> Procedures > Laboratory Procedure > Electrophoresis, Agar Gel

Electrophoresis, Agar Gel

Electrophoresis, Agar Gel is a powerful analytical technique used to separate and analyze complex biomolecular mixtures, such as proteins, nucleic acids, or carbohydrates.
In this method, the sample is loaded onto an agarose gel matrix, and an electrical field is applied, causing the charged molecules to migrate through the gel at different rates based on their size and charge.
This separation allows for the identification, quantification, and purification of specific biomolecules.
Agar gel electrophoresis is a versatile tool in fields like biochemistry, molecular biology, and clinical diagnostics, enabling researchers to gain insights into the structure and function of biological macromolecules.
With its high resolution and sensitivity, this technique is indispensable for many life science applications.

Most cited protocols related to «Electrophoresis, Agar Gel»

Sequencing and Assembly of Rice Genome

Cited 384 times

The IRGSP clone and PCR sequences of the O. sativa (japonica group, cultivar Nipponbare) genome deposited in the International Nucleotide Sequence Databases as of 25 February 2010 were used in construction of the MTP. In addition, sequence reads generated by the Syngenta rice genome sequencing project (Goff et al. 2002 (link)) were assembled and used to extend contigs.
For the next-generation DNA sequencing of an NIAS individual, total genomic DNA was prepared from nuclei isolated from Nipponbare rice young leaves (two weeks after germination) using the CTAB method (Murray and Thompson 1980 (link)). The DNA samples were fragmented by a nebulizer or Branson Sonifier 250 (Danbury, CT). Sequencing libraries were constructed following the protocols with Illumina Genomic DNA Sample Preparation Kit and Roche GS DNA Library Preparation Kit, respectively. Illumina genome sequencing was performed by Illumina Genome Analyzer II/IIx with the Illumina version 2 sequencing kit. GS-FLX genome sequencing was performed using the Roche GS LR70 Sequencing Kit. The sequence reads are available at the DDBJ Sequence Read Archive (DRA000651).
For the CSHL individual, ~5 μg of Nipponbare rice genomic DNA was used as input for standard Illumina libraries. The DNA was sheared by adaptive focused acoustics using the Covaris (Woburn, MA) instrument and end-repaired using T4 DNA polymerase, Klenow fragment, and T4 polynucleotide kinase. Fragments were then treated with Klenow fragment (3’ - 5’ exonuclease) to add a single 3’ deoxyA overhang and ligated to standard paired-end Illumina adapters. Qiagen (Valencia, CA) columns were used for purification between steps. The fragments were size-selected at ~225 bp (including adapters) using agarose gel electrophoresis. The actual insert size excluding adapters was ~150 bp. The library was then PCR amplified using Phusion DNA polymerase in HF buffer for 14 cycles and quantified using the Agilent BioAnalyzer (Santa Clara, CA). All libraries were normalized to 10 nM before loading on the Illumina sequencers. Production sequencing was performed using Illumina GAIIx instruments with paired-end modules using the Illumina version 3 sequencing kits. The library was sequenced with 76 bp paired-end read lengths. Sequence data was processed using the Illumina GAPipeline v1.1 and v1.3.2 (Firecrest/Bustard v1.9.6 and Firecrest/Bustard v1.3.2). The sequence reads are available at the Sequence Read Archive of NCBI (SRX032913).
Syngenta rice genome sequences (Goff et al. 2002 (link)) were filtered by using IRGSP rice genomic sequences with similarity searches. The filtered sequences were then assembled; 50 large Syngenta contigs (between 4 kb and 40 kb), a total of 748 kb were used for potential gap filling.

Kawahara Y., de la Bastide M., Hamilton J.P., Kanamori H., McCombie W.R., Ouyang S., Schwartz D.C., Tanaka T., Wu J., Zhou S., Childs K.L., Davidson R.M., Lin H., Quesada-Ocampo L., Vaillancourt B., Sakai H., Lee S.S., Kim J., Numa H., Itoh T., Buell C.R, & Matsumoto T. (2013). Improvement of the Oryza sativa Nipponbare reference genome using next generation sequence and optical map data. Rice, 6, 4.

Full text: Click here

Publication 2013

3'-5'-Exonucleases A-748 Acclimatization Acoustics Buffers Cell Nucleus Cetrimonium Bromide Clone Cells DNA-Directed DNA Polymerase DNA Library DNA Polymerase I Electrophoresis, Agar Gel Genome Germination Nebulizers Oryza sativa Polynucleotide 5'-Hydroxyl-Kinase

