Log In Sign up
The largest database of trusted experimental protocols
> Procedures > Laboratory Procedure > Flow Cytometry

Flow Cytometry

Flow cytometry is a powerful analytical technique used in various fields, including biology, immunology, and medicine.
It allows for the rapid measurement and analysis of multiple physical and chemical characteristics of cells or particles as they flow in a fluid stream through a beam of light.
This technique enables the identification, enumeration, and sorting of different cell types based on their size, granularity, and expression of specific surface or intracellular markers.
Flow cytometry has become an indispensable tool in medical research, clinical diagnostics, and cell biology, enabling researchers to gain insights into complex biological systems and unlock new discoveries.
With its high-throughput capabilities and ability to provide quantitative data, flow cytometry has revolutionized the way researchers approach cell analysis and has become an essential technique in modern biomedical research.

Most cited protocols related to «Flow Cytometry»

1
Intracellular Cytokine Staining Assay Protocol
Data used in this manuscript are either artificial (Figure 2), or from studies of HIV-specific T cell representation in infected subjects collected in our laboratory. Standard intracellular cytokine staining assays were used. As all data are purely for illustration of algorithms and displays, thus no information about the subjects nor assay results is provided. All human samples were collected under NIAID IRB approval. Flow cytometry data was analyzed using FlowJo v9.1 (TreeStar, Inc., Ashland, OR). Background subtraction and formatting of exported data from FlowJo was performed with Pestle v1.6.2 (see below). Statistical analysis and display of multicomponent distributions was performed with SPICE v5.1 (freely available from http://exon.niaid.nih.gov/spice/).
Roederer M., Nozzi J, & Nason M. (2011). SPICE: Exploration and Analysis of Post-Cytometric Complex Multivariate Datasets. Cytometry. Part A : the journal of the International Society for Analytical Cytology, 79(2), 167-174.
Publication 2011
Biological Assay Cytokine Exons Flow Cytometry Homo sapiens Protoplasm Spices T-Lymphocyte
2
Antigen-coated Bead Phagocytosis Assay

