Log In Sign up
The largest database of trusted experimental protocols
> Procedures > Laboratory Procedure > Spectrometry, Fluorescence

Spectrometry, Fluorescence

Spectrometry and fluorescence are powerful analytical techniques used in a wide range of scientific disciplines, from chemistry and biology to materials science and environmental research.
Spectrometry involves the measurement and analysis of the interaction between matter and electromagnetic radiation, allowing researchers to identify and quantify the components of a sample.
Fluorescence, on the other hand, is the emission of light by a substance that has absorbed light or other electromagnetic radiation.
These complementary techniques provide invaluable insights into the structure, composition, and behavior of materials and biological systems.
Researchers can elevate their spectrometry and fluorescence research by leveraging the AI-powered protocol optimization tools offered by PubCompare.ai, which help locate the best protocols from literature, pre-prints, and patents, maximizing research efficiency and discovering the optimal techniques for their experiments.
With PubCompare.ai's intelligent comparison tools, scientists can easily find and implement the most effective spectrometry and fluorescence protocols, accelerating their discoveries and advancing their fields of study.

Most cited protocols related to «Spectrometry, Fluorescence»

1
Quantitative PCR Amplification Protocol
Cited 14 times
PCR amplification was conducted as previously described [27 (link)] in which 3–4 replicate reactions were run for each quantity of lambda gDNA, and the FC datasets averaged to generate a single amplification profile for analysis. Briefly, replicate amplification sets consisting of 5.0 μl reactions containing lambda gDNA (New England BioLabs) at the specified quantity and 500 μM of the lambda primers K7B (CTGCTGGCCGGAACTAATGAATTTATTGGT) and K12 (ATGCCACGATGCCTCATCACTGTTG). The standard curve presented in Figure 1 employed QuantiTect (Qiagen) enzyme formulation, whereas DyNAmo (Finnzymes, distributed by New England BioLabs) was used for the standard curves containing increasing quantities of SYBR Green I (Table 1). SYBR Green I was diluted to the appropriate quantity using ddH20 before addition to the PCR master mix just prior to amplification reaction preparation and is expressed in units designated by the manufacturer (Invitrogen).
All amplifications were conducted with a Mx3000P spectrofluorometric thermal cycler (Stratagene) using a two temperature cycling regime initiated with a 15 min activation at 95°C, followed by 50 cycles of 120 s annealing and elongation at 65°C and a 10 s denaturation at 95°C. To increase optical precision, three fluorescent reads were taken at the end of the annealing and elongation step and the average used as an estimate of reaction fluorescence. Specificity of amplification was confirmed by melting curve analysis conducted at the end of each run.
An extensive description of the development and implementation of the LRE method is provided by Rutledge and Stewart [27 (link)]. Automated LRE analysis was conducted using the prototypic Java program provided as supplementary materials in this earlier study using default values.
Rutledge R.G, & Stewart D. (2008). Critical evaluation of methods used to determine amplification efficiency refutes the exponential character of real-time PCR. BMC Molecular Biology, 9, 96.
Publication 2008
DNA Replication Enzymes Fluorescence Oligonucleotide Primers Spectrometry, Fluorescence SYBR Green I Vision
2
Arsenic Analysis in Biological Samples
Cited 11 times
Many techniques are available to analyze arsenic in biological samples (B’Hymer and Caruso 2004 (link); Francesconi and Kuehnelt 2004 (link); Gong et al. 2002 (link); Mandal et al. 2004 (link); WHO, 2001 ). Methods to measure total arsenic include neutron activation, X-ray fluorescence, atomic absorption and fluorescence spectrometry, and inductively coupled plasma–atomic emission and –mass spectrometry. The latter two techniques are the most sensitive for total arsenic measurement (picogram range). Sample preparation can be burdensome for total arsenic measurement using the spectroscopic techniques. The organic arsenic in the matrix must be converted to iAs, usually by heating the sample to extreme temperatures in concentrated acid or by dry ashing.
Speciated analysis can differentiate inorganic from organic arsenic, and some techniques may maintain its oxidation state. Speciated analysis is performed by coupling chromatographic separation with a detector used for total arsenic analysis (Table 2). Sample preparation for speciated analysis is not as extreme as required for total arsenic analysis. In some cases, urine can be analyzed directly after removal of particulates by centrifugation.