Plasmid Construction and Mutagenesis

Cited 375 times

Plasmid pDESTSIRV30, pDESTSIRV33 expressing the SIRV proteins (CAG38830 and CAG38833), pDESTAVRA expressing MRSA vraR protein (CAG40961) and pDESTFaBH2 expressing Pseudomonas aeruginosa FaBH2 protein (AAG06721)[28 (link)] were constructed using a modified Gateway technology with an N-terminal TEV protease cleavable His tag [29 (link)]. All the plasmids were propagated in DH5α E. coli cells (Stratagene, La Jolla) and plasmids were prepared using Qiagen miniprep kits (Qiagen, Germany). Pfu DNA polymerase, DpnI restriction enzyme are provided with QuikChange™ kit purchased from Stratagene, additional Pfu DNA polymerase was purchased from Promega when required. All the primers were synthesized by Eurogentec and simply purified by SePOP desalting. The melting temperature was calculated as T_m= 81.5 + 16.6(log([K+]/(1+0.7 [K+])) + 0.41(% [G+C]) – 500/(probe length in base) – 1.0(%mismatch) [30 (link)]. The T_{m pp}and T_{m no}were calculated for each primer. All primers and their T_{m no}and T_{m pp}are detailed in Table 1. PCR cycling was carried out using a Px2 thermal cycler (Thermo Electro Cooperation).
For single-site mutation, deletion or insertion, the PCR reaction of 50 μl contained 2–10 ng of template, 1 μM primer pair, 200 μM dNTPs and 3 units of Pfu DNA polymerase. The PCR cycles were initiated at 95°C for 5 minutes to denature the template DNA, followed by 12 amplification cycles. Each amplification cycle consisted of 95°C for 1 minute, T_{m no}-5°C for 1 minute and 72°C for 10 minutes or 15 minutes according to the length of the template constructs (about 500 bp per minute for Pfu DNA polymerase). The PCR cycles were finished with an annealing step at T_{m pp}-5 for 1 minute and an extension step at 72°C for 30 minutes. The PCR products were treated with 5 units of DpnI at 37°C for 2 hours and then 10 μl of each PCR reactions was analyzed by agarose gel electrophoresis. The full-length plasmid DNA was quantified by band density analysis against the 1636-bp band (equal to 10% of the mass applied to the gel) of the DNA ladders. An aliquot of 2 μl above PCR products, the PCR products generated using QuickChange™ or generated as described in [13 (link)] was transformed respectively into E. coli DH5α competent cells by heat shock. The transformed cells were spread on a Luria-Bertani (LB) plate containing antibiotics and incubated at 37°C over night. The number of colonies was counted and used as an indirect indication of PCR amplification efficiency. Four colonies from each plate were grown and the plasmid DNA was isolated. To verify the mutations, 500 ng of plasmid DNA was mixed with 50 pmole of T7 sequencing primer in a volume of 15 μl. DNA sequencing was carried out using the Sequencing Service, University of Dundee. For multiple site-directed mutations, deletions and insertions, the PCR was carried out in 50 μl of reaction containing 10 ng of template, 1 μM of each of the two primer pairs, 200 μM dNTPs and 3 units of Pfu DNA polymerase. The PCR cycles, DNA quantification, transformation and mutation verification were essentially the same as described above.

Liu H, & Naismith J.H. (2008). An efficient one-step site-directed deletion, insertion, single and multiple-site plasmid mutagenesis protocol. BMC Biotechnology, 8, 91.

Full text: Click here

Publication 2008

Antibiotics Cells Deletion Mutation DNA Restriction Enzymes Electrophoresis, Agar Gel Escherichia coli Gene Deletion Heat-Shock Response Insertion Mutation Methicillin-Resistant Staphylococcus aureus Mutation Oligonucleotide Primers Pfu DNA polymerase Plasmids Promega Proteins Pseudomonas aeruginosa TEV protease

Bacterial 16S rDNA Amplification Protocols

Cited 261 times

Per sample, two separate PCR reactions were performed in order to test two bacterial primer pairs for 16S rDNA amplification. Primer pairs were: (i): S-D-Bact-0341-b-S-17, 5′-CCTACGGGNGGCWGCAG-3′ (32 (link)), and S-D-Bact-0785-a-A-21, 5′-GACTACHVGGGTATCTAATCC-3 (32 (link)); and (ii): S-D-Bact-0008-a-S-16, 5′-AGAGTTTGATCMTGGC-3′ (33 (link)), and S-D-Bact-0907-a-A-20, 5′-CCGTCAATTCMTTTGAGTTT-3′ (34 ). The reaction was carried out in 50 µl volumes containing 0.3 mg/ml BSA (Bovine Serum Albumin), 250 µM dTNPs, 0.5 µM of each primer, 0.02 U Phusion High-Fidelity DNA Polymerase (Finnzymes OY, Espoo, Finland) and 5x Phusion HF Buffer containing 1.5 mM MgCl₂. The following PCR conditions were used: initial denaturation at 95°C for 5 min, followed by 25 cycles consisting of denaturation (95°C for 40 s), annealing (2 min) and extension (72°C for 1 min) and a final extension step at 72°C for 7 min. Annealing temperature for primer pair (i) was set at 55°C and for (ii) at 44°C. PCR products were purified with a QiaQuick PCR purification kit (QIAGEN, Hilden, Germany). The quantity and quality of the extracted DNA were analysed by spectrophotometry using an ND-1000 spectrophotometer (NanoDrop Technologies, Wilmington, DE) and by agarose gel electrophoresis. The PCR products were stored at −20°C for sequencing.

