Log In Sign up
The largest database of trusted experimental protocols
> Procedures > Laboratory Procedure > Electrophoresis, Gel, Pulsed-Field

Electrophoresis, Gel, Pulsed-Field

Electrophoresis, Gel, Pulsed-Field is a technique used to separate large DNA fragments by applying an alternating electric field.
The DNA fragments migrate through an agarose gel matrix, allowing for the separation and visualization of high-molecular-weight DNA.
This method is particularly useful for analyzing chromosomal DNA and detecting genetic abnormalities.
The pulsed-field approach, with its ability to resolve high-molecular-weight DNA, has become an indispensable tool in molecular biology, genetics, and genomic research.
Explore PubCompare.ai's AI-driven optimization platform to find reproducibale and accuate pulsed-field gel electrophoresis protocols from literature, preprints, and patents, ensuring efficient and reliable results for your research needs.

Most cited protocols related to «Electrophoresis, Gel, Pulsed-Field»

1
Curing Plasmids from Staphylococcus aureus Strain
Cited 83 times
The Staphylococcus aureus strains used in this study were derived from a USA300 strain isolated from a skin and soft tissue infection in a detainee from the Los Angeles County Jail (LAC) (35 (link)). S. aureus strain LAC contains two plasmids, p01 (a 3.1-kb cryptic plasmid) and p03 (a 27-kb plasmid conferring resistance to erythromycin) (36 (link)). Both p01 and p03 were removed from LAC for two reasons. First, curing of these two plasmids eliminated potential plasmid incompatibility concerns with pFA545 and pBursa (see below), and second, curing ensured that the bursa aurealis transposon did not insert preferentially into plasmid DNA. For removal of p03, strain LAC was grown overnight in Tryptic soy broth (TSB) with shaking at 37°C without antibiotics. The next day, serial dilutions were made and the cells were plated on Trypic soy agar (TSA) plates without any antibiotics. Colonies arising after overnight incubation at 37°C were then replica plated onto plates with and without erythromycin (5 µg/ml). Those colonies unable to grow on erythromycin were chosen, and the loss of the plasmid was confirmed by performing plasmid analysis (Promega, Madison, WI). After confirmation that no major genomic rearrangements had occurred by pulsed-field gel electrophoresis (PFGE) (37 (link)), one colony, designated LAC-13C, was selected for subsequent manipulation.
We next cured p01 from LAC-13C utilizing a plasmid incompatibility strategy. First, a chimeric plasmid in which pCL84 (conferring tetracycline resistance) (38 (link)) and p01 were ligated together at their unique EcoRI sites was created. This plasmid, designated pJE06, was then electroporated into Escherichia coli DH5α, purified, and subsequently electroporated into S. aureus RN4220 (39 (link)). pJE06 was then transduced from RN4220 using bacteriophage ϕ11 (40 (link)) into LAC-13C using methods as described by McNamara (41 ). Plasmid preparations of the resulting tetracycline-resistant transductants were screened for the loss of p01 due to plasmid incompatibility (42 (link)). The resulting strains were then cured of pJE06 by following the process described above for removal of pUSA03 except that the colonies were screened for tetracycline sensitivity. Multiple tetracycline-susceptible derivatives were examined by PFGE to ensure that no chromosomal rearrangements were detected; one strain was selected for subsequent use and designated JE2.
Fey P.D., Endres J.L., Yajjala V.K., Widhelm T.J., Boissy R.J., Bose J.L, & Bayles K.W. (2013). A Genetic Resource for Rapid and Comprehensive Phenotype Screening of Nonessential Staphylococcus aureus Genes. mBio, 4(1), e00537-12.