The stability of arsenicals, particularly trivalent species, excreted in urine is a critical issue for speciated arsenic analysis. It is generally difficult to analyze urinary arsenic at a collection site. Storage of samples at 4 and −20°C appears to be suitable for maintaining the valence of some arsenicals for several months (Chen et al. 2002 (link); Feldmann et al. 1999 (link)). Freeze-drying urine samples and storing frozen also extends stability of arsenicals (Feldmann et al. 1999 (link); Yoshinaga et al. 2000 (link)).
Crecelius and Yager (1997) (link) examined the variability in arsenic quantitation among several different laboratories. These laboratories analyzed standard solutions of MMAV and DMAV, a reference sample and human urine spiked with iAsIII, iAsV, MMAV, and DMAV. Different methods were used for total and speciated arsenic analysis. For samples that contained < 5 μg/L arsenic, the accuracy and precision were poor. However, the measurement of total iAs, MMAV, and DMAV improved at levels > 5 μg/L, levels relevant to human exposure.
Standard reference material for arsenic is available in biological matrices such as urine, muscle, and liver but is certified only for total arsenic. Although a certified reference material for speciated arsenic in urine has been prepared (Yoshinaga et al. 2000 (link)), it is less readily obtainable. The identity of specific arsenicals has also become an issue. Hansen et al. (2004) (link) reported that an arsenic sulfur compound that was detected in urine has been misidentified as DMAIII. The availability of standard reference material for arsenic, which includes the trivalent methylated forms, has a tremendous impact on the ability to properly conduct an arsenic exposure analysis if biomarkers of exposure are to be used.
, & Hughes M.F. (2006). Biomarkers of Exposure: A Case Study with Inorganic Arsenic. Environmental Health Perspectives, 114(11), 1790-1796.
Publication 2006
Acids Arsenic Arsenicals Biological Markers Biopharmaceuticals Centrifugation Chromatography Fluorescence Freezing Homo sapiens Liver Mass Spectrometry Muscle Tissue Plasma Roentgen Rays Spectrometry, Fluorescence Spectrum Analysis Sulfur Sulfur Compounds Urine Urine Specimen Collection
3
Trypsin-Mediated Hemagglutinin Fusion Assay
Cited 11 times
HAb2 cells were treated by 5 μg/ml trypsin (Fluka, Buchs, Switzerland) for 10 min at room temperature to cleave HA0 into its fusion-competent HA1-S-S-HA2 form. For HA300a and BHA-PI cells, trypsin (5 μg/ml) was supplemented with neuraminidase (0.2 mg/ml; Sigma Chemical Co.) to improve binding of RBC. The enzymes were applied together for 10 min at room temperature. To terminate the reaction, HA-expressing cells were washed twice with complete medium containing 10% fetal serum. After two washings with PBS, cells were incubated for 10 min with a 1 ml suspension of RBC (0.05% hematocrit). HA-expressing cells with zero to two bound RBC per cell were washed three times with PBS to remove unbound RBC and then used. When measuring RBC binding to cells, several areas of the dish were selected. We screened at least 200 cells to find the average number of RBC bound to each HA-expressing cell.
Fusion was triggered by incubation of cells with PBS titrated by citrate to acidic pH. After low-pH treatment, acidic solution was replaced by PBS. Fusion extent was assayed by fluorescence microscopy more than 20 min after low-pH application as the ratio of dye-redistributed bound RBC to the total number of the bound RBC. Longer incubations (up to 2 h) did not increase the extent of fusion. We performed the fluorescence microscopy for lipid and content mixing either in a cold room at 4°C or at room temperature, as required.
For spectrofluorometric measurements (SLM-Aminco, Urbana, IL), excitation and emission wavelengths were 550 and 590 nm for R18, and 473 and 515 nm for NBD-taurine. The standard fusion assay was performed as in Chernomordik et al. (1997) (link). Suspensions of HA-expressing cells with bound RBC in PBS were placed into a thermostated fluorescence cuvette and stirred with a Teflon-coated flea. Citric acid was injected into the cuvette to lower pH to 4.9. The increase in fluorescence was normalized to that at infinite dilution of the probe by lysing cells with 0.06% SDS. Spectrofluorometry was also used to evaluate LPC incorporation into RBC membranes at different temperature from the decrease in R18 quenching caused by adding exogenous lipid to HAb2 cells with bound R18-labeled RBC (Chernomordik et al., 1997 (link)). To induce swelling of cells by applying hypotonic medium (osmotic shock), HA-expressing cells with bound RBC were placed into PBS diluted by H2O (1:3) as in Melikyan et al. (1995b) (link).
