> Procedures > Laboratory Procedure > Electrophoresis, Capillary

Electrophoresis, Capillary

Electrophoresis, Capillary is a powerful technique used in scientific research to separate and analyze complex mixtures of biomolecules, such as proteins, nucleic acids, and small molecules.
This method utilizes narrow-bore capillary tubes filled with a buffer solution, through which an electric field is applied, causing the charged analytes to migrate at different rates based on their size, charge, and other physicochemical properties.
Capillary electrophoresis offers high resolution, speed, and sensitivity, making it a valuable tool for a wide range of applications, including clinical diagnostics, forensics, and basic research in fields like biochemistry and molecular biology.
The technique's ability to handle miniture sample volumes and provide rapid, high-throughput analysis has made it an indispensible part of the modern scientific workflow.
Reasearchers can leverge the power of capillary electrophoresis to enhance the reproducibility and efficiency of their Electrophoresis, Capillary research projects.

Most cited protocols related to «Electrophoresis, Capillary»

Metabolite Profiling by CE-TOF-MS

Cited 105 times

The metabolite standards, instrumentation and CE-TOF-MS condition were used in this study as previously described (Soga et al. 2006 (link)), with slight modifications in the lock mass system setting. All chemical standards were of analytical or reagent grade and were obtained from commercial sources. They were dissolved in Milli-Q water (Millipore, Bedford, MA, USA), 0.1 mol/l HCl or 0.1 mol/l NaOH to obtain 1, 10 or 100 mmol/l stock solutions. The working solution was prepared prior to use by diluting with Milli-Q water to the appropriate concentration.
All CE-MS experiments were performed using an Agilent CE capillary electrophoresis system (Agilent Technologies, Waldbronn, Germany), an Agilent G3250AA LC/MSD TOF system (Agilent Technologies, Palo Alto, CA, USA), an Agilent 1100 series binary HPLC pump, and the G1603A Agilent CE-MS adapter and G1607A Agilent CE-ESI-MS sprayer kit. System control and data acquisition were done with G2201AA Agilent Chemstation software for CE and Analyst QS software for TOF-MS (ver. 1.1).
All samples were measured in single mode (see below); separation was done in fused-silica capillaries (50 μm i.d. × 100 cm total length) filled with 1 M formic acid as the background electrolyte. Sample solutions were injected at 50 mbar for 3 s and a voltage of 30 kV was applied. The capillary temperature was maintained at 20°C and the temperature of the sample tray was kept below 5°C using an external thermostatic cooler. The sheath liquid, comprising methanol/water (50% v/v) and 0.5 μM reserpine, was delivered at 10 μl/min. ESI-TOF-MS was conducted in the positive ion mode. The capillary voltage was set at 4 kV; the flow rate of nitrogen gas (heater temperature 300°C) was set at 10 psig. In TOF-MS, the fragmentor, skimmer and OCT RFV voltage were set at 75, 50 and 125 V, respectively. In the present study, we used a methanol dimer adduct ion ([2MeOH + H]⁺, m/z 65.059706) and hexakis phosphazene ([M + H]⁺, m/z 622.028963) to provide the lock mass for exact mass measurements. Exact mass data were acquired at the rate of 1.5 cycles/s over a 50–1000 m/z range.

Sugimoto M., Wong D.T., Hirayama A., Soga T, & Tomita M. (2009). Capillary electrophoresis mass spectrometry-based saliva metabolomics identified oral, breast and pancreatic cancer-specific profiles. Metabolomics, 6(1), 78-95.

Publication 2009

Capillaries Electrolytes Electrophoresis, Capillary formic acid High-Performance Liquid Chromatographies Methanol Nitrogen Reserpine Silicon Dioxide

Metabolite Analysis by CE-TOF-MS

Cited 96 times

Publication 2009

Capillaries Electrolytes Electrophoresis, Capillary formic acid High-Performance Liquid Chromatographies Methanol Nitrogen Reserpine Silicon Dioxide

