The largest database of trusted experimental protocols
> Procedures > Laboratory Procedure > Transmission Electron Microscopy

Transmission Electron Microscopy

Transmission Electron Microscopy (TEM) is a powerful imaging technique that uses a focused beam of electrons to produce high-resolution images of small-scale structures.
This method allows researchers to visualize and analyze the internal structure and composition of materials at the nanoscale level.
PubCompare.ai revolutionizes TEM workflows by leveraging AI-driven platforms to help scientists effortlessly locate the best protocols from literature, pre-prints, and patents.
This intelligent comparison tool enables researchers to identify the optimal procedures and products, streamlining their TEM-based investigations and leading to groundbreaking discoveries.
With a seamless, typo-free experience, PubCompare.ai empowers scientists to navigte the complexities of TEM with ease and efficiency.

Most cited protocols related to «Transmission Electron Microscopy»

Postnatal day 30 (P30) TWI mice and their WT littermates (5 for each experimental group processed in 5 different experimental sessions, every TWI with its WT littermate) and one P15 TWI mouse versus its WT littermate were perfused with a fixative solution (4% paraformaldehyde and 0.1%–1%–2.5% glutaraldehyde in phosphate buffer, pH 7.4). Sciatic nerves, spinal cords and gastrocnemius muscles were dissected and post-fixed for 4 hours at room temperature in the same fixative solution.
Spinal cords were dissected in the lumbar region, isolating four 1-mm-thick sections in the lumbar enlargement region and the gastrocnemius muscles were cut in small portions, approximately 1 mm3 in volume. Sciatic nerves were processed without further sectioning.
The selected tissues were further treated for epoxy resin embedding as previously described43 . Briefly, the samples were deeper fixed in 2–2.5% glutaraldehyde in cacodylate buffer (0.1 M, pH 7.4). After rinsing, specimens were post-fixed with osmium tetroxide (1%)-potassium ferricyanide (1%) in cacodylate buffer, rinsed again, en bloc stained with 3% uranyl acetate in ethanol, dehydrated and embedded in epoxy resin, that was baked for 48 h at 60 °C. Thin sections were obtained with an ultramicrotome (UC7, Leica Microsystems, Vienna, Austria) and collected on G300Cu grids (EMS). Finally, sections were examined with a Zeiss LIBRA 120 plus transmission electron microscope equipped with an in-column omega filter.
Publication 2016
Buffers Cacodylate Epoxy Resins Ethanol Fixatives Glutaral Hypertrophy Lumbar Region Mice, House Microtomy Muscle, Gastrocnemius Osmium Tetroxide paraform Phosphates potassium ferricyanide Sciatic Nerve Spinal Cord Tissues Transmission Electron Microscopy Ultramicrotomy uranyl acetate
We performed complementation analysis, genetics, molecular biology, western blotting, immunostaining and generation of transgenic animals using standard techniques4 (link). Multiple new lines of the full-length ‘short’ isoform of Mical, the MicalΔredox mutation (MicalG→W; ref. 4 (link)) and the other transgenic animals were generated and used for all experiments. Adult bristles were examined and quantified by crossing adults at 25 °C: adult offspring from these crosses were first sorted according to genotype and then examined under a dissecting microscope. We genotyped pupae using a Zeiss Discovery M2 Bio fluorescence stereomicroscope, and all preparation, staging and dissection of pupae were done using standard approaches. We imaged, drew and quantified the adult bristles with the aid of the Discovery M2 Bio stereomicroscope, a motorized focus and zoom, a Zeiss AxioCam HR camera and three-dimensional-reconstruction software (Zeiss AxioVision, version 4.6.3, and Extended Focus software). All other bright-field, dark-field, differential interference contrast and fluorescence visualization, and imaging of bristles, embryos and growth cones, was done using a Zeiss Axio Imager upright microscope with motorized focus and zoom and an ApoTome module, and images were captured and quantified using the AxioCam HR camera and AxioVision software. All electron microscopy of pupae and negative staining of purified proteins was done using a FEI Tecnai G2 Spirit BioTWIN transmission electron microscope. We purified recombinant Mical proteins10 and recombinant p-hydroxybenzoate hydroxylase using our previously developed approaches. Drosophila fascin (also known as singed) complementary DNA was inserted in a bacterial expression vector, and recombinant Drosophila fascin protein was purified. All F-actin and Mical co-sedimentation assays and G-actin/F-actin ratio experiments were performed using standard approaches, as were all pyrene-labelled actin polymerization and depolymerization assays, actin bundling assays, tubulin polymerization assays and microtubule co-sedimentation assays.
Publication 2010
Actins Adult Animals, Transgenic Bacteria Biological Assay Cloning Vectors Dissection DNA, Complementary Drosophila Electron Microscopy Embryo F-Actin fascin Fluorescence G-Actin Growth Cones Hydroxybenzoates Microscopy Microtubules Mixed Function Oxygenases Mutation Polymerization Protein Isoforms Proteins Pupa Pyrenes Reconstructive Surgical Procedures Sn protein, Drosophila Transmission Electron Microscopy Tubulin
Frozen plasma specimens were thawed and centrifuged at 2,000×g for 10 min at 4°C and then at 10,000–14,000×g for 30 min at 4°C. Clarified plasma was passed through 0.22 µm-pore Millipore filter and used for exosome isolation by SEC performed using 1.5 cm×12 cm mini-columns (Bio-Rad, Hercules, CA, USA; Econo-Pac columns) packed with Sepharose 2B (Sigma-Aldrich, St. Louis, MO, USA). The column bed volume is 10 mL. Prior to applying clarified plasma, the column is washed with 20 mL of phosphate-buffered saline (PBS), and a porous frit is placed at the top of the gel to prevent its disturbance during subsequent elution with PBS. Clarified plasma (0.5–1.0 mL) was loaded onto the column and five 1 mL fractions corresponding to the void volume peak were collected. Fractions # 3, #4 and #5 were tested for protein content, morphology by transmission electron microscopy (TEM) and in functional assays. In preparation for western blots, the fractions were concentrated using 300,000 MWCO VivaSpin 500 Centrifugal Concentrators (Sartorius Corp, New York, NY, USA) by centrifugation at 5,000×g for 2–15 min, depending on the content. Supplementary Fig. 1 shows the schema for isolation of plasma exosomes by the mini-SEC method.
Publication 2016
Biological Assay Centrifugation Exosomes Freezing isolation Phosphates Plasma Proteins Saline Solution Sepharose Transmission Electron Microscopy Urination Western Blot