Publication 2013
Agar Antibiotics Bacteriophages Cells CFC1 protein, human Chimera Chromosomes Deoxyribonuclease EcoRI derivatives Electrophoresis, Gel, Pulsed-Field Erythromycin Escherichia coli Gene Rearrangement Genome Hypersensitivity Jumping Genes Plasmids Promega Skin Soft Tissue Infection Staphylococcus aureus Staphylococcus aureus Infection Strains Synovial Bursa Technique, Dilution Tetracycline tryptic soy broth
2
Generating S. aureus Mutants for Virulence Factors
Cited 34 times
The rshSyn, codY double mutant was obtained by transducing the codY::tet(K) mutation into S. aureus strain Newman rshSyn[13] (link) using Φ11 lysates of strains RN4220-21 [15] (link). Transductants were verified by PCR and PFGE. For complementation the full length rsh gene with a 960 bp upstream region was transduced into strain Newman rshSyn (Table S1) using Φ11 lysates of strain CYL316-199 [13] (link).
The psmα and psmβ mutants were obtained by replacing psmα1-4 with a tetracycline resistance cassette and psmβ1-2 with an erythromycin resistance cassette using a newly developed temperature-sensitive shuttle vector pBASE6. This vector is based on the previously described pBT2 vector [57] (link) with the additional advantage of counter-selection against the plasmid by inducible expression of S. aureus secY antisense RNA of the pKOR1 vector [58] (link). Therefore the HindIII-Bst1107I fragment of pBT2 was replaced by the 4.875 kb EcoRV-HindIII (partial digest) fragment of pKOR1, containing the tetR/secY regulatory unit. Since some of the restriction sites of the pBT2 multiple cloning site (MCS) are also present in the introduced pKOR1 part, the MCS was removed by EcoRI-HindIII digestion. Primers: mcsmod1 (ATTCCGGAGCTCGGTACCCGGGCTAGCGCGCAGATCTGTCGACGATATCA) and mcsmod2 (AGCTTGATATCGTCGACAGATCTGCGCGCTAGCCCGGGTACCGAGCTCCGG) were mixed in equimolar amounts, heated to 95°C and slowly cooled down to room temperature. This new MCS contains only unique restriction sites and was ligated into the EcoRI-HindIII digested vector, resulting in pBASE6.
For gene replacements, two fragments flanking the pmsα1-4, psmβ1-2 locus, the tetracycline and erythromycin resistant cassette were amplified and annealed by overlapping PCR to generate the pmsα1-4-tetM and psmβ1,2-ermC mutagenesis vectors pCG307 and pCG308, respectively. The amplicons were cloned into the BglII/SalI restriction sites of pBASE6. These plasmids were used to mutagenize strain RN4220 as described previously [13] (link). The obtained psm gene replacement mutant strains (RN4220-307 and RN4220-308) were verified by PCR. In the mutants the whole psmα1-4 operon respectively psmβ1,2 operon was replaced by the corresponding resistant cassette. The rshSyn, psmα, psmβ triple mutant was obtained by transducing the psmβ::erm(C) and psmα::tet(M) mutations into S. aureus strain HG001 rshSyn using lysates of strain RN4220-307 and RN4220-308.
Geiger T., Francois P., Liebeke M., Fraunholz M., Goerke C., Krismer B., Schrenzel J., Lalk M, & Wolz C. (2012). The Stringent Response of Staphylococcus aureus and Its Impact on Survival after Phagocytosis through the Induction of Intracellular PSMs Expression. PLoS Pathogens, 8(11), e1003016.
Full text: Click here
Publication 2012
Antisense RNA Cloning Vectors Deoxyribonuclease EcoRI Digestion Electrophoresis, Gel, Pulsed-Field Erythromycin Genes Mutagenesis Mutation Oligonucleotide Primers Operon Plasmids Shuttle Vectors Strains Tetracycline
3
Comparative Lm Strain Typing: cgMLST vs. PFGE
Cited 30 times
To compare cgMLST with PFGE for Lm strain typing, we analysed, in parallel, 100 isolates (57 human isolates, 33 food isolates and 10 isolates from food production environments) prospectively collected between January and April 2015 in the frame of the French listeriosis surveillance system by the National Reference Center for Listeria (Institut Pasteur, France). PFGE restriction profiles were obtained using the enzymes AscI and ApaI according to PulseNet standardized procedures (http://www.cdc.gov/pulsenet/PDF/listeria-pfge-protocol-508c.pdf) and were analysed using BioNumerics. PFGE and cgMLST typing results were compared using Simpson’s index of diversity and the adjusted Wallace index of concordance (see Supplementary Section 2.5 for details).