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2010
Antibodies Antigens Cells Cytokine Flow Cytometry Germ Cells Monoclonal Antibodies neutravidin paraform Phagocytes secretion Technique, Dilution THP-1 Cells Tissues
3
Measuring DNA Repair by Transient Transfection
To measure the repair by transient transfection, 2.5×104 cells/cm2 were plated and transfected the next day with 0.8 µg/ml of pCBASce mixed with 3.6 µl/ml of Lipofectamine 2000 (Invitrogen) along with a variety of other vectors. The KU and RAD52 expression vectors were added at 0.8 µg/ml, the ERCC1 vector was added at 0.4 µg/ml, the RAD51-K133R vector was added at 0.1 µg/ml, and the BRC3 vector was added at 0.2 µg/ml. For each experiment, an equivalent amount of empty vector (pCAGGS-BSKX) was included in the parallel transfections. Each of these expression vectors have been previously described [18] (link). GFP positive cells were quantified by flow cytometric analysis (FACS) 3d after transfection on a Cyan ADP (Dako). Amplification of PCR products from sorted GFP+ cells, associated restriction digests, and quantification of bands were performed using the primers KNDRF and KNDRR as previously described for analysis of DR-GFP [50] (link).
To measure repair using the inducible I-SceI protein (TST) in combination with siRNA-mediated inhibition of CtIP, HEK293 cell lines with each of the reporters and stable expression of TST were first plated on 24 well plates at 105 cells/well. The following day, the wells were transfected with 70nM siRNA duplex mixed with 4ul/ml of Lipofectamine 2000 in Optimem (Invitrogen). After 4.5h, transfection complexes were diluted two-fold with media without antibiotics, and 48h after the initiation of transfection, 4OHT was added at 3 µM for 24h. Three days after 4OHT was added, the percentage of GFP+ cells was analyzed by FACS as described above. Knockdown of CtIP levels using the various siRNAs was confirmed by RT-PCR from RNA samples isolated from parallel transfections at the time of 4OHT addition (data not shown). Amplification product was quantified at the threshold cycle by including SYBR green in the PCR reaction and using an iQ5 cycler for real-time analysis at the end of each cycle (BioRad). Products were normalized relative to a primer set directed against actin. Sequences of the siRNAs siCtIP-p (Santa Cruz Biotechnology), and siCtIP-1 [25] (link), and primers for RT-PCR are shown in Figure S1D.
Repair frequencies are the mean of at least three transfections or four 4OHT treatments, and error bars represent the standard deviation from the mean. For some experiments, repair frequencies are shown relative to samples co-transfected with I-SceI and an empty vector (EV). For this calculation, the percentage of GFP+ cells from each sample was divided by the mean value of the EV samples treated in the parallel experiment. Similarly, to calculate the fold-difference in repair between siRNA-treated and control-siRNA treated cells, the percentage of GFP+ cells from each sample was divided by the mean value of control-siRNA samples from the parallel experiment. Statistical analysis was performed using the unpaired t-test.
Bennardo N., Cheng A., Huang N, & Stark J.M. (2008). Alternative-NHEJ Is a Mechanistically Distinct Pathway of Mammalian Chromosome Break Repair. PLoS Genetics, 4(6), e1000110.
Full text: Click here
Publication 2008
Actins Antibiotics Cloning Vectors Flow Cytometry HEK293 Cells lipofectamine 2000 Oligonucleotide Primers Psychological Inhibition RAD52 protein, human RBBP8 protein, human Reverse Transcriptase Polymerase Chain Reaction RNA, Small Interfering SYBR Green I Synapsin I Transfection Transients
4
Profiling Immune Cells in Lymphoma and Lung Cancer
All patient samples in this study were reviewed and approved by the Stanford Institutional Review Board in accordance with the Declaration of Helsinki. Tonsils were collected as part of routine tonsilectomy procedures at Lucile Packard Children’s Hospital at Stanford University with informed consent for research use, and then mechanically disaggregated before cell suspensions were cryopreserved (Supplementary Fig. 3b). Peripheral blood mononuclear cells (PBMCs) were isolated from specimens taken before and immediately following four weekly doses of infusional rituximab (375 mg m−2) monotherapy for extranodal marginal zone lymphoma (EMZL) in a subject without measurable circulating disease (patient 1 in Supplementary Fig. 4c). PBMCs were respectively isolated from specimens taken immediately following four cycles and six cycles of RCHOP immunochemotherapy for treatment of DLBCL (patients 2 and 3 in Supplementary Fig. 4c). PBMCs were also isolated from a subject following four cycles of Rituximab for treatment of FL (patient 4 in Supplementary Fig. 4c); this subject had ~2% circulating lymphoma cells at diagnosis, which were undetectable by CIBERSORT and flow cytometry following four Rituximab infusions. Specimens of adjacent normal lung tissue were obtained during surgical resection of early stage non-small cell lung tumors (Fig. 2h). Surgical tissue biopsies were obtained from untreated FL patients enrolled in a Phase III clinical trial (NCT0001729018 (link)) (Fig. 2i and Fig. 3c). Lastly, PBMCs were obtained from 20 adults of varying ages receiving influenza immunization (NCT01827462) (Fig. 3a), and from seven adults consisting of patient 4 in Supplementary Fig. 4c and six healthy subjects (Fig. 3b, which includes patient 4).
Newman A.M., Liu C.L., Green M.R., Gentles A.J., Feng W., Xu Y., Hoang C.D., Diehn M, & Alizadeh A.A. (2015). Robust enumeration of cell subsets from tissue expression profiles. Nature methods, 12(5), 453-457.
Publication 2015
Adult Biopsy Cells Child Diagnosis Ethics Committees, Research Flow Cytometry Healthy Volunteers Lung Lung Neoplasms Lymphoma Mucosa-Associated Lymphoid Tissue Lymphoma Operative Surgical Procedures Palatine Tonsil Patients PBMC Peripheral Blood Mononuclear Cells Rituximab Tissues Tonsillectomy Vaccination Virus Vaccine, Influenza
5
Profiling Immune Cells in Lymphoma and Lung Cancer
All patient samples in this study were reviewed and approved by the Stanford Institutional Review Board in accordance with the Declaration of Helsinki. Tonsils were collected as part of routine tonsilectomy procedures at Lucile Packard Children’s Hospital at Stanford University with informed consent for research use, and then mechanically disaggregated before cell suspensions were cryopreserved (Supplementary Fig. 3b). Peripheral blood mononuclear cells (PBMCs) were isolated from specimens taken before and immediately following four weekly doses of infusional rituximab (375 mg m−2) monotherapy for extranodal marginal zone lymphoma (EMZL) in a subject without measurable circulating disease (patient 1 in Supplementary Fig. 4c). PBMCs were respectively isolated from specimens taken immediately following four cycles and six cycles of RCHOP immunochemotherapy for treatment of DLBCL (patients 2 and 3 in Supplementary Fig. 4c). PBMCs were also isolated from a subject following four cycles of Rituximab for treatment of FL (patient 4 in Supplementary Fig. 4c); this subject had ~2% circulating lymphoma cells at diagnosis, which were undetectable by CIBERSORT and flow cytometry following four Rituximab infusions. Specimens of adjacent normal lung tissue were obtained during surgical resection of early stage non-small cell lung tumors (Fig. 2h). Surgical tissue biopsies were obtained from untreated FL patients enrolled in a Phase III clinical trial (NCT0001729018 (link)) (Fig. 2i and Fig. 3c). Lastly, PBMCs were obtained from 20 adults of varying ages receiving influenza immunization (NCT01827462) (Fig. 3a), and from seven adults consisting of patient 4 in Supplementary Fig. 4c and six healthy subjects (Fig. 3b, which includes patient 4).
Newman A.M., Liu C.L., Green M.R., Gentles A.J., Feng W., Xu Y., Hoang C.D., Diehn M, & Alizadeh A.A. (2015). Robust enumeration of cell subsets from tissue expression profiles. Nature methods, 12(5), 453-457.
Publication 2015
Adult Biopsy Cells Child Diagnosis Ethics Committees, Research Flow Cytometry Healthy Volunteers Lung Lung Neoplasms Lymphoma Mucosa-Associated Lymphoid Tissue Lymphoma Operative Surgical Procedures Palatine Tonsil Patients PBMC Peripheral Blood Mononuclear Cells Rituximab Tissues Tonsillectomy Vaccination Virus Vaccine, Influenza