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2016
Animals Bacteria Biological Assay Cytokine Flow Cytometry Immunofluorescence Immunofluorescence Microscopy Lactate Dehydrogenase Light Microscopy Macrophage Microarray Analysis Microscopy Mus Real-Time Polymerase Chain Reaction RNA, Small Interfering Sequence Analysis, Protein Transmission Electron Microscopy

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2011
Acetic Acid Acids Apatites Carbonate, Calcium Dental Enamel Dentin dicalcium phosphate dimethyl 2,3,5,6-tetrachloroterephthalate Electrostatics Forests Ions Minerals Molar Powder Radiography SNCA protein, human Transmission Electron Microscopy

Most recents protocols related to «Transmission Electron Microscopy»

Example 1

a. Materials and Methods

i. Vector Construction

1. Virus-Like Particle

As most broadly neutralizing HPV antibodies are derived from the highly conserved N-terminal region of L2, amino acids 14-122 of HPV16 L2 were used to create HBc VLPs. L2 with flanking linker regions was inserted into the tip of the a-helical spike of an HBc gene copy which was fused to another copy of HBc lacking the L2 insert. This arrangement allows the formation of HBc dimers that contain only a single copy of L2, increasing VLP stability (Peyret et al. 2015). This heterodimer is referred to as HBche-L2. A dicot plant-optimized HPV16 L2 coding sequence was designed based upon the sequence of GenBank Accession No. CAC51368.1 and synthesized in vitro using synthetic oligonucleotides by the method described (Stemmer et al., 1995). The plant-optimized L2 nucleotide sequence encoding residues 1-473 is posted at GenBank Accession No. KC330735. PCR end-tailoring was used to insert Xbal and SpeI sites flanking the L2 aa 14-122 using primers L2-14-Xba-F (SEQ ID NO. 1: CGTCTAGAGTCCGCAACCCAACTTTACAAG) and L2-122-Spe-R (SEQ ID NO. 2: G GGACTAGTTGGGGCACCAGCATC). The SpeI site was fused to a sequence encoding a 6His tag, and the resulting fusion was cloned into a geminiviral replicon vector (Diamos, 2016) to produce pBYe3R2K2Mc-L2(14-122)6H.