Klindworth A., Pruesse E., Schweer T., Peplies J., Quast C., Horn M, & Glöckner F.O. (2012). Evaluation of general 16S ribosomal RNA gene PCR primers for classical and next-generation sequencing-based diversity studies. Nucleic Acids Research, 41(1), e1.

Publication 2012

Bacteria Buffers DNA, Ribosomal DNA-Directed DNA Polymerase Electrophoresis, Agar Gel Magnesium Chloride Oligonucleotide Primers Serum Albumin, Bovine Spectrophotometry

Detailed eCLIP Experiment Protocol

Cited 175 times

(See Supplementary Protocol 1 for detailed Standard Operating Procedures for ENCODE-style eCLIP experiments, including oligonucleotide sequences, catalog numbers for all reagents, and specific details for eCLIP experiments). RNA binding protein (RBP)-RNA interactions were stabilized with UV crosslinking (254 nm, 400 mJ/cm²), followed by lysis in iCLIP lysis buffer, limited digestion with RNase I (Ambion), immunoprecipitation of RBP-RNA complexes with a specific primary antibody of interest using magnetic beads with pre-coupled secondary antibody (typically M-280 Sheep Anti-Rabbit IgG Dynabeads, ThermoFisher Scientific 11204D), and stringent washes. After dephosphorylation with FastAP (ThermoFisher) and T4 PNK (NEB), a barcoded RNA adapter was ligated to the 3′ end (T4 RNA Ligase, NEB) (at this step, multiple replicates of the same RBP, or potentially RBPs of similar size and bound RNA amount, can be uniquely barcoded and pooled after ligation to simplify downstream steps - see Supplementary Fig. 2a). Ligations were performed on-bead (to allow washing away unincorporated adapter) in high concentration of PEG8000, which improves ligation efficiency to > 90%. Samples were then run on standard protein gels and transferred to nitrocellulose membranes, and a region 75 kDa (~150 nt of RNA) above the protein size was isolated and proteinase K (NEB) treated to isolate RNA. RNA was reverse transcribed with AffinityScript (Agilent), and treated with ExoSAP-IT (Affymetrix) to remove excess oligonucleotides. A second DNA adapter (containing a random-mer of 5 (N₅) or 10 (N₁₀) random bases at the 5′ end) was then ligated to the cDNA fragment 3′ end (T4 RNA Ligase, NEB), performed with high concentration of PEG8000 (to improve ligation efficiency) and DMSO (to decrease inhibition of ligation due to secondary structure). After cleanup (Dynabeads MyOne Silane, ThermoFisher), an aliquot of each sample was first subjected to qPCR (to identify the proper number of PCR cycles), and then the remainder was PCR amplified (Q5, NEB) and size selected via agarose gel electrophoresis. Samples were sequenced on the Illumina HiSeq 2500 or 4000 platform as two Paired End 50bp (for N₅) or 55bp (for N₁₀) reads. All analyses were performed using identical antibody lots for RBFOX2 (A300-864A lot 002, Bethyl), SLBP (RN045P lot 001, MBL International), and IgG Isotype Control (02-6102 lot 32013, Thermo Fisher Scientific). SLBP experiments were performed with 20×10⁶ cells and 10 ug of primary antibody; RBFOX2 experiments were performed with 20×10⁶ cells and 10 ug (eCLIP Rep1 and Rep2) or 10×10⁶ cells and 5 ug (RNase I variation experiments). All experiments in K562 and HepG2 cells were performed with 20×10⁶ cells and 10 ug of indicated primary antibody (Supplementary Table 2). Antibody validation documentation (including Western images of immunoprecipitation and shRNA knockdown^{19 (link)}) are available at http://www.encodeproject.org/. Additional experiments performed in K562 and HepG2 cells in which the antibody failed to successfully immunoprecipitate the targeted RBP were excluded from analysis. 293T cells were obtained from Clontech (Lenti-X 293T cell line). K562 and HepG2 cells were purchased from ATCC, and were not independently verified. Cells were routinely tested for mycoplasma using MycoAlert PLUS (Lonza).

Van Nostrand E.L., Pratt G.A., Shishkin A.A., Gelboin-Burkhart C., Fang M.Y., Sundararaman B., Blue S.M., Nguyen T.B., Surka C., Elkins K., Stanton R., Rigo F., Guttman M, & Yeo G.W. (2016). Robust transcriptome-wide discovery of RNA binding protein binding sites with enhanced CLIP (eCLIP). Nature methods, 13(6), 508-514.