Moura A., Criscuolo A., Pouseele H., Maury M.M., Leclercq A., Tarr C., Björkman J.T., Dallman T., Reimer A., Enouf V., Larsonneur E., Carleton H., Bracq-Dieye H., Katz L.S., Jones L., Touchon M., Tourdjman M., Walker M., Stroika S., Cantinelli T., Chenal-Francisque V., Kucerova Z., Rocha E.P., Nadon C., Grant K., Nielsen E.M., Pot B., Gerner-Smidt P., Lecuit M, & Brisse S. (2016). Whole genome-based population biology and epidemiological surveillance of Listeria monocytogenes. Nature microbiology, 2, 16185.
Publication 2016
Electrophoresis, Gel, Pulsed-Field Enzymes Food Homo sapiens Listeria Listeriosis methyl 4-azidophenylacetimidate Reading Frames Strains
4
Validation of Bacterial Primer Specificity
Cited 20 times
All primer sets were tested for sensitivity, optimal annealing temperature and primer efficiency as previously described [18] (link), [19] (link). Briefly, high quality gDNA was was extracted using the GeneJET Genomic DNA Purification Kit (Fermentas Inc, Glen Burnie, MD, USA) with an additional bead-beating step to maximize lysis. DNA was quantified using both a Nanodrop 2000 (Nanodrop, Wilmington, DE, USA) and Qubit 2.0 Fluorometer (Life technologies, Grand Island, NY, USA).
Genome copies of DNA were calculated using the following formula:
Size of genome (in bp) × 650 Daltons/bp = molecular weight of Genome in g/mol.
# copies of genome in 1 ng of DNA = (1×10−9 g ÷ Mw of genome)×6.02×1023 molecules/mole (Avogadro’s number).
To get 108 copies in 2 µl = (108 ÷ # copies of genome in 1 ng)/2.
Serial dilutions of DNA from 108 to 102 copies were prepared and tested in duplicate with each primer set to calculate primer efficiency and sensitivity.
Primers were tested using two different instruments, the Roche Light Cycler 480 II (LC 480 II) with SYBR Green I Master Mix (Roche Applied Sciences, Indianapolis, IN), and the BioRad CFX96 with SsoAdvanced SYBR Green supermix (Bio-Rad Laboratories, Hercules, CA). Each primer was tested for specificity by two methods. First, the primers were tested against genomic DNA extracted from a panel of American Type Culture Collection strains (ATCC, Manassas, VA, USA) and clinical isolates representing fifty different bacterial species, including closely related members from the same genus (Table S5). Secondly, primers were tested against 200 clinical isolates of each species, identified to the species level using three automated identification systems; the Vitek 2 (bioMerieux, Durham, NC), the BD Pheonix (Diagnostics Systems, Sparks, MD), and the Microscan Walkway (Siemens Healthcare Diagnostics Inc, Deerfield, IL), selected from a large repository of isolates (>10,000 strains) collected between 2002 to 2012 from 23 different facilities in the United States of America, Europe, Asia and the Middle East. Pulsed-field gel electrophoresis (PFGE) indicated that the selected clinical isolates represented a variety of different pulse-types (unpublished results).
Clifford R.J., Milillo M., Prestwood J., Quintero R., Zurawski D.V., Kwak Y.I., Waterman P.E., Lesho E.P, & Mc Gann P. (2012). Detection of Bacterial 16S rRNA and Identification of Four Clinically Important Bacteria by Real-Time PCR. PLoS ONE, 7(11), e48558.