Zika Virus Genome Sequencing and Phylogenetic Analysis

Cited 83 times

RNA was extracted from patient samples that demonstrated the highest concentration of ZIKV RNA determined by the real-time assay, and for which sufficient sample volume was available (patients 824, 037, 830a, and 958). Briefly, RNA was extracted from 150 μL of serum by using the QIAamp Viral RNA Mini Kit (QIAGEN), and RNA was eluted with 75 μL of RNase-free water. A series of RT-PCRs was performed with each RNA preparation by using primer pairs designed to generate overlapping DNA fragments that spanned the entire polyprotein coding region of the virus. Primers were designed by using the ZIKV MR 766 prototype virus coding region sequence (GenBank accession no. AY632535) and the PrimerSelect software module of the LaserGene package (DNASTAR Inc., Madison, WI, USA). Several primers initially failed to amplify because of sequence mismatches between ZIKV MR 766 and ZIKV Yap 2007. Therefore, primers were redesigned by using newly generated DNA sequence data, and a “genome walking” approach was used to derive complete coding region sequence data. The complete list of amplification and sequencing primers is available upon request.
All RT-PCRs were performed with 10 μL of RNA by using the OneStep RT-PCR Kit (QIAGEN) following the manufacturer’s protocol. DNAs were analyzed by 2% agarose gel electrophoresis, and bands of the predicted size were excised from the gel and purified by using the QIAquick Gel Extraction Kit (QIAGEN). Purified DNAs were subjected to nucleic acid sequence analysis with sequencing primers spaced ≈500 bases apart on both strands of the DNA fragments by using the ABI BigDye Terminator V3.1 Ready Reaction Cycle Sequencing Mixture (Applied Biosystems). Nucleotide sequence was determined by capillary electrophoresis by using the ABI 3130 genetic analyzer (Applied Biosystems) following the manufacturer’s protcol. Raw sequence data were aligned and edited by using the SeqMan module of LaserGene (DNASTAR Inc.). Because of insufficient sample volume, no patient RNA was sufficient to generate DNA that included the entire coding region. Therefore, DNA data obtained from 4 patients was combined to generate a consensus sequence heretofore designated the ZIKV 2007 epidemic consensus (EC) sequence (GenBank accession no. EU545988).
The complete coding region of ZIKV 2007 EC or the nonstructural protein 5 (NS5) gene subregion was aligned with all available flavivirus sequences in GenBank by using the Clustal W algorithm within the MEGA version 4 software package (www.megasoftware.net). Phylogenetic trees were constructed by using either the complete coding region or the NS5 region because a large number of NS5 sequences were available in GenBank and trees for the NS5 region have been constructed (16 (link)). Additional ZIKV strains from the CDC/World Health Organization reference collection (strains 41662, 41524, and 41525) isolated from Aedes spp. mosquitoes collected in Senegal in 1984 were also amplified by RT-PCR in the NS5 region and subjected to nucleic acid sequencing as described above and included in the NS5 region analysis. Trees were constructed from coding region data or from NS5 data by MEGA 4 from aligned nucleotide sequences. We used maximum parsimony, neighbor-joining, or minimum evolution algorithms with 2,000 replicates for bootstrap support of tree groupings. All trees generated nearly identical topology; only the neighbor-joining NS5 tree is shown (Figure 1).

Lanciotti R.S., Kosoy O.L., Laven J.J., Velez J.O., Lambert A.J., Johnson A.J., Stanfield S.M, & Duffy M.R. (2008). Genetic and Serologic Properties of Zika Virus Associated with an Epidemic, Yap State, Micronesia, 2007. Emerging Infectious Diseases, 14(8), 1232-1239.

Full text: Click here

Publication 2008

ABI1 protein, human Aedes Base Sequence Biological Assay Biological Evolution Consensus Sequence Culicidae Electrophoresis, Agar Gel Electrophoresis, Capillary Endoribonucleases Epidemics Flavivirus Genes Genome Oligonucleotide Primers Patients Polyproteins Proteins Reproduction Reverse Transcriptase Polymerase Chain Reaction RNA, Viral Serum Strains Trees Virus Zika Virus