Publication 2016

anti-IgG Buffers Cell Lines Cells Digestion DNA, Complementary Domestic Sheep Electrophoresis, Agar Gel Endopeptidase K Gels HEK293 Cells Hep G2 Cells Immunoglobulin Isotypes Immunoglobulins Immunoprecipitation Ligation M 280 Mycoplasma Nitrocellulose Oligonucleotides polyethylene glycol 8000 Proteins Psychological Inhibition Rabbits Ribonuclease, Pancreatic RNA-Binding Proteins RNA Ligase (ATP) Short Hairpin RNA Silanes Sulfoxide, Dimethyl Tissue, Membrane

Primer Design and qRT-PCR Analysis

Cited 90 times

Full-length gene sequences were extracted from WormBase (Release WS170) and primers were designed by the Primer3 software [31 ] and tested for specifity using NCBI BLAST. The targets amplified by the primer pairs were evaluated with MFOLD software [32 ] in order to check for the formation of secondary structures at the site of primer binding. MFOLD analysis was performed using default settings and 50 mM Na⁺, 3 mM Mg²⁺and a temperature of 60°C (which is the annealing temperature of the primers). Primers were purchased from Invitrogen. Primer and amplicon information are listed in Table 3.
Quantitative RT-PCR was carried out using a Rotor-Gene 2000 centrifugal real-time cycler (Corbett Research) using the Platinum SYBR Green qPCR SuperMix-UDG (Invitrogen). Each reaction contained: 12.5 μl of the Platinum SYBR Green qPCR SuperMix-UDG, 200 nM, 300 nM or 400 nM of forward and reverse primers and 5 μl cDNA (1:40 RNA dilution), to a final volume of 25 μl. Amplification was performed in 0.1 ml real-time PCR tubes (Corbett Research) placed in the 72-well rotor of the Rotor-Gene instrument. The cycling conditions were as follows: 50°C for 2 min, initial denaturation at 95°C for 2 min, followed by 45 cycles of 15 s at 95°C, 30 s at 60°C, and 30 s at 72°C (gain set at 8 for SYBR Green). Following the final cycle, melting curve analysis was performed to examine the specificity in each reaction tube (absence of primer dimers and other nonspecific products). The Rotor-Gene software allows automatic melting curve analysis for all tested samples in a given run. SYBR Green fluorescence of the generated products was continuously monitored throughout the temperature ramp from 60 to 99°C. The temperature rose in 1° increments with a 5 s hold at each degree. A single melt peak for each reaction confirmed the identity of each PCR product. Each assay included a no-template control for every primer pair. In addition, aliquots of each reaction mixture were analyzed by agarose gel electrophoresis to evaluate amplification of nonspecific products.

Hoogewijs D., Houthoofd K., Matthijssens F., Vandesompele J, & Vanfleteren J.R. (2008). Selection and validation of a set of reliable reference genes for quantitative sod gene expression analysis in C. elegans. BMC Molecular Biology, 9, 9.

Full text: Click here

Publication 2008

Binding Sites Biological Assay DNA, Complementary Electrophoresis, Agar Gel Fluorescence Genes Oligonucleotide Primers Platinum Real-Time Polymerase Chain Reaction Reverse Transcriptase Polymerase Chain Reaction SYBR Green I Technique, Dilution

Most recents protocols related to «Electrophoresis, Agar Gel»

Candidate Gene Screening for Tobacco Mutants

Not available on PMC !

Example 5

Three tobacco lines, FC401 wild type (Wt); FC40-M207 mutant line fourth generation (M4) and FC401-M544 mutant line fourth generation (M4) were used for candidate gene screening. Low anatabine traits were confirmed for the two tobacco mutant lines (M207 and M544) in root and leaf before screening (see FIG. 3).

RNA was extracted from root tissues of wild type (Wt) FC401, M207 and M544 with RNeasy Plus Mini kit from Quiagen Inc. following the manufacturer's protocol. cDNA libraries were prepared from the RNAs using In-Fusion® SMARTer® Directional cDNA Library Construction Kit from Clontech Inc. cDNA libraries were diluted to 100 ng/μl and used as the template for candidate gene PCR screening.

PCR amplifications were performed in 50 μl final volumes that contained 50-100 ng of template DNA (i.e., the cDNA library) and 0.2 μM of primers (Fisher Scientific) using the Platinum® Taq DNA Polymerase High Fidelity kit (Life Technology Inc.). Thermocycling conditions included a 5 min incubation at 94° C.; followed by 34 cycles of 30 seconds at 94° C., 30 seconds at 58° C., 1 min 30 seconds at 68° C.; with a final reaction step of 68° C. for 7 mins. The PCR products were evaluated by agarose gel electrophoresis, and desired bands were gel purified and sequenced using an ABI 3730 DNA Analyzer (ABI).

51 candidate genes (listed in Table 4) were cloned from F401, Wt, M207 and M544 lines, and sequenced for single nucleotide polymorphism (SNP) detection.

TABLE 4

Listing of Candidate Genes for Screening

Quinolinate Synthase A-1Pathogenesis related protein 1

Allene oxide synthaseAllene oxide cyclase

ET861088.1 Methyl esteraseFH733463.1 TGACG-sequence specific transcription factor

FH129193.1 Aquaporin-TransportFH297656.1 Universal stress protein

Universal stress protein Tabacum sequenceFH077657.1 Scarecrow-like protein

FH864888.1 EIN3-binding F-box proteinFH029529.1 4,5 DOPA dioxygenase

FI010668.1 Ethylene-responsive transcription EB430189 Carboxylesterase

factor

DW001704 Glutathione S transferaseEB683763 Bifunctional inhibitor/lipid transfer protein/seed

storage 2S albumin

DW002318 Serine/threonine protein kinaseDW004086 Superoxide dismutase

DW001733 Lipid transfer protein DIRIDW001944 Protein phosphatase 2C

DW002033EB683763 Bifunctional inhibitor/lipid transfer protein/seed

storage 2S albumin

DW002318 Serine/threonine protein kinaseDW002576 Glycosyl hydrolase of unknown function DUF1680