Most recents protocols related to «Flow Cytometry»

1
PD-1/PD-L1 Blocking Antibody Assay
Not available on PMC !

Example 10

This example provides in vitro IC50 data for the blocking of the interaction between recombinant human PD-1 (PD-1-Fc Chimera; Sino Biologics) and human PD-L1 expressed CHO cells by anti-PD-L1 antibody G12. Here, CHO cells expressing PD-L1 were pre-incubated with G12 prior to the addition of rhPD-1-Fc chimeric protein. After incubation and washing, PD-1 binding to cell surface expressed PD-L1 was detected using an Alexa-Fluor 647 tagged anti-PD-1 antibody by flow cytometry (Intellicyt HTFC; FL-4H). This example shows that anti-PD-L1 monoclonal antibody G12 was able to inhibit efficiently the binding of PD-1 to PD-L1 expressed on the surface of CHO cells.

Results: As shown in FIG. 8 and Table 4, the IC50 for blocking of the PD-1/PD-L1 cellular interaction by G12 is 1.76E-09 M. Data was collected on the Intellicyt HTFC flow cytometer, processed using FlowJo software, and analyzed and plotted in Graph Pad Prizm using non-linear regression fit. Data points are shown as the median fluorescence detected in the FL-4H channel+/−Std Error.

TABLE 4
G12
Inhibition of PD-1/PD-L1CHO-PD-L1/1.76E−09
Interaction IC50 (M)rhPD-1-Fc

US11878058B2. Antigen binding proteins that bind PD-L1 (2024-01-23). Sorrento Therapeutics, Inc. [US]. Inventors: Heyue Zhou [US], Randy Gastwirt [US], Barbara A. Swanson [US], John Dixon Gray [US], Gunnar F. Kaufmann [US].
Full text: Click here
Patent 2024
Alexa Fluor 647 Antibodies, Anti-Idiotypic Antigens Binding Proteins Biological Factors CD274 protein, human Cell Communication Cells Chimera CHO Cells Flow Cytometry Fluorescence Homo sapiens Immunoglobulins isononanoyl oxybenzene sulfonate Monoclonal Antibodies Proteins Psychological Inhibition
2
Investigating Virus Infectivity's Role in Plaque Size
Not available on PMC !