Targeted Loci Amplification and Sequencing

Cited 68 times

PCR reactions to amplify targeted loci were performed using the primers shown in Supplementary Table 5. For most loci, we were able to use standard PCR conditions with Phusion Hot Start II high-fidelity DNA polymerase (Thermo-Fisher) performed according to manufacturer’s instructions for 35 cycles (98°C, 10 s denaturation; 68°C, 15 s annealing; 72°C, 30 s extension). For loci that did not amplify under standard conditions we used one of the following modifications: 1) the addition of betaine to a final concentration of 1.8M, 2) touchdown PCR ([98°C, 10 s; 72–62°C, −1°C/cycle, 15s; 72°C, 30s]_{10 cycles}, [98°C, 10 s; 62°C, −1°C/cycle, 15s; 72°C, 30s]_{25 cycles}) with 1.8M betaine, and 3) the addition of 3% or 5% DMSO and an annealing temperature of 65°C. PCR products were analyzed for correct size on a QIAxcel capillary electrophoresis system. Correctly sized products were treated with ExoSap-IT (Affymetrix) to remove unincorporated nucleotides or primers and sent for DNA sequencing to confirm the endogenous gene sequence.

Reyon D., Tsai S.Q., Khayter C., Foden J.A., Sander J.D, & Joung J.K. (2012). FLASH Assembly of TALENs Enables High-Throughput Genome Editing. Nature biotechnology, 30(5), 460-465.

Publication 2012

Betaine DNA Polymerase II Electrophoresis, Capillary Genes Nucleotides Oligonucleotide Primers Sulfoxide, Dimethyl Training Programs

Single-Cell RNA Sequencing of Human and Mouse Lung Cells

Cited 67 times

mRNA from single cells sorted from human and mouse lungs and human blood into lysis plates was reverse transcribed to complementary DNA (cDNA) and amplified as previously described^{2 (link)}. Illumina sequencing libraries for cDNA from single cells were prepared as previously described^{2 (link)}. Briefly, cDNA libraries were prepared using the Nextera XT Library Sample Preparation kit (Illumina, FC-131–1096). Nextera tagmentation DNA buffer (Illumina) and Tn5 enzyme (Illumina) were added, and the sample was incubated at 55°C for 10 minutes. The reaction was neutralized by adding “Neutralize Tagment Buffer” (Illumina) and centrifuging at room temperature at 3,220 x g for 5 minutes. Mouse samples were then indexed via PCR by adding i5 indexing primer, i7 indexing primer, and Nextera NPM mix (Illumina). Human samples were similarly indexed via PCR using custom, dual-unique indexing primers (IDT)^{2 (link)}.
Following library preparation, wells of each library plate were pooled using a Mosquito liquid handler (TTP Labtech), then purified twice using 0.7x AMPure beads (Fisher A63881). Library pool quality was assessed by capillary electrophoresis on a Tapestation system (Agilent) with either a high sensitivity or normal D5000 ScreenTape assay kit (Agilent) or Fragment analyzer (AATI), and library cDNA concentrations were quantified by qPCR (Kapa Biosystems KK4923) on a CFX96 Touch Real-Time PCR Detection System (Biorad). Plate pools were normalized and combined equally to make each sequencing sample pool. A PhiX control library was spiked in at 1% before sequencing. Human libraries were sequenced on a NovaSeq 6000 (Illumina) and mouse libraries on a NextSeq 500 (Illumina).
Cells isolated from each compartment (“immune and endothelial enriched”, “epithelial enriched”, “stromal”) and subject blood were captured in droplet emulsions using a Chromium Single-Cell instrument (10x Genomics) and libraries were prepared using the 10x Genomics 3’ Single Cell V2 protocol as previously described^{2 (link)}. All 10x libraries were pooled and sequenced on a NovaSeq 6000 (Illumina).

Travaglini K.J., Nabhan A.N., Penland L., Sinha R., Gillich A., Sit R.V., Chang S., Conley S.D., Mori Y., Seita J., Berry G.J., Shrager J.B., Metzger R.J., Kuo C.S., Neff N., Weissman I.L., Quake S.R, & Krasnow M.A. (2020). A molecular cell atlas of the human lung from single cell RNA sequencing. Nature, 587(7835), 619-625.