EB683279EB683763

EB683951FG141784 (FAD Oxidoreductase)

BBLa-Tabacum sequencesBBLb

BBLeBBLd

PdrlPdr2

Pdr3Pdr5a

Pdr5bNtMATEl

NtMATE2NtMATE3

WRKY8EIG-I24

WRKY3WRKY9

EIG-E17AJ748263.1 QPT2 quinolinate phosphoribosyltransferase

AJ748262.1 QPT1

US11873500B2. Genetic locus imparting a low anatabine trait in tobacco and methods of using (2024-01-16). ALTRIA CLIENT SERVICES LLC [US]. Inventors: Chengalrayan Kudithipudi [US], Alec J. Hayes [US], Robert Frank Hart [US], Yanxin Shen [US], Jesse Frederick [US], Dongmei Xu [US].

Full text: Click here

Patent 2024

Albumins allene oxide cyclase allene oxide synthase Amino Acid Sequence anatabine Carboxylesterase cDNA Library Dioxygenases Dopa Electrophoresis, Agar Gel Esterases Ethylenes Genes Glutathione S-Transferase Heat Shock Proteins Histocompatibility Testing Hydrolase lipid transfer protein Neoplasm Metastasis Nicotiana Nicotinate-nucleotide pyrophosphorylase (carboxylating) NOS1 protein, human Oligonucleotide Primers Oxidoreductase pathogenesis Plant Leaves Plant Roots Platinum Protein-Serine-Threonine Kinases Protein-Threonine Phosphatase Protein Kinases protein methylesterase Protein Phosphatase Protein Phosphatase 2C Proteins Quinolinate RNA Single Nucleotide Polymorphism Superoxide Dismutase Synapsin I Taq Polymerase Transcription, Genetic Transcription Factor Transfer Factor Water Channel

In Vitro Transcription for Customized mRNA Synthesis

Not available on PMC !

Example 3

The in vitro transcription reactions can generate polynucleotides containing uniformly modified polynucleotides. Such uniformly modified polynucleotides can comprise a region or part of the polynucleotides of the invention. The input nucleotide triphosphate (NTP) mix can be made using natural and un-natural NTPs.

A typical in vitro transcription reaction can include the following:

- 1 Template cDNA—1.0
- 2 10× transcription buffer (400 mM Tris-HCl pH 8.0, 190 mM MgCl₂, 50 mM DTT, mM Spermidine)—2.0
- 3 Custom NTPs (25 mM each)—7.2 μl
- 4 RNase Inhibitor—20 U
- 5 T7 RNA polymerase—3000 U
- 6 dH₂O—Up to 20.0 μl. and
- 7 Incubation at 37° C. for 3 hr-5 hrs.

The crude IVT mix can be stored at 4° C. overnight for cleanup the next day. 1 U of RNase-free DNase can then be used to digest the original template. After 15 minutes of incubation at 37° C., the mRNA can be purified using Ambion's MEGACLEAR™ Kit (Austin, TX) following the manufacturer's instructions. This kit can purify up to 500 μg of RNA. Following the cleanup, the RNA can be quantified using the NanoDrop and analyzed by agarose gel electrophoresis to confirm the RNA is the proper size and that no degradation of the RNA has occurred.

US11859215B2. Polynucleotides encoding ornithine transcarbamylase for the treatment of urea cycle disorders (2024-01-02). ModernaTX, Inc. [US]. Inventors: Zhijian Zhuo [US], Andrea Lea Frassetto [US], Paolo G. V. Martini [US], Vladimir Presnyak [US], Patrick Finn [US].

Full text: Click here

Patent 2024

austin Buffers Deoxyribonuclease I DNA, Complementary DNA-Directed RNA Polymerase Electrophoresis, Agar Gel Endoribonucleases Magnesium Chloride Nucleotides Polynucleotides ribonuclease U RNA, Messenger RNA Degradation Spermidine Transcription, Genetic triphosphate Tromethamine

Fusion Polypeptide Library Construction

Not available on PMC !

Example 6

Each plasmid containing EBP, CalM, or a Cys-incorporated block was used to prepare genes for the fusion polypeptide libraries of EBP[G₁A₃F₂]_n-CalM-EBP[G₁A₃F₂]_nwith Cys blocks at both ends. A plasmid vector harboring an EBP gene was digested and dephosphorylated with 10 U of XbaI, 10 U of BseRI and 10 U of FastAP, a thermosensitive alkaline phosphatase, in CutSmart buffer for 30 minutes at 37° C. The restricted plasmid DNA was purified using a PCR purification kit, and then was eluted in 40 μl of distilled and deionized water. A total of 4 μg of the CalM gene was digested with 10 U of XbaI and 15 U of AcuI in the CutSmart buffer for 30 minutes at 37° C. to prepare the CalM gene as an insert, followed by separation using agarose gel electrophoresis and purification using a gel extraction kit. A ligation reaction was performed by incubating 90 pmol of the purified insert with 30 pmol of the linearized vector in T4 DNA ligase buffer containing 1 U of T4 DNA ligase for 30 minutes at 16° C. The product was transformed into Top10 chemically competent cells, then the cells were plated on a SOC plate supplemented with 50 μg/ml of ampicillin. Transformants were initially screened by a diagnostic restriction digest on an agarose gel and further confirmed by DNA sequencing as described above.

