Rad
Sourced in United States, Germany, Italy, United Kingdom, Canada, France, China, Switzerland, Japan, Spain, Australia, Sweden, Portugal, Israel, Netherlands, Belgium
Nitrocellulose membranes are a type of laboratory equipment designed for use in protein detection and analysis techniques. These membranes serve as a support matrix for the immobilization of proteins, enabling various downstream applications such as Western blotting, dot blotting, and immunodetection.
10
Protease inhibitor cocktail by Roche
Sourced in United States, Switzerland, Germany, China, United Kingdom, France, Canada, Japan, Italy, Australia, Austria, Sweden, Spain, Cameroon, India, Macao, Belgium, Israel
Protease inhibitor cocktail is a laboratory reagent used to inhibit the activity of proteases, which are enzymes that break down proteins. It is commonly used in protein extraction and purification procedures to prevent protein degradation.

More about "Electrophoresis"

Electrophoresis is a powerful analytical technique that has revolutionized the way scientists study and analyze complex biomolecules.
This versatile process, also known as gel electrophoresis or SDS-PAGE, exploits the differential migration of charged particles, such as proteins, nucleic acids, and other biomolecules, through a porous medium under the influence of an applied electric field.
Electrophoresis is widely used in fields like biochemistry, molecular biology, and clinical diagnostics, contributing to advancements in areas like proteomics, genomics, and biomarker discovery.
By separating and identifying specific components within a sample, researchers can gain valuable insights into cellular processes, disease mechanisms, and molecular interactions.
The technique's versatility extends to various applications, including the use of PVDF membranes for Western blotting, TRIzol reagent and RNeasy Mini Kit for RNA extraction, and RIPA lysis buffer and BCA protein assay kit for protein analysis.
Additionally, Nitrocellulose membranes are commonly used in blotting techniques, while Protease inhibitor cocktail helps preserve the integrity of proteins during sample preparation.
The Zetasizer Nano ZS, a dynamic light scattering instrument, can also be used in conjunction with electrophoresis to analyze the size and zeta potential of biomolecules, providing further insights into their properties and behavior.
By leveraging the power of electrophoresis and its related tools and techniques, researchers can enhance the accuracy and depth of their investigations, leading to more informed decisions and impactful findings that advance scientific knowledge and understanding.