Publication 2020

Biological Assay BLOOD Buffers cDNA Library Cells Chromium Culicidae cyclo(D-tyrosyl-arginyl-arginyl-3-(2-naphthyl)alanyl-glycyl) DNA, Complementary Electrophoresis, Capillary Emulsions Endothelium Enzymes Homo sapiens Hypersensitivity Lung Mus Oligonucleotide Primers RNA, Messenger Touch

Most recents protocols related to «Electrophoresis, Capillary»

Mutant Polymerase Nucleotide Incorporation

Not available on PMC !

Example 6

Primed DNA template molecules in a reaction buffer was mixed with a purified mutant polymerase and allowed to equilibrate to 42° C. The reaction was started by adding a 3′ methylazido nucleotide corresponding to the next base on the template molecule. The reaction was allowed to proceed at 42° C. and quenched with EDTA and formamide at incremental time points. Analysis of the n+1 versus n was performed by capillary electrophoresis. The incorporation rates of dATP nucleotide analog into a template having a thymine as the next base in the template molecule was assayed. The incorporation rates of dATP nucleotide analog into a template having an adenine as the next base in the template molecule was assayed. The incorporation rates of dATP nucleotide analog into a template having a uracil as the next base in the template molecule was assayed. Some of the mutant polymerases exhibited increased capability for incorporating a dATP nucleotide analog into a uracil-containing template molecule.

US11859241B2. Compositions and methods for pairwise sequencing (2024-01-02). Element Biosciences, Inc. [US]. Inventors: Sinan Arslan [US], Junhua Zhao [US], Molly He [US], Samantha Snow [US], William Light [US], Matthew Kellinger [US], Michael Previte [US], Michael Kim [US], Hua Yu [US], Yu-Hsien Hwang-Fu [US], Marco Tjioe [US], Andrew Boddicker [US], Mark Ambroso [US], Tyler Lopez [US], Michael Klein [US], Virginia Saade [US].

Full text: Click here

Patent 2024

Adenine Buffers DNA Edetic Acid Electrophoresis, Capillary formamide Nucleotides Thymine Uracil Uracil Nucleotides

Allele-Specific PCR for TEP1 Genotyping

Two TEP1 allele-specific PCR assays were employed to genotype the variants previously described in An. gambiae populations [4 (link), 12 (link)]. The first assay [4 (link)] amplifies a 428 bp fragment for the susceptible allele (TEP1s) and 349 bp fragment for the resistant allele (TEP1r). The genotypes of TEP1r were amplified using the second assay [12 (link)], which targets 510 bp fragment for TEP1r^A and 155 bp fragment for TEP1r^B. The wild type (TEP1) (646 bp) was also amplified from the second assay. PCR products were analysed using QIAxcel capillary electrophoresis to identify the different fragments. Only fragments that were positive from both PCR assays were finally analysed. A total of 1400 mosquitoes were genotyped (2009 = 335; 2016 = 525; 2019 = 540).

Hamid-Adiamoh M., Jabang A.M., Opondo K.O., Ndiath M.O., Assogba B.S, & Amambua-Ngwa A. (2023). Distribution of Anopheles gambiae thioester-containing protein 1 alleles along malaria transmission gradients in The Gambia. Malaria Journal, 22, 89.

Full text: Click here

Publication 2023

Alleles Biological Assay Culicidae Electrophoresis, Capillary Population Group TEP1 protein, human

Antimicrobial Resistance Profiling of Enterococcus

Minimum inhibitory concentrations (MICs) to ampicillin, gentamicin, vancomycin, teicoplanin, ciprofloxacin, tigecycline, linezolid, daptomycin and quinupristin/dalfopristin were examined by E-test (Liofilchem, Italy). MICs results were interpreted according to the recommendations of The European Committee on Antimicrobial Susceptibility Testing (EUCAST Breakpoint tables for interpretation of MICs and zone diameters, version 11.0, 2021, http://www.eucast.org/clinical_breakpoints/). The Clinical and Laboratory Standards Institute (CLSI) guidelines, 2021, https://clsi.org/standards/ were used to interpret the MICs for daptomycin. The presence of vanABCDMN genes was investigated by colony multiplex PCR assay using the primer sequences and PCR protocol described by Nomura et al. [22 (link)]. Briefly, a modified PCR mix for detection of the investigated genes was applied containing 0.4 µM (each) primer, 200 µM (each) dNTP, 1 U of Taq (Canvax, Spain), 1X reaction buffer, 2.5 mM MgCl₂, ultrapure PCR H₂O and 10 ng DNA template to a final volume of 20 µL. The PCR thermal conditions consisted of initial denaturation (94 °C for 4 min), followed by 30 cycles of denaturation (94 °C for 30 s), annealing (62 °C for 35 s) and extension (68 °C for 1 min), with a single final extension of 7 min at 68 °C. The amplified PCR products were analyzed by capillary electrophoresis.