US11866470B2. Polypeptides with phase transition, triblock polypeptides of the polypeptide-calmodulin-polypeptide with multi-stimuli responsiveness, hydrogel of the triblock polypeptides, and its uses (2024-01-09). INDUSTRY-UNIVERSITY COOPERATION FOUNDATION HANYANG UNIVERSITY ERICA CAMPUS [KR]. Inventors: Dong Woo Lim [KR], Jae Sang Lee [KR], Min Jung Kang [KR].

Full text: Click here

Patent 2024

Alkaline Phosphatase Ampicillin Buffers Cells Cloning Vectors Diagnosis Electrophoresis, Agar Gel Gene Library Genes Genes, vif Ligation Plasmids Polypeptides Sepharose T4 DNA Ligase

Reducing C9orf72 Transcripts via CRISPR-Cas9

Not available on PMC !

Example 2

In this example, guide RNAs were designed to target exon 3 after the ATG initiation codon of C9orf72 (Table 2). The strategy was to introduce small indels that will lead to early termination codon, thus inducing non-sense mediated decay of C9orf72 transcripts to reduce RNA foci and dipeptide formation. FIG. 6A shows the human C9orf72 gene sequence of exon 3 with the locations of the non-sense mediated decay (NMD) guide RNA 1r and 2f and the location and sequence of PCR indel analysis primers C9NMD Indel F1 and R1 marked. FIG. 6B shows the results of agarose gel electrophoresis of the PCR products amplified by the C9NMD-Indel F1 and R1 PCR primers. In this example, HEK293T cells were transfected with LV-SpCas9 (Control) or LV-NMDgR-SpCas9 plasmid (2 μg) in triplicate. FIG. 6C shows the results of digital droplet PCT (ddPCR) analysis of the C9orf72 RNA levels from FIG. 6B.

TABLE 2

Guide RNAs generated for

“Non-sense mediated decay.”

SEQ

guide RNAguide RNA sequenceNO:

NMD gRNA 1rUCGAAAUGCAGAGAGUGGUG5

NMD gRNA 2fAAUGGGGAUCGCAGCACAUA6

US11859179B2. Methods of treating amyotrophic lateral sclerosis (ALS) (2024-01-02). University of Massachusetts [US]. Inventors: Christian Mueller [US], Abbas Abdallah [US].

Full text: Click here

Patent 2024

Cells Codon, Initiator Codon, Terminator Dipeptides Electrophoresis, Agar Gel Exons Fingers INDEL Mutation Oligonucleotide Primers Plasmids RNA RNA Decay RNA Sequence Sequence Analysis

Clonal Plant Genomic DNA Sequencing

Not available on PMC !

Example 9

Leaf tissue is collected from clonal plants separated for transplanting and analyzed as individuals. Genomic DNA is extracted using a Wizard@ 96 Magnetic DNA Plant System kit (Promega, U.S. Pat. No. 6,027,945 & U.S. Pat. No 6,368,800) as directed by the manufacturer. Isolated DNA is PCR amplified using the appropriate forward and reverse primer.

PCR amplification is performed using Hotstar Taq DNA Polymerase (Qiagen) using touchdown thermocycling program as follows: 96° C. for 15 min, followed by 35 cycles (96° C., 30 sec; 58° C. -0.2° C. per cycle, 30 sec; 72° C., 3 min and 30 sec), 10 min at 72° C. PCR products are verified for concentration and fragment size via agarose gel electrophoresis. Dephosphorylated PCR products are analyzed by direct sequence using the PCR primers (DNA Landmarks, or Entelechon). Chromatogram trace files (.scf) are analyzed for mutation relative to the wild-type gene using Vector NTI Advance 10™ (Invitrogen). Based on sequence information, mutations are identified in several individuals. Sequence analysis is performed on the representative chromatograms and corresponding AlignX alignment with default settings and edited to call secondary peaks.

US11879132B2. Plants having increased tolerance to herbicides (2024-01-23). BASF AGRO B.V. [NL]. Inventors: Raphael Aponte [DE], Stefan Tresch [DE], Dario Massa [DE], Matthias Witschel [DE], Tobias Seiser [DE], Jill Marie Paulik [US].