Each set of experiments for each graph presented here was repeated on at least three occasions with similar results. Presented data were averaged from the same set of experiments.
Chernomordik L.V., Frolov V.A., Leikina E., Bronk P, & Zimmerberg J. (1998). The Pathway of Membrane Fusion Catalyzed by Influenza Hemagglutinin: Restriction of Lipids, Hemifusion, and Lipidic Fusion Pore Formation. The Journal of Cell Biology, 140(6), 1369-1382.
Publication 1998
Acids Biological Assay Cells Citrates Citric Acid Cold Temperature Enzymes Fetus Fleas Fluorescence Fusions, Cell Hyperostosis, Diffuse Idiopathic Skeletal Lipids Microscopy, Fluorescence NBD-taurine Neuraminidase Osmotic Shock Serum Spectrometry, Fluorescence Technique, Dilution Teflon Tissue, Membrane Trypsin Volumes, Packed Erythrocyte
4
Assessing Mercury Levels in Hair Samples
Cited 9 times
Hair segments of 0.4 in. (1.0 cm) closest to the scalp, approximately 1 month’s growth, were analyzed for total Hg concentration using a cold vapor atomic fluorescence spectroscopy method (Pellizzari et al. 1999 (link)). The method involves digestion of the analyte from hair samples using a 30:70 mixture of sulfuric and nitric acids and subsequent analysis by cold vapor atomic fluorescence spectrometry. The analyte is identified by the presence of fluorescence signal from a Hg-specific detector. During NHANES 1999–2000, hair Hg was analyzed in batches of 20–40 samples, and quantification of the analyte was carried out using batch-specific standard calibration curves. Linearity greater than 0.99 was confirmed for each curve using eight aqueous calibration standards (0, 5, 10, 30, 50, 80, and 85 pg/mL Hg) as previously described (Pellizzari et al. 1999 (link)). Daily quality control (QC) procedures included analysis in triplicate of a known human hair reference standard certified at 4.42 μg/g Hg (Pellizzari et al. 1999 (link)). QC standard checks were performed initially and after every 10th sample, and replicate measurements were performed (duplicate sample preparation with duplicate analysis of each preparation).
Percent recovery of the Hg analyte was monitored by analyzing hair samples spiked with a known Hg reference standard before the digestion process. Mean percent recovery of Hg (± SD) in the spiked samples was 96.2 ± 12.1%]. The precision of analysis was assessed from duplicate extracts (i.e., reanalysis of the same extract at a later time) and from duplicate hair sample analyses (i.e., a second aliquot of hair processed through the entire analysis process). The mean precision (± SD) for duplicate extract and sample analyses was 5.4 ± 8.7% and 11.7 ± 14.4%), respectively. The limit of detection (LOD) for total hair Hg varied by analytic batch because of the laboratory’s batch-specific standardization methodology. Method detection limits ranged from 0.0006 to 0.06 μg/g. Whenever the values for hair Hg were below a batch LOD, a fill value equal to the batch-specific LOD divided by the square root of 2 was used (Taylor 1987 ).
McDowell M.A., Dillon C.F., Osterloh J., Bolger P.M., Pellizzari E., Fernando R., de Oca R.M., Schober S.E., Sinks T., Jones R.L, & Mahaffey K.R. (2004). Hair Mercury Levels in U.S. Children and Women of Childbearing Age: Reference Range Data from NHANES 1999–2000. Environmental Health Perspectives, 112(11), 1165-1171.