Full text: Click here
Publication 2012
Bacteria Diagnosis Electrophoresis, Gel, Pulsed-Field Genome Hypersensitivity Light Moles Oligonucleotide Primers Pulse Rate Strains SYBR Green I SYBR Green II Technique, Dilution
5
Nanopore-based Plasmid Sequencing and Analysis
Cited 17 times
Although a local basecaller script was used during the run, there was still a small amount of reads that were not basecalled due to the generation of raw data in a rapid mode. Albacore basecalling software (v1.0.3) was used to generate fast5 files harboring the 1D DNA sequence from fast5 files with only raw data in the tmp folder. Also, the read_fast5_basecaller.py script in Albacore was used to de-multiplex the 12 samples from basecalled fast5 files (except the files in fail folder) based on the 12 barcodes in SQK-RBK001. The Poretools toolkit was utilized to extract all the DNA sequences from fast5 to fasta format among the 12 samples, respectively (Poretools, RRID:SCR_015879) [18 (link)]. The Canu assembly tool (v1.3; Canu, RRID:SCR_015880) [14 (link)] was used to perform de novo assembly of complete plasmid sequences based on nanopore 1D long reads in 3 consecutive stages including correction, trimming, and assembly [14 (link)]. Due to the possibility of the contamination of bacterial chromosomal DNA in the plasmid samples and the large variation of the size of the plasmids, the parameter of genomeSize was set at 0.5, 1, 2, and 4 m, respectively, to optimize the assembly results to obtain circular plasmid sequences of interest. The sizes and the numbers of plasmids determined by S1–pulsed-field gel electrophoresis (PFGE) were used to confirm the assembled results. High-quality complete plasmids were constructed by hybrid de novo assembly of Illumina short reads and nanopore long reads data using the Unicycler v0.3 tool [19 (link)]. NanoOK was adopted to evaluate the quality of nanopore long reads [20 (link)]. BWA MEM was used to align long reads against reference plasmids (BWA, RRID:SCR_010910) [21 (link)].
To assess the distribution of resistance genes, mobile elements, and replicon genes, the corresponding databases were downloaded [21 (link)–23 (link)] and BLASTN was performed among the finished plasmids (BLASTN, RRID:SCR_001598). The result was visualized by the tool Genesis [24 (link)]. Easyfig was utilized to compare the detailed structures of the MDR plasmids (Easyfig, RRID:SCR_013169) [25 (link)].
Li R., Xie M., Dong N., Lin D., Yang X., Wong M.H., Chan E.W, & Chen S. (2018). Efficient generation of complete sequences of MDR-encoding plasmids by rapid assembly of MinION barcoding sequencing data. GigaScience, 7(3), gix132.
Full text: Click here
Publication 2018
Chromosomes DNA, Bacterial Electrophoresis, Gel, Pulsed-Field Genes Hybrids Plasmids Replicon

Most recents protocols related to «Electrophoresis, Gel, Pulsed-Field»

1
Genetic Relatedness Analysis via PFGE
Cited 1 time
To further explore the relatedness of JNQH497, 498, 462 strains, we used PFGE to analyze the genetic relatedness. PFGE of Xbal-digested genomic DNA samples were performed with a CHEF MAPPER XA apparatus (Bio-Rad, USA), as previously described [11 (link)].
Ma W., Zhu B., Wang W., Wang Q., Cui X., Wang Y., Dong X., Li X., Ma J., Cheng F., Shi X., Chen L., Niu S, & Hao M. (2023). Genetic and enzymatic characterization of two novel blaNDM-36, -37 variants in Escherichia coli strains. European Journal of Clinical Microbiology & Infectious Diseases, 42(4), 471-480.