Full text: Click here

Patent 2024

Base Sequence Clone Cells Cloning Vectors Electrophoresis, Agar Gel Genes Genome Mutation Oligonucleotide Primers Plant Leaves Plants Promega Sequence Analysis Taq Polymerase Tissues

Top products related to «Electrophoresis, Agar Gel»

Trizol reagent by Thermo Fisher Scientific

Sourced in United States, China, Japan, Germany, United Kingdom, Canada, France, Italy, Australia, Spain, Switzerland, Netherlands, Belgium, Lithuania, Denmark, Singapore, New Zealand, India, Brazil, Argentina, Sweden, Norway, Austria, Poland, Finland, Israel, Hong Kong, Cameroon, Sao Tome and Principe, Macao, Taiwan, Province of China, Thailand

TRIzol reagent is a monophasic solution of phenol, guanidine isothiocyanate, and other proprietary components designed for the isolation of total RNA, DNA, and proteins from a variety of biological samples. The reagent maintains the integrity of the RNA while disrupting cells and dissolving cell components.

Nanodrop 2000 by Thermo Fisher Scientific

Sourced in United States, China, Germany, Japan, United Kingdom, Spain, Canada, France, Australia, Italy, Switzerland, Sweden, Denmark, Lithuania, Belgium, Netherlands, Uruguay, Morocco, India, Czechia, Portugal, Poland, Ireland, Gabon, Finland, Panama

The NanoDrop 2000 is a spectrophotometer designed for the analysis of small volume samples. It enables rapid and accurate quantification of proteins, DNA, and RNA by measuring the absorbance of the sample. The NanoDrop 2000 utilizes a patented sample retention system that requires only 1-2 microliters of sample for each measurement.

Agilent 2100 bioanalyzer by Agilent Technologies

Sourced in United States, Germany, Canada, China, France, United Kingdom, Japan, Netherlands, Italy, Spain, Australia, Belgium, Denmark, Switzerland, Singapore, Sweden, Ireland, Lithuania, Austria, Poland, Morocco, Hong Kong, India

The Agilent 2100 Bioanalyzer is a lab instrument that provides automated analysis of DNA, RNA, and protein samples. It uses microfluidic technology to separate and detect these biomolecules with high sensitivity and resolution.

Trizol by Thermo Fisher Scientific

Sourced in United States, Germany, China, Japan, United Kingdom, Canada, France, Italy, Australia, Spain, Switzerland, Belgium, Denmark, Netherlands, India, Ireland, Lithuania, Singapore, Sweden, Norway, Austria, Brazil, Argentina, Hungary, Sao Tome and Principe, New Zealand, Hong Kong, Cameroon, Philippines

TRIzol is a monophasic solution of phenol and guanidine isothiocyanate that is used for the isolation of total RNA from various biological samples. It is a reagent designed to facilitate the disruption of cells and the subsequent isolation of RNA.

Rneasy mini kit by Qiagen

Sourced in Germany, United States, United Kingdom, Netherlands, Spain, Japan, Canada, France, China, Australia, Italy, Switzerland, Sweden, Belgium, Denmark, India, Jamaica, Singapore, Poland, Lithuania, Brazil, New Zealand, Austria, Hong Kong, Portugal, Romania, Cameroon, Norway

The RNeasy Mini Kit is a laboratory equipment designed for the purification of total RNA from a variety of sample types, including animal cells, tissues, and other biological materials. The kit utilizes a silica-based membrane technology to selectively bind and isolate RNA molecules, allowing for efficient extraction and recovery of high-quality RNA.

Nanodrop 2000 spectrophotometer by Thermo Fisher Scientific

Sourced in United States, Germany, China, United Kingdom, Japan, Canada, France, Italy, Australia, Spain, Denmark, Switzerland, Singapore, Poland, Ireland, Belgium, Netherlands, Lithuania, Austria, Brazil

The NanoDrop 2000 spectrophotometer is an instrument designed to measure the concentration and purity of a wide range of biomolecular samples, including nucleic acids and proteins. It utilizes a unique sample retention system that requires only 1-2 microliters of sample to perform the analysis.

Nanodrop by Thermo Fisher Scientific

Sourced in United States, Germany, United Kingdom, China, France, Japan, Canada, Italy, Belgium, Australia, Denmark, Spain, Sweden, India, Finland, Switzerland, Poland, Austria, Brazil, Singapore, Portugal, Macao, Netherlands, Taiwan, Province of China, Ireland, Lithuania

The NanoDrop is a spectrophotometer designed for the quantification and analysis of small volume samples. It measures the absorbance of a sample and provides accurate results for DNA, RNA, and protein concentration measurements.

Nanodrop nd 1000 spectrophotometer by Thermo Fisher Scientific

Sourced in United States, Germany, United Kingdom, France, Spain, Australia, Japan, Italy, China, Canada, Denmark, Sweden, Belgium, Norway, Switzerland, Singapore, Cameroon, Israel, Finland, Portugal

The NanoDrop ND-1000 spectrophotometer is a compact and easy-to-use instrument designed for the quantification of small volume samples. It utilizes a proprietary sample retention system to measure the absorbance of samples as small as 1 μL, making it suitable for a wide range of applications in molecular biology, genomics, and biochemistry.

Qubit 2.0 fluorometer by Thermo Fisher Scientific

Sourced in United States, Germany, United Kingdom, China, Canada, France, Singapore, Italy, Japan, Switzerland, Australia, Netherlands, Belgium, Sweden, Denmark, Austria, Portugal, India, Spain, Brazil, Norway, Ireland, Lithuania

The Qubit 2.0 Fluorometer is a compact and sensitive instrument designed for quantifying nucleic acids and proteins. It utilizes fluorescent dye-based detection technology to provide accurate and reproducible measurements of sample concentrations. The Qubit 2.0 Fluorometer is a self-contained unit that can be used for a variety of applications in research and clinical settings.