Publication 2004
Cold Temperature Digestion Digestive System Processes DNA Replication Fluorescence Fluorescence Spectroscopy Hair Hair Analysis Homo sapiens Nitric acid Plant Roots Scalp Spectrometry, Fluorescence Sulfur
5
Quantification of DWV Strands using qRT-PCR
Cited 8 times
TaqMan real-time quantitative RT-PCR (qRT-PCR) incorporated with biotinylated-primers and magnetic bead purification was performed for quantification of negative and positive-strands of DWV using the Stratagene Mx3000P spectrofluorometric thermal cycler operated by MxPro qPCR software. The virus levels were quantified based on the value of the cycle threshold (Ct), which represents the number of cycles needed to generate a fluorescent signal above a predefined threshold and is inversely proportional to the concentration of the initial target that has been amplified. The house keeping gene, β-actin, was employed as an endogenous control for normalization of the quantification. The sequence information of primers and probes for both DWV and β-actin are the same as described before [30 (link)]. The amplification reaction mixture and conditions were the same as the strand-specific RT-PCR, mentioned above, except that a 0.2 μM TaqMan probe was incorporated in the PCR amplification. The measurement of the strand-specific virus titer was conducted in bees with deformed wings and with apparently normal wings.
Boncristiani HF J.r., Di Prisco G., Pettis J.S., Hamilton M, & Chen Y.P. (2009). Molecular approaches to the analysis of deformed wing virus replication and pathogenesis in the honey bee, Apis mellifera. Virology Journal, 6, 221.
Publication 2009
Actins Bees Genes, Housekeeping Oligonucleotide Primers Real-Time Polymerase Chain Reaction Reverse Transcriptase Polymerase Chain Reaction Spectrometry, Fluorescence Virus

Most recents protocols related to «Spectrometry, Fluorescence»

1
Cold Vapor-AFS for Total Mercury Analysis
Total Hg was analyzed
using cold vapor-atomic fluorescence spectrometry (CV-AFS) following
reduction with SnCl2. Freeze-dried samples were digested
with 8 mL of aqua regia at 100 °C on a hotplate for 2 h in rigorously
acid-leached 50 mL polypropylene digestion tubes. Standard reference
material that consists of stream sediment (GBW07305; the certified
Hg value is 100 ng g–1) and sample blanks were digested
with every 20 samples or less. Average reference material recoveries
were within 4% of certified values, with standard deviation (SD) less
than 5 ng g–1 (n > 3) for every
batch of sample digestions and measurements. During the CV-AFS measurements,
standard solutions and quality-control blanks were measured every
five samples to monitor measurement stability.
Yang H., Macario-González L., Cohuo S., Whitmore T.J., Salgado J., Peréz L., Schwalb A., Rose N.L., Holmes J., Riedinger-Whitmore M.A., Hoelzmann P, & O’Dea A. (2023). Mercury Pollution History in Tropical and Subtropical American Lakes: Multiple Impacts and the Possible Relationship with Climate Change. Environmental Science & Technology, 57(9), 3680-3690.
Publication 2023
aqua regia Cold Temperature Digestion Freezing Polypropylenes Spectrometry, Fluorescence
2
Biodistribution of Doxorubicin Formulations
14 days after tumor inoculation, when the tumor size was approximately 5 mm wide, mice were randomly classified into 9 treatment groups (n = 3). The free Dox, Caelyx®, F2, F3, F4, F5, F6, F7, and F8 formulations were then systemically injected via the tail vein at the equivalent dose of 10 mg/kg of Dox. 200 µL of PBS were injected to control mice. 24 h later, animals were killed and their main organs, including spleen, lung, heart, kidney, a piece of liver, and the tumor region were removed, weighed, and put in a 2 mL polypropylene microvials (BioSpec Products, Inc., Bartlesville, USA) containing 1 mL of acidified isopropanol plus zirconia beads (1600 mg) and homogenized by the Mini-Beadbeater-1 (BioSpec Products, Inc., Bartlesville, USA). The homogenized tissue samples were then stored at 2–8 °C. The samples were finally centrifuged at 14,000 rpm for 10 min, and the Dox concentration in the supernatant was assessed using spectrofluorometry as described in the Additional file 1.
Askarizadeh A., Mashreghi M., Mirhadi E., Mirzavi F., Shargh V.H., Badiee A., Alavizadeh S.H., Arabi L, & Jaafari M.R. (2023). Doxorubicin-loaded liposomes surface engineered with the matrix metalloproteinase-2 cleavable polyethylene glycol conjugate for cancer therapy. Cancer Nanotechnology, 14(1), 18.