Example 3

Investigation of Virus Infectivity as a Factor that Determines Plaque Size.

With the revelation that plaque formation is strongly influenced by the immunogenicity of the virus, the possibility that infectivity of the virus could be another factor that determines plaque sizes was investigated. The uptake of viruses into cells in vitro was determined by measuring the amounts of specific viral RNA sequences through real-time PCR.

To measure total viral RNA, total cellular RNA was extracted using the RNEasy Mini kit (Qiagen), and complementary DNA synthesized using the iScript cDNA Synthesis kit (Bio-Rad). To measure total viral RNA, quantitative real-time PCR was done using a primer pair targeting a highly conserved region of the 3′ UTR common to all four serotypes of dengue; inter-sample normalization was done using GAPDH as a control. Primer sequences are listed in Table 5. Pronase (Roche) was used at a concentration of 1 mg/mL and incubated with infected cells for five minutes on ice, before washing with ice cold PBS. Total cellular RNA was then extracted from the cell pellets in the manner described above.

TABLE 5
PCR primer sequences.
Gene TargetPrimer Sequence
DENV LYL 3′UTRForward: TTGAGTAAACYRTGCTGCCTGTA
TGCC (SEQ ID NO: 24)
Reverse: GAGACAGCAGGATCTCTGGTCTY
TC (SEQ ID NO: 25)
GAPDH (Human)Forward: GAGTCAACGGATTTGGTCGT
(SEQ ID NO: 26)
Reverse: TTGATTTTGGAGGGATCTCG
(SEQ ID NO: 27)
CXCL10 (Human)Forward: GGTGAGAAGAGATGTCTGAATCC
(SEQ ID NO: 28)
Reverse: GTCCATCCTTGGAAGCACTGCA
(SEQ ID NO: 29)
ISG20 (Human)Forward: ACACGTCCACTGACAGGCTGTT
(SEQ ID NO: 30)
Reverse: ATCTTCCACCGAGCTGTGTCCA
(SEQ ID NO: 31)
IFIT2 (Human)Forward: GAAGAGGAAGATTTCTGAAG
(SEQ ID NO: 32)
Reverse: CATTTTAGTTGCCGTAGG
(SEQ ID NO: 33)
IFNα (Canine)Forward: GCTCTTGTGACCACTACACCA
(SEQ ID NO: 34)
Reverse: AAGACCTTCTGGGTCATCACG
(SEQ ID NO: 35)
IFNβ (Canine)Forward: GGATGGAATGAGACCACTGTCG
(SEQ ID NO: 36)
Reverse: ACGTCCTCCAGGATTATCTCCA
(SEQ ID NO: 37)

The proportion of infected cells was assessed by flow cytometry. Cells were fixed and permeabilised with 3% paraformaldehyde and 0.1% saponin, respectively. DENV envelope (E) protein was stained with mouse monoclonal 4G2 antibody (ATCC) and AlexaFluor488 anti-mouse secondary antibody. Flow cytometry analysis was done on a BD FACS Canto II (BD Bioscience).

Unexpectedly, despite DENV-2 PDK53 inducing stronger antiviral immune responses, it had higher rates of uptake by HuH-7 cells compared to DENV-2 16681 (FIG. 5). This difference continued to be observed when DENV-2 PDK53 inoculum was reduced 10-fold. In contrast, DENV-3 PGMK30 and its parental strain DENV-3 16562 displayed the same rate of viral uptake in host cells. Furthermore, DENV-2 PDK53 showed a higher viral replication rate compared to DENV-2 16681. This was determined by measuring the percentage of cells that harbored DENV E-protein, detected using flow cytometry. DENV-2 PDK53 showed a higher percentage of infected cells compared to DENV-2 16681 at the same amount of MOI from Day 1 to 3 (FIG. 6). In contrast, DENV-3 PGMK30 showed a reverse trend and displayed lower percentage of infected cells compared to DENV-3 16562. Results here show that successfully attenuated vaccines, as exemplified by DENV-2 PDK53, have greater uptake and replication rate.