Hristova P.M., Nankov V.M., Hristov I.G., Trifonov S.V., Alexandrova A.S, & Hitkova H.Y. (2023). Gut colonization with vancomicyn-resistant enterococci among patients with hematologic malignancies. Gut Pathogens, 15, 12.

Full text: Click here

Publication 2023

Ampicillin Biological Assay Buffers Ciprofloxacin Clinical Laboratory Services Daptomycin Electrophoresis, Capillary Europeans Genes Genes, vif Gentamicin Linezolid Magnesium Chloride Microbicides Minimum Inhibitory Concentration Multiplex Polymerase Chain Reaction Oligonucleotide Primers quinupristin-dalfopristin Susceptibility, Disease Teicoplanin Tigecycline Vancomycin

Profiling Small RNA Expression in Osteosarcoma

Total RNA was extracted from samples from 10 OS patients and 10 healthy controls using phenol-chloroform (TRIzol; Invitrogen; ThermoFisher Scientific, Inc., Waltham, MA, United States). The quality of RNA was assessed by capillary electrophoresis (Agilent Technologies, Inc., Santa Clara, CA, United States). Libraries for small RNA sequencing were prepared using NEB kits (New England Biolabs, Inc., Ipswich, MA, United States). qRT-PCR with SYBR-Green (Takara, Osaka, Japan) to detect CDC5L, CUL1, CXCL10, EIF2AK2, POLR2B, PTEN, STAT1, and TBP expression levels, GAPDH was applied as a house keeping gene. The reaction was performed via 40 amplification cycles using the following protocol: 95°C for 3 min, 95°C for 45 s, 55°C for 15 s, and 72°C for 50 s. Primers used in PCR were shown in Supplementary Table S1. Samples were analyzed in triplicate, and gene expression was quantified by normalizing target gene expression to that of the internal control using the 2^−ΔΔCt formula.

Deng Y., Wang Y., Shi Q, & Jiang Y. (2023). Identification of hub genes associated with osteoporosis development by comprehensive bioinformatics analysis. Frontiers in Genetics, 14, 1028681.

Full text: Click here

Publication 2023

Chloroform CUL1 protein, human Electrophoresis, Capillary GAPDH protein, human Gene Expression Genes, Housekeeping Oligonucleotide Primers Patients Phenol PTEN protein, human STAT1 protein, human SYBR Green I trizol

Molecular Analysis for Malaria Recrudescence

To distinguish between recrudescence and re-infection, 4 drops of blood from malaria-positive patients were collected on filter paper on day zero before treatment, and on any day of recurrent P. falciparum malaria. Molecular analysis was conducted following the previously described method [19 (link)], with slight modifications. Briefly, blood spotted filter papers were soaked for 24 h in 1 mL of 0.5% saponin-1 phosphate buffered saline. The mixture was washed twice in 1-mL PBS and boiled for 8 min in 100 mL PCR-grade water to release DNA from the cells. To elute the extracted DNA, 150 µL Buffer AE was added to each well using a multichannel pipette and incubated for 1 min at room temperature. This setup was then centrifuged at 2608 RCF for 8 min. DNA was recovered and stored at -80 °C. Nested PCR was performed on the extracted DNA for subsequent genotyping of P. falciparum polymorphic gene loci encoding Merozoite surface protein 2 (MSP-2) using the method described by [20 (link)]. A master mix was prepared according to manufacturer instructions (New England Bio Labs, Massachusetts, USA). 24 µL of the Master Mix was added to the PCR 96 well plate and 25 µL of the master mix was also added to the negative PCR control. The plates were sealed using a thermo-seal plate sealer and placed in the PCR thermo-cycler. Amplification was then performed under the following conditions; denaturation (94 °C), annealing (55 °C), and extension (72 °C). Amplification was confirmed by running the nested PCR product together with a DNA ladder on the QIAxcel capillary electrophoresis. The result was classified as recrudescence if at least one identical MSP2 allele was detected in both ACT pre-treatment and ACT post-treatment blood samples. Blood samples where MSP2 alleles did not match ACT pre- and ACT post-treatment were classified as new infections. Any sample, which failed to amplify was classified as undetermined. Blood samples, which showed recrudescence of parasites during any follow up day were further genotyped for P. falciparum k13 resistance markers. The primers used in this protocol are shown in Table 1.Table 1