Publication 2023
Animals Caelyx Cancer Vaccines Heart Isopropyl Alcohol Kidney Liver Lung Mus Neoplasms Polypropylenes Spectrometry, Fluorescence Spleen Tail Tissues Veins zirconium oxide
3
Trace Element Analysis of MFHT Infusions
The MFHT samples were dried, crushed, passed through an 80-mesh sieve, sealed in a sample bag, and stored in a desiccator. Dried samples (0.3 g) were digested with 5 mL HNO3 and 2 mL H2O2. The samples were then placed in a microwave digester (TANK PRO, Hanon, Shandong, China) and digested according to the procedure described in Supplementary Table 1. Subsequently, the digestion solution was heated to 150 °C in an acid detector (TK-12, Hanon, Shandong, China) until the red-brown vapor evaporated and was concentrated to 1–2 mL before being transferred to a 10 mL polyethylene terephthalate tube. The volume was increased to 10 mL with 2% nitric acid and refrigerated for testing. The Fe, Mn, Zn, Cu, Cr, Cd, Pb, and Ni contents of the digested samples were analyzed via inductively coupled plasma mass spectrometry (NexION300D, PerkinElmer, Inc., USA). As was analyzed by atomic fluorescence spectrometry (AFS-6790, Haiguang, Beijing, China). The concentration deviations obtained for sample replicates were within ± 5%.
Six samples were randomly selected from the same type of MFHT (a total of 72 samples from the 12 types of MFHTs) for the infusion extraction experiment. By investigating the weight of herbal tea bags in markets and simulating the herbal tea brewing process, 20 g of uncrushed herbal tea sample was weighed and was added to 200 mL of boiled deionized water and steeped for 30 min. These infusion samples were digested, and the concentrations of Fe, Mn, Zn, Cu, Cr, Cd, As, Pb, and Ni were tested using via ICP-MS (NexION300D, PerkinElmer, Inc., USA) employed to analyze the trace element content in the MFHTs.
Xiao C., Liang B., Xiong W, & Ye X. (2023). Enrichment and health risks associated with trace elements in medicine food homology teas. Environmental Science and Pollution Research International, 30(18), 54193-54204.
Publication 2023
Acids Digestion Mass Spectrometry Microwaves Nitric acid Peroxide, Hydrogen Plasma Polyethylene Terephthalates Spectrometry, Fluorescence Teas, Herbal Trace Elements
4
Selenium Resistance in Intercropped Plants
To determine whether the intercropping could improve the resistances of these plants to Se, the third mature leaf of each plant from the top was collected to determine various parameters, including the contents of photosynthetic pigments (chlorophyll a, chlorophyll b, and carotenoid), activities of antioxidant enzymes [superoxide dismutase (SOD), peroxidase (POD), and catalase (CAT)], and soluble protein content following the methods reported by Lin et al. (2023) [44 (link)] and Hao et al. (2004) [45 ] two months after plants transplanting. Subsequently, the plants were harvested and treated as described by Li et al. (2022) [46 (link)]. The dry weights (biomass) of roots and shoots were measured using an electronic balance. The plant samples were dried, ground, and digested with nitric acid and perchloric acid. Furthermore, the digestion solutions were reduced with hydrochloric acid, and the Se concentration was determined using a hydride generation-atomic fluorescence spectrometry (AFS-9700, Beijing Haiguang Instrument Co., Ltd., Beijing, China) [46 (link)]. The translocation factor (TF, Se content in shoots/Se content in roots) was calculated as described previously [47 (link)].
Lin L., Xu X., Wang J., Wang X., Lv X., Tang Y., Deng H., Liang D, & Xia H. (2023). Intercropping of Cyphomandra betacea with Different Ploidies of Solanum Sect. Solanum (Solanaceae) Wild Vegetables Increase Their Selenium Uptakes. Plants, 12(4), 716.