Results above demonstrate that the DENV-2 PDK53 and DENV-3 PGMK30 are polarized in their properties that influence plaque morphologies. While both attenuated strains were selected for their formation of smaller plaques compared to their parental strains, the factors leading to this outcome are different between the two.

Accordingly, this study has demonstrated that successfully attenuated vaccines, as exemplified by DENV-2 PDK53 in this study, form smaller plaques due to induction of strong innate immune responses, which is triggered by fast viral uptake and spread of infection. In contrast, DENV-3 PGMK30 form smaller plaques due to its slower uptake and growth in host cells, which inadvertently causes lower up-regulation of the innate immune response.

Based on the results presented in the foregoing Examples, the present invention provides a new strategy to prepare a LAV, which expedites the production process and ensures the generation of effectively attenuated viruses fit for vaccine use.

US11865083B2. Rapid method of generating live attenuated vaccines (2024-01-09). NATIONAL UNIVERSITY OF SINGAPORE [SG]. Inventors: Eng Eong Ooi [SG], Kenneth Goh [SG], Swee Sen Kwek [SG], Choon Kit Tang [SG].
Full text: Click here
Patent 2024
Antibodies, Anti-Idiotypic Antigens, Viral Antiviral Agents Canis familiaris Cells Common Cold Cowpox virus Dengue Fever Dental Plaque DNA, Complementary DNA Replication Flow Cytometry GAPDH protein, human Genes Homo sapiens Immunity, Innate Infection Interferon-alpha Monoclonal Antibodies Mus Oligonucleotide Primers paraform Parent Pellets, Drug Pronase Proteins Real-Time Polymerase Chain Reaction Response, Immune RNA, Viral Saponin Senile Plaques Strains Vaccines Virus Virus Diseases Virus Replication
3
Binding Affinity of CD40-CEA Bispecific Antibodies
Not available on PMC !

Example 6

Aim and Background

The aim of this study was to assess the binding of the CD40-CEA RUBY™ bispecific antibodies to CEACAM5 expressed on cells and evaluate potential cross-reactivity to CEACAM1. In this study both CEACAM5 transfected cells and human tumor cells with endogenous CEACAM5 expression were used.

Materials and Methods

The human CEACAM5 and CEACAM1 genes were cloned into pcDNA3.1, and the vector was subsequently stably transfected into CHO cells. The tumor cell line MKN45, expressing high levels of CEACAM5, LS174T expressing intermediate levels of CEACAM5, and HT29 and LOVO expressing low levels of CEACAM5 (Table 16), CHO-CEACAM5, CHO-CEACAM1 and to CHO wt cells were incubated with titrated concentrations of CD40-CEA bispecific antibodies. Binding of the antibodies was detected using fluorochrome-conjugated anti-human IgG and analyzed using flow cytometry.

Results and Conclusions

The data demonstrate that all tested CD40-CEACAM5 RUBYs bind to CEACAM5 expressed on CHO-CEACAM5 (FIG. 6A-FIG. 6E), and MKN45 (high expressing) (FIG. 8A-FIG. 8C) and LS174T (intermediate expressing) human tumor cells (FIG. 8D-FIG. 8F). Low or no binding was observed to the CEACAM5 low expressing tumor cells, the LOVO cells (FIG. 8G-FIG. 8I). In addition, a low cross-reactivity to CEACAM1 or stickiness to CHO wt cells was observed with some of the CD40-CEA bispecific antibodies at very high concentrations (FIG. 7). In conclusion, all the CD40-CEA RUBY™ bispecific antibodies bind to CEACAM5 and with low or no binding to CEACAM1.