The HBche heterodimer VLP system was adapted from Peyret et al (2015). Using the plant optimized HBc gene (Huang et al., 2009), inventors constructed a DNA sequence encoding a dimer comprising HBc aa 1-149, a linker (G2S)5G (SEQ ID NO. 39), HBc aa 1-77, a linker GT(G4S)2 (SEQ ID NO. 40), HPV-16 L2 aa 14-122, a linker (GGS)2GSSGGSGG (SEQ ID NO. 41), and HBc aa 78-176. The dimer sequence was generated using multiple PCR steps including overlap extensions and insertion of BamHI and SpeI restriction sites flanking the L2 aa 14-122, using primers L2-14-Bam-F (SEQ ID NO. 3: CAGGATCCGCAACC CAACTTTACAAGAC) and L2-122-Spe-R (SEQ ID NO. 2). The HBche-L2 coding sequence was inserted into a geminiviral replicon binary vector pBYR2eK2M (FIG. 3), which includes the following elements: CaMV 35S promoter with duplicated enhancer (Huang et al., 2009), 5′ UTR of N. benthamiana psaK2 gene (Diamos et al., 2016), intron-containing 3′ UTR and terminator of tobacco extensin (Rosenthal et al, 2018), CaMV 35S 3′ terminator (Rosenthal et al, 2018), and Rb7 matrix attachment region (Diamos et al., 2016).

2. Recombinant Immune Complex

The recombinant immune complex (RIC) vector was adapted from Kim et al., (2015). The HPV-16 L2 (aa 14-122) segment was inserted into the BamHI and SpeI sites of the gene encoding humanized mAb 6D8 heavy chain, resulting in 6D8 epitope-tagged L2. The heavy chain fusion was inserted into an expression cassette linked to a 6D8 kappa chain expression cassette, all inserted into a geminiviral replicon binary vector (FIG. 3, RIC vector). Both cassettes contain CaMV 35S promoter with duplicated enhancer (Huang et al., 2009), 5′ UTR of N. benthamiana psaK2 gene (Diamos et al., 2016), intron-containing 3′ UTR and terminator of tobacco extensin (Rosenthal et al, 2018), and Rb7 matrix attachment region (Diamos et al., 2016).

ii. Agroinfiltration of Nicotiana benthamiana Leaves

Binary vectors were separately introduced into Agrobacterium tumefaciens EHA105 by electroporation. The resulting strains were verified by restriction digestion or PCR, grown overnight at 30° C., and used to infiltrate leaves of 5- to 6-week-old N. benthamiana maintained at 23-25° C. Briefly, the bacteria were pelleted by centrifugation for 5 minutes at 5,000 g and then resuspended in infiltration buffer (10 mM 2-(N-morpholino)ethanesulfonic acid (MES), pH 5.5 and 10 mM MgSO4) to OD600=0.2, unless otherwise described. The resulting bacterial suspensions were injected by using a syringe without needle into leaves through a small puncture (Huang et al. 2004). Plant tissue was harvested after 5 DPI, or as stated for each experiment. Leaves producing GFP were photographed under UV illumination generated by a B-100AP lamp (UVP, Upland, CA).

iii. Protein Extraction

Total protein extract was obtained by homogenizing agroinfiltrated leaf samples with 1:5 (w:v) ice cold extraction buffer (25 mM sodium phosphate, pH 7.4, 100 mM NaCl, 1 mM EDTA, 0.1% Triton X-100, 10 mg/mL sodium ascorbate, 0.3 mg/mL PMSF) using a Bullet Blender machine (Next Advance, Averill Park, NY) following the manufacturer's instruction. To enhance solubility, homogenized tissue was rotated at room temperature or 4° C. for 30 minutes. The crude plant extract was clarified by centrifugation at 13,000 g for 10 minutes at 4° C. Necrotic leaf tissue has reduced water weight, which can lead to inaccurate measurements based on leaf mass. Therefore, extracts were normalized based on total protein content by Bradford protein assay kit (Bio-Rad) with bovine serum albumin as standard.

iv. SDS-PAGE and Western Blot

Clarified plant protein extract was mixed with sample buffer (50 mM Tris-HCl, pH 6.8, 2% SDS, 10% glycerol, 0.02% bromophenol blue) and separated on 4-15% polyacrylamide gels (Bio-Rad). For reducing conditions, 0.5M DTT was added, and the samples were boiled for 10 minutes prior to loading. Polyacrylamide gels were either transferred to a PVDF membrane or stained with Coomassie stain (Bio-Rad) following the manufacturer's instructions. For L2 detection, the protein transferred membranes were blocked with 5% dry milk in PBST (PBS with 0.05% tween-20) overnight at 4° C. and probed with polyclonal rabbit anti-L2 diluted 1:5000 in 1% PBSTM, followed by goat anti-rabbit horseradish peroxidase conjugate (Sigma). Bound antibody was detected with ECL reagent (Amersham).