Publication 2023
Antioxidant Activity Carotenoids Catalase Chlorophyll A chlorophyll b Digestion Enzymes Hydrochloric acid Nitric acid Perchloric Acid Peroxidase Photosynthesis Pigmentation Plant Leaves Plant Roots Plants Proteins Spectrometry, Fluorescence Superoxide Dismutase Translocation, Chromosomal
5
Cytosolic and Mitochondrial Ca2+ Dynamics
Cytosolic Ca2+ transients were recorded in RV cardiomyocytes loaded with Fura-2 (as described in Section 2.3). Cells were field-stimulated at 1 Hz (room temperature) and continuously superfused with Tyrode’s solution containing (in mM): 140 NaCl, 4 KCl, 10 Hepes, 1 MgCl2, 10 Glucose, and 1 CaCl2 (all Sigma-Aldrich Co. Merck, Darmstadt, Germany). Myocytes were imaged using a 20× fluorescent objective lens (0.75 NA) and illuminated with alternating 340 nm and 380 nm excitation wavelengths every 5 ms using an Optoscan monochromator and a spectrofluorometric PMT-based system (Cairn, Faversham, the UK). Emitted 510 ± 15 nm fluorescence was acquired at 400 Hz using Acquisition Engine Software (Cairn, Faversham, the UK) from whole cells as a measure of cytosolic [Ca2+] fluxes. Myocytes were subjected to 1 Hz stimulation until steady state was achieved. At this point, both the flow and the stimulation were switched off, and a 20 mM bolus of caffeine (Sigma-Aldrich) in Tyrode’s solution was applied to the bath to determine Ca2+ store content and sarcolemmal NCX activity. Superfusion with caffeine-free Tyrode’s solution and stimulation at 1 Hz were then re-commenced. The response to β-adrenergic stimulation with 1 mM Ca2+ Tyrode’s solution containing 1 µM isoproterenol (ISO, Sigma-Aldrich, cat no. 16504) was then determined.
Mitochondrial Ca2+ measurements were taken from dhRhod-2 loaded myocytes using the same spectrofluorometric system described above. Cells were field-stimulated at 0.1, 0.5, and 1 Hz (room temperature) and continuously superfused with 1.5 mM [Ca2+] Tyrode’s solution containing 1 µM isoproterenol and 150 µM spermine (Cayman Chemical, Ann Arbor, MI, USA, cat no. 136587-13-8). Myocytes were illuminated with a 542 ± 10 nm excitation wavelength and emitted fluorescence was collected at 581 nm (±10 nm) from whole cells as a measure of mitochondrial Ca2+ fluxes.
Krstic A.M., Power A.S, & Ward M.L. (2023). Increased Mitochondrial Calcium Fluxes in Hypertrophic Right Ventricular Cardiomyocytes from a Rat Model of Pulmonary Artery Hypertension. Life, 13(2), 540.
Publication 2023
Adrenergic Agents Bath Caffeine Caimans Cells Cytosol Fluorescence Fura-2 Glucose HEPES Isoproterenol Lens, Crystalline Magnesium Chloride Mitochondrial Inheritance Muscle Cells Myocytes, Cardiac Sodium Chloride Spectrometry, Fluorescence Spermine Transients

Top products related to «Spectrometry, Fluorescence»

1
Icycler by Bio-Rad
Sourced in United States, Germany, Japan, China, United Kingdom, Canada, France, Italy, Australia
The iCycler is a real-time PCR detection system designed for nucleic acid quantification and analysis. It features a thermal cycler and an optical detection system for measuring fluorescence during the amplification process. The iCycler is capable of performing real-time PCR experiments and data analysis.
2
Trizol reagent by Thermo Fisher Scientific
Sourced in United States, China, Japan, Germany, United Kingdom, Canada, France, Italy, Australia, Spain, Switzerland, Netherlands, Belgium, Lithuania, Denmark, Singapore, New Zealand, India, Brazil, Argentina, Sweden, Norway, Austria, Poland, Finland, Israel, Hong Kong, Cameroon, Sao Tome and Principe, Macao, Taiwan, Province of China, Thailand
TRIzol reagent is a monophasic solution of phenol, guanidine isothiocyanate, and other proprietary components designed for the isolation of total RNA, DNA, and proteins from a variety of biological samples. The reagent maintains the integrity of the RNA while disrupting cells and dissolving cell components.
3
Cdna synthesis kit by Thermo Fisher Scientific
Sourced in United States, Canada, Germany, Lithuania, China, United Kingdom, Japan, India, Italy
The cDNA Synthesis Kit is a laboratory tool designed for the reverse transcription of RNA into complementary DNA (cDNA). This kit provides the necessary components, including reverse transcriptase enzyme, buffer, and primers, to facilitate the conversion of RNA into a DNA format suitable for further analysis and applications.