Full text: Click here
Publication 2023
Electrophoresis, Gel, Pulsed-Field Genome Reproduction Strains
2
Avian High-Molecular DNA Extraction
High molecular weight DNA was extracted from the blood of an Arabian 2-year-old female gyrfalcon weighing 1,400 g using the Nanobind magnetic disc-based method from Circulomics (Circulomics, Baltimore, MD, USA). The optimization included efficient homogenization of the blood with phosphate-buffered saline (PBS) to avoid a viscous lysate and ensure proper lysis, considering avian erythrocytes contain high amounts of nuclei. 50 μL of avian blood provided more than 20 μg of DNA yield, quantified using broad range Qubit fluorometer (Invitrogen, USA). The DNA fragment size was 120 kb on the pulsed field gel electrophoresis.
Zuccolo A., Mfarrej S., Celii M., Mussurova S., Rivera L.F., Llaca V., Mohammed N., Pain A., Alrefaei A.F., Alrefaei A.F, & Wing R.A. (2023). The gyrfalcon (Falco rusticolus) genome. G3: Genes|Genomes|Genetics, 13(3), jkad001.
Full text: Click here
Publication 2023
Aves BLOOD Cell Nucleus Electrophoresis, Gel, Pulsed-Field Erythrocytes Phosphates Saline Solution Viscosity Woman
3
Clonal Spread Analysis of Klebsiella pneumoniae
All isolates of Klebsiella pneumoniae were analyzed using the standardized PFGE protocol developed at the Centers for Disease Control and Prevention by the PulseNet program (version for Escherichia coli). Data from previous studies showed that K. pneumoniae strains isolated in Polish hospitals (mainly from ICUs for adults and neonates and pediatric units) often belong to one clone. For this reason, a PFGE study was performed for this species to check for clonal spreading of strains coming from oral bacteriota samples and HAI cases. Genomic DNA was prepared in situ in agarose blocks and was subsequently digested with restriction enzymes: XbaI (25 U per block, Thermo Scientific. The digested products were separated on a CHEF III PFGE system (Bio-Rad, Warsaw, Poland) in 0.5 × Tris-borate-EDTA buffer at 14 °C at 6 V for 22 h with a starting pulse of 2 s and a final pulse of 35 s. GelCompar (Applied Maths, Kortrijk, Belgium) was used for cluster analysis with the unweighted pair group method with an arithmetic mean and the Dice coefficient. Similarity must be > 90% for the pattern to be considered to belong to the same pulsotype. The results of the PFGE analysis are presented for each patient with a number that they were assigned on recruitment (1–56). The term “case” refers to HAI diagnoses.
Gregorczyk-Maga I., Pałka A., Fiema M., Kania M., Kujawska A., Maga P., Jachowicz-Matczak E., Romaniszyn D., Chmielarczyk A., Żółtowska B, & Wójkowska-Mach J. (2023). Impact of tooth brushing on oral bacteriota and health care-associated infections among ventilated COVID-19 patients: an intervention study. Antimicrobial Resistance and Infection Control, 12, 17.
Full text: Click here
Publication 2023
Adult Clone Cells Diagnosis DNA Restriction Enzymes Electrophoresis, Gel, Pulsed-Field Escherichia coli Genome Infant, Newborn Klebsiella pneumoniae Patients Pulse Rate Sepharose Strains Tris-borate-EDTA buffer
4
Pulsed-Field Gel Electrophoresis of Yeast Chromosomes
Chromosomes from stationary yeast cell cultures were prepared in agar molds using the Certified Megabase Agarose (Bio-Rad CAT. 1613108), and PFGE was carried out as previously described, with running conditions recommended for either S. cerevisiae or Saccharomyces pombe chromosomes. Specifically, megachromosomes were separated on a 0.8% agar gel in 1× TAE (Tris acetate ethylene diamine tetra-acetic acid) at 14°C. Run time was ~72 h at 2V/cm with switch time of 20 to 30 min at an included angle of 106° (36 (link)). DNA size markers used were the S. pombe chromosomal DNA (Bio-Rad CAT. 170-3633) and the Hansenula wingei chromosomal DNA (Bio-Rad CAT. 170-3667).