TABLE 16
Summary of CEA expression levels on CEACAM5 transfected
CHO cells and CEA expressing human tumor cells.
Tumor cell line and CEA
transfected CHO cellsReceptors/cell
HT2911 300
LOVO 5 500
LS174T51 500
MKN45353 000 
CHO-CEACAM5125 000 

US11873348B2. Peptides (2024-01-16). ALLIGATOR BIOSCIENCE AB [SE]. Inventors: Peter Ellmark [SE], Karin Hagerbrand [SE], Laura Varas [SE], Mattias Levin [SE], Anna Säll [SE], Laura von Schantz [SE].
Full text: Click here
Patent 2024
anti-IgG Antibodies Antibodies, Bispecific biliary glycoprotein I CEACAM5 protein, human Cell Line, Tumor Cells CHO Cells Cloning Vectors Cross Reactions Flow Cytometry Fluorescent Dyes Genes Homo sapiens HT29 Cells Neoplasms
4
Evaluating Cynomolgus Monkey Toxicity Model
Not available on PMC !

Example 7

To confirm that Cynomolgus monkey is a relevant toxicity species, protease activated CI104, CI106 and CI107 were used in a flow cytometry based cell binding assay and a HT29-luc2 cytotoxicity assay using Cynomolgus pan T cells (BioreclamationIVT) and the potency was compared to human PBMCs. Protocol was as described in Examples 2 and 3.

FIG. 6A and FIG. 6B demonstrate that the EC50s of the tested dually masked and protease activated bispecific antibodies in a cytotoxicity assay are similar when either human (6A) or cyno (6B) effector cells are used. FIG. 6C and FIG. 6D demonstrate that binding of the protease-activated and dually masked antibodies to human (6C) and cyno (6D) T cells is similar.

Therefore, cynomolgus monkey was determined to be a relevant species for tolerability studies.

US11859010B2. Antibodies, activatable antibodies, bispecific antibodies, and bispecific activatable antibodies and methods of use thereof (2024-01-02). CytomX Therapeutics, Inc. [US]. Inventors: Leila Marie Boustany [US], Sherry L. La Porte [US], Bryan A. Irving [US], Jeanne Grace Flandez [US].
Full text: Click here
Patent 2024
Antibodies Antibodies, Bispecific Biological Assay Cells Cross Reactions Cytotoxin Flow Cytometry Homo sapiens HT29 Cells Macaca fascicularis Peptide Hydrolases T-Lymphocyte
5
Identifying SLAM-Dependent Surface Lipoproteins
Not available on PMC !

Example 8

In selecting genomes for a given bacterial species where a SLAM homolog was identified, preference was given to reference genomes that contained fully sequenced genomes. SLAM homologs were identified using iterative Blast searches into closely related species to Neisseria to more distantly related species. For each of the SLAM homologs identified in these species, the corresponding genomic record (NCBI genome) was used to identify genes upstream and downstream along with their corresponding functional annotations (NCBI protein database, Ensembl bacteria). In a few cases, no genes were predicted upstream or downstream of the SLAM gene as they were too close to the beginning or end of the contig, respectively, and thus these sequences were ignored.

Neighbouring genes were analyzed for 1) an N-terminal lipobox motif (predicted using LipoP, SignalP), and 2) a solute binding protein, Tbp-like (InterPro signature: IPR or IPR011250), or pagP-beta barrel (InterPro signature: IPR011250) fold. If they contained these elements, we identified the adjacent genes as potential SLAM-dependent surface lipoproteins.

A putative SLAM (PM1515, SEQ ID NO: 1087) was identified in Pasteurella multocida using the Neisseria SLAM as a search. The putative SLAM (PM1515, SEQ ID NO: 1087) was adjacent to a newly predicted lipoprotein gene with unknown function (PM1514, SEQ ID NO: 1083) (FIG. 11A). The putative SLAM displayed 32% identity to N. meningitidis SLAM1 while the SLP showed no sequence similarity to known SLAM-dependent neisserial SLPs.

The putative SLAM (PM1515, SEQ ID NO: 1087) and its adjacent lipoprotein (PM1514, SEQ ID NO: 1083) were cloned into pET26b and pET52b, respectively, as previously described and transformed into E. coli C43 and grown overnight on LB agar supplemented with kanamycin (50 ug/ml) and ampicillin (100 ug/ml).