Showing Merozoite Surface Proteins-2 (MSP-2) Amplification primers

Primer name	Sequence (5′ → 3′)	Purpose
MSP-2(1)	ATGAAGGTAATTAAAACATTGTCTATTATA	External forward primer
MSP-2(4)	ATATGGCAAAAGATAAAACAAGTGTTGCTG	External reverse primer
MSP-2(A1)	CAGAAAGTAAGCCTTCTACTGG	Internal forward primer (IC3D7)
MSP-2(A2)	GATTTGTTTCGGCATTATTATGA	Internal reverse primer (IC3D7)
MSP-2(B1)	CAAATGAAGGTTCTAATACTA	External forward primer (FC27)
MSP-2(B2)	GCTTTGGGTCCTTCTTCAGTTGATTC	Internal reverse primer (FC27)

Maniga J.N., Samuel M., John O., Rael M., Muchiri J.N., Bwogo P., Martin O., Sankarapandian V., Wilberforce M., Albert O., Onkoba S.K., Adebayo I.A., Adeyemo R.O, & Akinola S.A. (2023). Novel Plasmodium falciparum k13 gene polymorphisms from Kisii County, Kenya during an era of artemisinin-based combination therapy deployment. Malaria Journal, 22, 87.

Full text: Click here

Publication 2023

Alleles BLOOD Buffers Cells Electrophoresis, Capillary Genetic Loci Infection Malaria Malaria, Falciparum Membrane Proteins Merozoites Nested Polymerase Chain Reaction Neutrophil Oligonucleotide Primers Parasites Patients Phocidae Phosphates Recrudescence Reinfection Saline Solution Saponin

Top products related to «Electrophoresis, Capillary»

Agilent 2100 bioanalyzer by Agilent Technologies

Sourced in United States, Germany, Canada, China, France, United Kingdom, Japan, Netherlands, Italy, Spain, Australia, Belgium, Denmark, Switzerland, Singapore, Sweden, Ireland, Lithuania, Austria, Poland, Morocco, Hong Kong, India

The Agilent 2100 Bioanalyzer is a lab instrument that provides automated analysis of DNA, RNA, and protein samples. It uses microfluidic technology to separate and detect these biomolecules with high sensitivity and resolution.

2100 bioanalyzer by Agilent Technologies

Sourced in United States, Germany, Canada, United Kingdom, France, China, Japan, Spain, Ireland, Switzerland, Singapore, Italy, Australia, Belgium, Denmark, Hong Kong, Netherlands, India

The 2100 Bioanalyzer is a lab equipment product from Agilent Technologies. It is a microfluidic platform designed for the analysis of DNA, RNA, and proteins. The 2100 Bioanalyzer utilizes a lab-on-a-chip technology to perform automated electrophoretic separations and detection.

Rneasy mini kit by Qiagen

Sourced in Germany, United States, United Kingdom, Netherlands, Spain, Japan, Canada, France, China, Australia, Italy, Switzerland, Sweden, Belgium, Denmark, India, Jamaica, Singapore, Poland, Lithuania, Brazil, New Zealand, Austria, Hong Kong, Portugal, Romania, Cameroon, Norway

The RNeasy Mini Kit is a laboratory equipment designed for the purification of total RNA from a variety of sample types, including animal cells, tissues, and other biological materials. The kit utilizes a silica-based membrane technology to selectively bind and isolate RNA molecules, allowing for efficient extraction and recovery of high-quality RNA.