Lazar-Stefanita L., Luo J., Haase M.A., Zhang W, & Boeke J.D. (2023). Two differentially stable rDNA loci coexist on the same chromosome and form a single nucleolus. Proceedings of the National Academy of Sciences of the United States of America, 120(9), e2219126120.
Publication 2023
Acetate Acetic Acid Agar Cell Culture Techniques Chromosomes Electrophoresis, Gel, Pulsed-Field Ethylenediamines Fungus, Filamentous Markers, DNA Saccharomyces Saccharomyces cerevisiae Schizosaccharomyces pombe Sepharose Tetragonopterus Tromethamine Wickerhamomyces canadensis
5
Constructing Metagenomic Libraries from Gut and Soil
For the gut microbiome library, we collected faecal samples from 10 unrelated, healthy individuals with no history of taking antibiotics in the year before sample donation. For the anthropogenic soil microbiome, samples were collected from highly antibiotic-contaminated industrial areas in India53 (link). Metagenomic DNA from the gut and soil samples was extracted using DNeasy PowerSoil kit (Qiagen, 47016). Genomic DNA of clinical bacterial isolates (Supplementary Table 1) was isolated using the Sigma GenElute bacterial genomic DNA kit (Sigma, NA2110-1KT).
From each sample, 40 µg of extracted DNA was digested with MluCI enzyme (NEB, R0538L) (10 min, 37 °C), followed by inactivation (20 min, 85 °C). The quantity of the MluCI enzyme was varied to obtain DNA in the target size range of 1–5 kbp. DNA was isolated with pulsed field gel electrophoresis (Sage Science, PB02901) with a 0.75% agarose gel cassette and low-voltage 1–6 kbp marker S1 cassette definition. The metagenomic DNA fragments were ligated into the pZE21_p15A plasmid at the EcoRI site using a 3:1 mass ratio of insert:vector. Pure ligation mixture was electroporated into 40 µl of either E. coli MegaX (Invitrogen, C640003) or E. coli 10G ELITE (Lucigen, 60080-2) cells. Following one h of incubation at 37 °C, transformants were plated onto 50 µg ml−1 kanamycin containing Luria Bertani (LB) agar plates in 101×, 102× and 103× dilutions for colony forming unit determination. The rest of the recovered cells were grown overnight on LB agar plates supplemented with kanamycin. The next day, plasmids were isolated. Insert size distribution was estimated by PCR amplification of relevant plasmid regions from 10–20 randomly selected clones. The average insert size was determined to be 2–3 kbp.
Apjok G., Számel M., Christodoulou C., Seregi V., Vásárhelyi B.M., Stirling T., Eszenyi B., Sári T., Vidovics F., Nagrand E., Kovács D., Szili P., Lantos I.I., Méhi O., Jangir P.K., Herczeg R., Gálik B., Urbán P., Gyenesei A., Draskovits G., Nyerges Á., Fekete G., Bodai L., Zsindely N., Dénes B., Yosef I., Qimron U., Papp B., Pál C, & Kintses B. (2023). Characterization of antibiotic resistomes by reprogrammed bacteriophage-enabled functional metagenomics in clinical strains. Nature Microbiology, 8(3), 410-423.