4
Spectramax gemini by Molecular Devices
Sourced in United States, Germany
The SpectraMax Gemini is a multi-mode microplate reader designed for a variety of applications in life science research. It features optical components for absorbance, fluorescence, and luminescence detection, enabling users to perform diverse assays on a single platform.
5
Cary eclipse by Agilent Technologies
Sourced in United States, Australia, United Kingdom, Canada, China, Malaysia, Japan
The Cary Eclipse is a fluorescence spectrophotometer designed for accurate and sensitive fluorescence measurements. It features a xenon flash lamp, double-monochromator system, and photomultiplier tube detector to provide high-performance fluorescence analysis.
6
Ls50b by PerkinElmer
Sourced in United States, United Kingdom, Italy, Germany, Japan
The LS50B is a benchtop luminescence spectrometer designed for fluorescence and phosphorescence measurements. It features a Xenon discharge lamp, monochromators for excitation and emission, and a photomultiplier tube detector. The LS50B can be used to analyze a variety of samples and is suitable for both qualitative and quantitative applications.
7
Spectramax m5 by Molecular Devices
Sourced in United States, China, Japan, Switzerland, United Kingdom, Canada, Germany, Brazil, Uruguay
The SpectraMax M5 is a multi-mode microplate reader designed for absorbance, fluorescence, and luminescence measurements. It provides a diverse range of capabilities to support various applications in life science research and drug discovery.
8
Cdna synthesis kit by Bio-Rad
Sourced in United States, Italy, India, Australia, China, United Kingdom
The cDNA Synthesis Kit is a laboratory reagent used to convert RNA into complementary DNA (cDNA) molecules. It provides the necessary enzymes, buffers, and reagents to perform reverse transcription, a fundamental step in various molecular biology applications such as gene expression analysis, RT-PCR, and cDNA library construction.
9
Aia 360 by Tosoh
Sourced in Japan, United States, Germany, Belgium
The AIA-360 is an automated immunoassay analyzer developed by Tosoh Corporation. It is designed to perform various immunoassay tests for the detection and quantification of a wide range of analytes in clinical samples. The AIA-360 utilizes chemiluminescent technology to provide accurate and reliable results. However, a detailed description of its core function is not available while maintaining an unbiased and factual approach.
10
Quantitect sybr green pcr kit by Qiagen
Sourced in Germany, United States, United Kingdom, China, Canada, Australia, Switzerland, Japan, France, Netherlands, Denmark, Italy, Spain
The QuantiTect SYBR Green PCR Kit is a reagent kit designed for quantitative real-time PCR (qPCR) analysis. It contains all the necessary components, including a SYBR Green-based master mix, for performing sensitive and reproducible real-time PCR amplification and detection of target DNA sequences.

More about "Spectrometry, Fluorescence"

Spectrometry and fluorescence are powerful analytical techniques that are widely used in various scientific disciplines, including chemistry, biology, materials science, and environmental research.
Spectrometry involves the measurement and analysis of the interaction between matter and electromagnetic radiation, allowing researchers to identify and quantify the components of a sample.
This technique is commonly used in techniques like ICycler, SpectraMax Gemini, Cary Eclipse, and LS50B.
Fluorescence, on the other hand, is the emission of light by a substance that has absorbed light or other electromagnetic radiation.
This complementary technique is often utilized in conjunction with tools like TRIzol reagent, cDNA synthesis kits, and SpectraMax M5 to provide invaluable insights into the structure, composition, and behavior of materials and biological systems.
Researchers can elevate their spectrometry and fluorescence research by leveraging the AI-powered protocol optimization tools offered by PubCompare.ai, which help locate the best protocols from literature, pre-prints, and patents, maximizing research efficiency and discovering the optimal techniques for their experiments.
With PubCompare.ai's intelligent comparison tools, scientists can easily find and implement the most effective spectrometry and fluorescence protocols, accelerating their discoveries and advancing their fields of study.
Additionally, techniques like the QuantiTect SYBR Green PCR Kit and AIA-360 analyzer can be used to further enhance the capabilities of spectrometry and fluorescence research.