Hi di formamide by Thermo Fisher Scientific

Sourced in United States, Germany, United Kingdom, China

Hi-Di formamide is a high-deionized formamide solution used as a reagent in various molecular biology applications. It serves as a denaturing agent, facilitating the separation of double-stranded DNA or RNA molecules.

Genemapper software by Thermo Fisher Scientific

Sourced in United States, France, United Kingdom, Germany

GeneMapper software is a bioinformatics tool designed for DNA fragment analysis. It is used for the identification and quantification of DNA fragments generated during genetic research or forensic investigations. The software provides a platform for the analysis and interpretation of data obtained from electrophoretic separation techniques, such as capillary electrophoresis.

Abi 3500 genetic analyzer by Thermo Fisher Scientific

Sourced in United States, Germany, Japan, China, India, United Kingdom, Switzerland

The ABI 3500 Genetic Analyzer is a capillary electrophoresis instrument designed for DNA sequencing and fragment analysis applications. It utilizes laser-induced fluorescence detection and a 24-capillary array to provide high-throughput analysis of genetic samples.

Abi 3130xl genetic analyzer by Thermo Fisher Scientific

Sourced in United States, United Kingdom, Japan, Germany, Canada

The ABI 3130xl Genetic Analyzer is a capillary electrophoresis instrument designed for DNA sequencing and fragment analysis. It employs laser-induced fluorescence detection to analyze DNA samples. The instrument can process multiple samples simultaneously and provides high-resolution data for various genetic applications.

Trizol reagent by Thermo Fisher Scientific

Sourced in United States, China, Japan, Germany, United Kingdom, Canada, France, Italy, Australia, Spain, Switzerland, Netherlands, Belgium, Lithuania, Denmark, Singapore, New Zealand, India, Brazil, Argentina, Sweden, Norway, Austria, Poland, Finland, Israel, Hong Kong, Cameroon, Sao Tome and Principe, Macao, Taiwan, Province of China, Thailand

TRIzol reagent is a monophasic solution of phenol, guanidine isothiocyanate, and other proprietary components designed for the isolation of total RNA, DNA, and proteins from a variety of biological samples. The reagent maintains the integrity of the RNA while disrupting cells and dissolving cell components.

Bigdye terminator v3.1 cycle sequencing kit by Thermo Fisher Scientific

Sourced in United States, Japan, Germany, United Kingdom, China, Canada, Australia, France, Poland, Lithuania, Italy, Malaysia, Thailand, Switzerland, Denmark, Argentina, Norway, Netherlands, Singapore

The BigDye Terminator v3.1 Cycle Sequencing Kit is a reagent kit used for DNA sequencing. It contains the necessary components, including fluorescently labeled dideoxynucleotides, to perform the Sanger sequencing method.

3130xl genetic analyzer by Thermo Fisher Scientific

Sourced in United States, Germany, Australia, Japan, United Kingdom, Netherlands, France, Canada, Switzerland, Spain

The 3130xl Genetic Analyzer is a capillary electrophoresis instrument designed for DNA sequencing and fragment analysis. It features 16 capillaries and a laser-induced fluorescence detection system. The 3130xl enables high-throughput genetic analysis with its automated sample handling and data processing capabilities.

More about "Electrophoresis, Capillary"

capillary electrophoresis, CE, capillary zone electrophoresis, CZE, micellar electrokinetic chromatography, MEKC, capillary gel electrophoresis, CGE, capillary isoelectric focusing, CIEF, Agilent 2100 Bioanalyzer, 2100 Bioanalyzer, RNeasy Mini Kit, Hi-Di formamide, GeneMapper software, ABI 3500 Genetic Analyzer, ABI 3130xl Genetic Analyzer, TRIzol reagent, BigDye Terminator v3.1 Cycle Sequencing Kit, 3130xl Genetic Analyzer, biomolecules, proteins, nucleic acids, small molecules, clinical diagnostics, forensics, biochemistry, molecular biology, reproducibility, efficiency, research workflow