Cells were grown in auto-induction media for 18 hours at 37 C and then harvested, washed twice in PBS containing 1 mM MgCl2, and labeled with α-Flag (1:200, Sigma) for 1 hr at 4 C. The cells were then washed twice with PBS containing 1 mM MgCl2 and then labeled with R-PE conjugated α-mouse IgG (25 ug/mL, Thermo Fisher Scientific) for 1 hr at 4 C. following straining, cells were fixed in 2% formaldehyde for 20 minutes and further washed with PBS containing 1 mM MgCl2. Flow Cytometry was performed with a Becton Dickinson FACSCalibur and the results were analyzed using FLOWJO software. Mean fluorescence intensity (MFI) was calculated using at least three replicates was used to compare surface exposure the lipoprotein in strains either containing or lacking the putative SLAM (PM1515) and are shown in FIG. 11C and FIG. 11D. PM1514 could be detected on the surface of E. coli illustrating i) that SLAM can be used to identify SLPs and ii) that SLAM is required to translocate these SLPs to the surface of the cell—thus identifying a class of proteins call “SLAM-dependent surface lipoproteins”. Antibodies were raised against purified PmSLP (PM1514) and the protein was shown to be on the surface of Pasteurella multocida via PK shaving assays.

US11872275B2. SLAM polynucleotides and polypeptides and uses thereof (2024-01-16). ENGINEERED ANTIGENS INC. [CA]. Inventors: Trevor F. Moraes [CA], Christine Chieh-Lin Lai [CA], Yogesh Hooda [CA], Andrew Judd [CA], Anthony B. Schryvers [CA], Scott D. Gray-Owen [CA].
Full text: Click here
Patent 2024
Agar Ampicillin Antibodies Bacteria Binding Proteins Biological Assay Cells Escherichia coli Flow Cytometry Fluorescence Formaldehyde Genes Genome Kanamycin Lipoprotein (a-) Lipoproteins Magnesium Chloride Mus Neisseria Neisseria meningitidis Pasteurella multocida Proteins Staphylococcal Protein A Strains

Top products related to «Flow Cytometry»