Full text: Click here
Publication 2023
Agar Antibiotics Antibiotics, Antitubercular Clone Cells Cloning Vectors Deoxyribonuclease EcoRI DNA, Bacterial DNA Library Electrophoresis, Gel, Pulsed-Field Enzymes Escherichia coli Feces Gastrointestinal Microbiome Genome Kanamycin Ligation Metagenome Microbiome Plasmids Sepharose Technique, Dilution

Top products related to «Electrophoresis, Gel, Pulsed-Field»

1
Chef dr 3 system by Bio-Rad
Sourced in United States, Germany, Spain, United Kingdom, France, Belgium, Japan
The CHEF-DR III system is a pulsed-field gel electrophoresis (PFGE) instrument designed for the separation and analysis of large DNA molecules. It employs a unique electric field configuration to facilitate the separation of DNA fragments ranging from 50 kilobase pairs (kbp) to 6 megabase pairs (Mbp). The system provides a reliable and efficient method for the study of genomic DNA.
2
Chef mapper system by Bio-Rad
Sourced in United States, China, United Kingdom, Poland
The CHEF Mapper system is a laboratory equipment used for pulsed-field gel electrophoresis (PFGE), a technique employed for the separation and analysis of large DNA molecules. The system enables the separation of DNA fragments ranging from 10 kilobases (kb) to 10 megabases (Mb) in size.
3
Chef dr 2 system by Bio-Rad
Sourced in United States, Germany, United Kingdom, Belgium, Switzerland
The CHEF-DR II system is a pulsed-field gel electrophoresis (PFGE) instrument designed for the separation and analysis of large DNA molecules. It utilizes a unique electric field pattern to facilitate the separation of high molecular weight DNA fragments. The system is capable of resolving DNA molecules ranging from 50 kilobase pairs to 5 megabase pairs.
4
S1 nuclease by Takara Bio
Sourced in China, Japan, United States
S1 nuclease is an enzyme that cleaves single-stranded DNA and RNA molecules. It is commonly used in molecular biology applications to remove single-stranded regions from DNA or RNA samples.
5
Xbai by Takara Bio
Sourced in Japan, China, United States
XbaI is a type II restriction endonuclease enzyme isolated from the bacterium Xanthomonas badrii. It recognizes and cleaves the palindromic DNA sequence 5'-TCTAGA-3'.
6
Chef mapper by Bio-Rad
Sourced in United States, Lithuania, Japan, Switzerland
The CHEF Mapper is a pulsed-field gel electrophoresis (PFGE) system designed for the separation and analysis of large DNA molecules. It provides precise control over the electric field parameters, enabling the effective separation of DNA fragments ranging from 50 kilobase pairs to 10 megabase pairs.
7
Chef dr 3 by Bio-Rad
Sourced in United States, Italy, China, Canada
The CHEF-DR III is a pulsed-field gel electrophoresis (PFGE) system designed for the separation and analysis of large DNA molecules. It utilizes an alternating electric field to separate DNA fragments ranging from 50 kilobase pairs (kbp) to 10 megabase pairs (Mbp). The CHEF-DR III provides a precise and consistent method for the resolution of high-molecular-weight DNA samples.
8
Chef mapper xa system by Bio-Rad
Sourced in United States, Japan
The CHEF Mapper XA system is a pulsed-field gel electrophoresis (PFGE) instrument designed for the separation and analysis of large DNA molecules. The system uses a unique, programmable electric field to separate DNA fragments ranging from 20 kilobases to 10 megabases in size. The CHEF Mapper XA system provides a versatile platform for a variety of applications, including genomic analysis, molecular typing, and genetic mapping.
9
Xbai by New England Biolabs
Sourced in United States, United Kingdom, China, Germany, Canada
XbaI is a restriction endonuclease enzyme isolated from the bacterium Xanthomonas badrii. It recognizes and cleaves the palindromic DNA sequence 5'-TCTAGA-3'.
10
Chef dr 3 apparatus by Bio-Rad
Sourced in United States, France
The CHEF-DR III apparatus is a pulsed-field gel electrophoresis (PFGE) system designed for the separation and analysis of large DNA molecules. The CHEF-DR III allows for the resolution of DNA fragments ranging from 50 kilobase pairs (kbp) to 6 megabase pairs (Mbp).

More about "Electrophoresis, Gel, Pulsed-Field"