v. Immunization of Mice and Sample Collection

All animals were handled in accordance to the Animal Welfare Act and Arizona State University IACUC. Female BALB/C mice, 6-8 weeks old, were immunized subcutaneously with purified plant-expressed L2 (14-122), HBche-L2 VLP, L2 RIC, or PBS mixed 1:1 with Imject® Alum (Thermo Scientific, Rockford, IL). In all treatment groups, the total weight of antigen was set to deliver an equivalent 5 μg of L2. Doses were given on days 0, 21, and 42. Serum collection was done as described (Santi et al. 2008) by submandibular bleed on days 0, 21, 42, and 63.

vi. Antibody Measurements

Mouse antibody titers were measured by ELISA. Bacterially-expressed L2 (amino acids 11-128) was bound to 96-well high-binding polystyrene plates (Corning), and the plates were blocked with 5% nonfat dry milk in PBST. After washing the wells with PBST (PBS with 0.05% Tween 20), the diluted mouse sera were added and incubated. Mouse antibodies were detected by incubation with polyclonal goat anti-mouse IgG-horseradish peroxidase conjugate (Sigma). The plate was developed with TMB substrate (Pierce) and the absorbance was read at 450 nm. Endpoint titers were taken as the reciprocal of the lowest dilution which produced an OD450 reading twice the background. IgG1 and IgG2a antibodies were measured with goat-anti mouse IgG1 or IgG2a horseradish peroxidase conjugate.

vii. Electron Microscopy

Purified samples of HBche or HBche-L2 were initially incubated on 75/300 mesh grids coated with formvar. Following incubation, samples were briefly washed twice with deionized water then negatively stained with 2% aqueous uranyl acetate. Transmission electron microscopy was performed with a Phillips CM-12 microscope, and images were acquired with a Gatan model 791 CCD camera.

viii. Statistical Analysis

The significance of vaccine treatments and virus neutralization was measured by non-parametric Mann-Whitney test using GraphPad prism software. Two stars (**) indicates p values <0.05. Three stars (***) indicates p values <0.001.

b. Design and Expression of HBc VLPs and RIC Displaying HPV16 L2

BeYDV plant expression vectors (FIG. 3) expressing either the target VLP HBche-L2, or L2 and HBche alone as controls, were agroinfiltrated into the leaves of N. benthamiana and analyzed for VLP production. After 4-5 days post infiltration (DPI), leaves displayed only minor signs of tissue necrosis, indicating that the VLP was well-tolerated by the plants (FIG. 4A). Leaf extracts analyzed by reducing SDS-PAGE showed an abundant band near the predicted size of 51 kDa for HBche-L2, just above the large subunit of rubisco (RbcL). HBche was detected around the predicted size of 38 kDa (FIG. 4B). Western blot probed with anti-L2 polyclonal serum detected a band for HBche-L2 at ˜51 kDa (FIG. 4B). These results indicate that this plant system is capable of producing high levels of L2-containing HBc VLP.

To express L2-containing MC, amino acids 14-122 of HPV16 L2 were fused with linker to the C-terminus of the 6D8 antibody heavy chain and tagged with the 6D8 epitope (Kim et al. 2015). A BeYDV vector (FIG. 3) expressing both the L2-fused 6D8 heavy chain and the light chain was agroinfiltrated into leaves of N. benthamiana and analyzed for RIC production. To create more homogenous human-type glycosylation, which has been shown to improve antibody Fc receptor binding in vivo, transgenic plants silenced for xylosyltransferase and fucosyltransferase were employed (Castilho and Steinkellner 2012). By western blot, high molecular weight bands >150 kDa suggestive of RIC formation were observed (FIG. 4C). Expression of soluble L2 RIC was lower than HBche-L2 due to relatively poor solubility of the RIC (FIG. 4C).