1
Facscalibur by BD
Sourced in United States, Germany, United Kingdom, China, Canada, Japan, Italy, France, Belgium, Switzerland, Singapore, Uruguay, Australia, Spain, Poland, India, Austria, Denmark, Netherlands, Jersey, Finland, Sweden
The FACSCalibur is a flow cytometry system designed for multi-parameter analysis of cells and other particles. It features a blue (488 nm) and a red (635 nm) laser for excitation of fluorescent dyes. The instrument is capable of detecting forward scatter, side scatter, and up to four fluorescent parameters simultaneously.
2
Facscanto 2 by BD
Sourced in United States, Germany, United Kingdom, Belgium, China, Australia, France, Japan, Italy, Spain, Switzerland, Canada, Uruguay, Netherlands, Czechia, Jersey, Brazil, Denmark, Singapore, Austria, India, Panama
The FACSCanto II is a flow cytometer instrument designed for multi-parameter analysis of single cells. It features a solid-state diode laser and up to four fluorescence detectors for simultaneous measurement of multiple cellular parameters.
3
Facscalibur flow cytometer by BD
Sourced in United States, Germany, United Kingdom, China, Canada, Japan, Belgium, France, Spain, Italy, Australia, Finland, Poland, Switzerland, Cameroon, Uruguay, Denmark, Jersey, Moldova, Republic of, Singapore, India, Brazil
The FACSCalibur flow cytometer is a compact and versatile instrument designed for multiparameter analysis of cells and particles. It employs laser-based technology to rapidly measure and analyze the physical and fluorescent characteristics of cells or other particles as they flow in a fluid stream. The FACSCalibur can detect and quantify a wide range of cellular properties, making it a valuable tool for various applications in biology, immunology, and clinical research.
4
Lsrfortessa by BD
Sourced in United States, United Kingdom, Germany, France, Canada, Australia, Belgium, China, Uruguay, Japan, Sweden, Switzerland, Cameroon
The LSRFortessa is a flow cytometer designed for multiparameter analysis of cells and other particles. It features a compact design and offers a range of configurations to meet various research needs. The LSRFortessa provides high-resolution data acquisition and analysis capabilities.
5
Flow cytometry by BD
Sourced in United States, Germany, China, Japan, United Kingdom, Australia, Uruguay, Switzerland
Flow cytometry is an analytical technique used to detect and measure physical and chemical characteristics of particles or cells suspended in a fluid as they pass through a laser beam. It allows for the rapid analysis and sorting of individual cells within a heterogeneous mixture.
6
Cellquest software by BD
Sourced in United States, Germany, United Kingdom, Italy, Canada, China, Japan, Belgium, France, Spain, Switzerland, Poland, Uruguay, Denmark, Singapore
CellQuest software is a data acquisition and analysis software designed for flow cytometry applications. It provides tools for acquiring, processing, and analyzing flow cytometry data.
7
Facsdiva software by BD
Sourced in United States, Germany, United Kingdom, France, Canada, Belgium, Australia, Italy, Spain, Switzerland, China, Netherlands, Finland, Japan, Jersey, Lao People's Democratic Republic
FACSDiva software is a user-friendly flow cytometry analysis and data management platform. It provides intuitive tools for data acquisition, analysis, and reporting. The software enables researchers to efficiently process and interpret flow cytometry data.
8
Accuri c6 by BD
Sourced in United States, United Kingdom, Germany, China, France, Italy, Canada, Belgium, Japan, Switzerland, Australia, Ireland, Portugal, Spain, Uruguay, New Zealand
The BD Accuri C6 is a flow cytometer designed for analytical applications. It is capable of detecting and characterizing particles, cells, and other biological samples based on their size, granularity, and fluorescence properties.
9
Propidium iodide by Merck Group
Sourced in United States, Germany, United Kingdom, China, Italy, Japan, France, Sao Tome and Principe, Macao, Canada, Spain, India, Belgium, Australia, Israel, Switzerland, Poland, Ireland, Argentina, Austria, Brazil, Sweden, Portugal, New Zealand, Netherlands, Slovakia, Norway, Hungary, Czechia, Denmark
Propidium iodide is a fluorescent dye commonly used in molecular biology and flow cytometry applications. It binds to DNA and is used to stain cell nuclei, allowing for the identification and quantification of cells in various stages of the cell cycle.
10
Facscan by BD
Sourced in United States, Germany, China, United Kingdom, Italy, Japan, Spain, France, Canada, Switzerland, Jersey, Macao
The FACScan is a flow cytometry instrument manufactured by BD. It is designed to analyze and sort cells or particles in a fluid stream. The FACScan uses laser technology to detect and measure the physical and fluorescent characteristics of individual cells or particles as they pass through the instrument's flow cell.

More about "Flow Cytometry"

Explore the versatile world of flow cytometry, a cutting-edge analytical technique that has revolutionized fields like biology, immunology, and medicine.
This powerful method allows researchers to rapidly measure and analyze multiple physical and chemical characteristics of cells or particles as they flow through a fluid stream and encounter a beam of light.
With its ability to identify, enumerate, and sort different cell types based on size, granularity, and the expression of specific surface or intracellular markers, flow cytometry has become an indispensable tool in modern biomedical research.
From the FACSCalibur and FACSCanto II to the LSRFortessa, flow cytometers have become essential instruments in countless laboratories, enabling researchers to unlock new discoveries and gain deep insights into complex biological systems.
Powered by software like CellQuest and FACSDiva, these advanced instruments can even perform high-throughput cell analysis, revolutionizing the way researchers approach cell characterization.
Propidium iodide, a widely used fluorescent dye, has become a staple in flow cytometry, allowing researchers to stain and detect dead or dying cells.
The BD Accuri C6, a compact and user-friendly flow cytometer, has also become a popular choice for researchers and clinicians alike, offering a streamlined approach to cell analysis.
Whether you're working with immunology, cell biology, or any other field that requires in-depth cell analysis, flow cytometry is an essential tool that can help you unlock new discoveries and push the boundaries of your research.
Explore the latest advancements and best practices in flow cytometry, and discover how this powerful technique can transform your workflow and elevate your research to new heights.