Nanodrop spectrophotometer by Thermo Fisher Scientific

Sourced in United States, Germany, United Kingdom, China, Canada, Japan, Italy, France, Australia, Poland, Belgium, Switzerland, Spain, Austria, Netherlands, Singapore, India, Ireland, Sweden, Denmark, Israel, Malaysia, Argentina, Slovakia, Finland

The NanoDrop spectrophotometer is a compact and efficient instrument designed for the measurement of small-volume samples. It utilizes a patented sample-retention technology to enable accurate and reproducible spectroscopic analyses of various biomolecules, including nucleic acids and proteins, in a simple and convenient manner.

What are some common challenges with Electrophoresis, Agar Gel?

One of the main challenges with Electrophoresis, Agar Gel is ensuring proper sample preparation and loading to achieve optimal separation. Incomplete sample solubilization or uneven loading can lead to poor resolution and inaccurate results. Additionally, maintaining a consistent buffer pH and temperature throughout the run is critical for consistent migration patterns.

How can PubCompare.ai help with Electrophoresis, Agar Gel research?

PubCompare.ai's AI-driven platform can be extremely helpful for Electrophoresis, Agar Gel research. The tool allows you to efficiently screen protocol literature from published articles, preprints, and patents to identify the most effective and reproducible methods for your specific needs. The platform's intelligent comparisons can highlight key differences in protocol performance, buffer compositions, and other critical factors, enabeling you to choose the optimal approach for your experiments. This can save valuable time and improve the accuracy and reliability of your Electrophoresis, Agar Gel results.

What are the different types or variations of Electrophoresis, Agar Gel?

Electrophoresis, Agar Gel can be performed using various buffer systems and gel concentrations depending on the specific biomolecules being analyzed. Common variations include native PAGE (for native protein analysis), SDS-PAGE (for denatured protein analysis), and agarose gel electrophoresis (for nucleic acid separation). Each variation offers unique advantages and is suited for different applications, such as protein profiling, DNA fragment analysis, or RNA purification.

How can Electrophoresis, Agar Gel be used in clinical diagnostics?

Electrophoresis, Agar Gel is an indispensable technique in clinical diagnostics, particularly for the analysis of serum proteins and hemoglobin variants. By separating and quantifying specific protein fractions, such as albumin, globulins, and immunoglobulins, clinicians can detect and monitor various disease states, including liver disorders, kidney diseases, and autoimmune conditions. Additionally, the separation of hemoglobin variants allows for the diagnosis of hemoglobin disorders, such as sickle cell anemia and thalassemia.

What are some best practices for optimizing Electrophoresis, Agar Gel experiments?

To optimize Electrophoresis, Agar Gel experiments, it's important to carefully consider factors such as gel concentration, buffer composition, sample preparation, and run conditions. For example, higher agarose concentrations (e.g., 1-2%) are typically used for separating larger biomolecules like proteins, while lower concentrations (e.g., 0.5-1%) are better suited for nucleic acid analysis. Additionally, ensuring consistent temperature and voltage throughout the run can improve resolution and reproducibility. Consulting the relavant literature and using PubCompare.ai to identify the most effective protocols can greatly enhance the success of your Electrophoresis, Agar Gel experiments.

More about "Electrophoresis, Agar Gel"

Gel electrophoresis, agarose gel electrophoresis, AGE, biological macromolecule separation, protein analysis, nucleic acid analysis, carbohydrate separation, biomolecular characterization, molecular weight determination, TRIzol reagent, NanoDrop 2000, Agilent 2100 Bioanalyzer, RNeasy Mini Kit, Qubit 2.0 Fluorometer.
Agar gel electrophoresis is a powerful analytical technique used to separate and analyze complex biomolecular mixtures, such as proteins, nucleic acids, or carbohydrates.
In this method, the sample is loaded onto an agarose gel matrix, and an electrical field is applied, causing the charged molecules to migrate through the gel at different rates based on their size and charge.
This separation allows for the identification, quantification, and purification of specific biomolecules.
Agar gel electrophoresis is a versatile tool in fields like biochemistry, molecular biology, and clinical diagnostics, enabling researchers to gain insights into the structure and function of biological macromolecules.
With its high resolution and sensitivity, this technique is indispensable for many life science applications.
Complimentary techniques like TRIzol reagent for RNA extraction, NanoDrop 2000 and Agilent 2100 Bioanalyzer for nucleic acid quantification and quality assessment, and Qubit 2.0 Fluorometer for sensitive protein quantification can be used in conjunction with agar gel electrophoresis to provide a comprehensive analysis of biomolecules.
The NanoDrop spectrophotometer is a widely used tool for quick and accurate measurement of nucleic acid and protein concentrations.
Whether you're studying proteins, nucleic acids, or carbohydrates, agar gel electrophoresis is an indispensable technique for your life science research.