After rigorous genetic optimization, the N. benthamiana system is capable of producing very high levels of recombinant protein, up to 30-50% of the total soluble plant protein, in 4-5 days (Diamos et al. 2016). Using this system, we produced and purified milligram quantities of fully assembled and potently immunogenic HBc VLPs displaying HPV L2 through a simple one-step purification process (FIGS. 4A-4C and 6).

c. Purification and Characterization of HBche-L2 and L2 RIC

To assess the assembly of HBc-L2 VLP, clarified plant extracts containing either HBche-L2 or HBche were analyzed by sucrose gradient sedimentation. HBche-L2 sedimented largely with HBche, which is known to form VLP, though a small increase in density was observed with HBche-L2, perhaps due to the incorporation of L2 into the virus particle (FIG. 5A). To demonstrate particle formation, sucrose fractions were examined by electron microscopy. Both HBche and HBche-L2 formed ˜30 nm particles, although the appearance of HBche-L2 VLP suggested slightly larger, fuller particles (FIGS. 5C and 5D). As most plant proteins do not sediment with VLP, pooling peak sucrose fractions resulted in >95% pure HBche-L2 (FIG. 5B), yielding sufficient antigen (>3 mg) for vaccination from a single plant leaf.

L2 RIC was purified from plant tissue by protein G affinity chromatography. By SDS-PAGE, an appropriately sized band was visible >150 kDa that was highly pure (FIG. 5B). Western blot confirmed the presence of L2 in this band, indicating proper RIC formation (FIG. 5B). L2 RIC bound to human complement C1q receptor with substantially higher affinity compared to free human IgG standard, suggesting proper immune complex formation (FIG. 5E).

d. Mouse Immunization with HBche-L2 and L2 RIC

Groups of Balb/c mice (n=8) were immunized, using alum as adjuvant, with three doses each of 5 μg L2 delivered as either L2 alone, HBche-L2 VLP, L2 RIC, or a combination of half VLP and half RIC. VLP and RIC, alone or combined, greatly enhanced antibody titers compared to L2 alone by more than an order of magnitude at all time points tested (FIG. 6). After one or two doses, the combined VLP/RIC treatment group outperformed both the VLP or RIC groups, reaching mean endpoint titers of >200,000, which represent a 700-fold increase over immunization with L2 alone (FIG. 6). After the third dose, both the VLP and combined VLP/RIC groups reached endpoint titers >1,300,000, a 2-fold increase over the RIC alone group. To determine the antibody subtypes produced by each treatment group, sera were assayed for L2-binding IgG1 and IgG2a. All four groups produced predominately IgG1 (FIG. 7, note dilutions). However, RIC and especially VLP-containing groups had an elevated ratio of IgG2a:IgG1 (>3-fold) compared to L2 alone (FIG. 7).

In vitro neutralization of HPV16 pseudovirions showed that the VLP and RIC groups greatly enhanced neutralization compared to L2 alone (FIG. 5, p<0.001). Additionally, VLP and RIC combined further enhanced neutralization activity ($5-fold, p<0.05) compared to either antigen alone, supporting the strong synergistic effect of delivering L2 by both platforms simultaneously.

In this study, by displaying amino acids 11-128 on the surface of plant-produced HBc VLPs, L2 antibody titers as high as those seen with L1 vaccines were generated (FIG. 6). Mice immunized with L2 alone had highly variable antibody titers, with titers spanning two orders of magnitude. By contrast, the other groups had much more homogenous antibody responses, especially the VLP-containing groups, which had no animals below an endpoint titer of 1:1,000,000 (FIG. 6). These results underscore the potential of HBc VLP and RIC to provide consistently potent immune responses against L2. Moreover, significant synergy of VLP and RIC systems was observed when the systems were delivered together, after one or two doses (FIG. 6). Since equivalent amounts of L2 were delivered with each dose, the enhanced antibody titer did not result from higher L2 doses. Rather, these data suggest that higher L2-specific antibody production may be due to augmented stimulation of L2-specific B cells by T-helper cells that were primed by RIC-induced antigen presenting cells. Although treatment with VLP and RIC alone reached similar endpoint titers as the combined VLP/RIC group after 3 doses, virus neutralization was substantially higher (>5-fold) in the combined group (FIG. 8). Together, these data indicate unique synergy exists when VLP and RIC are delivered together. Inventors have observed similarly significant synergistic enhancement of immunogenicity for a variety of other antigens.

Mice immunized with L2 alone had highly variable antibody titers, with titers spanning two orders of magnitude. By contrast, the VLP and VLP/RIC groups had much more homogenous antibody responses, with no animals below an endpoint titer of 1:1,000,000 (FIG. 6). These results underscore the potential of HBc VLP and RIC to provide consistently potent immune responses against L2.

Fc gamma receptors are present on immune cells and strongly impact antibody effector functions such as antibody-dependent cell-mediated cytotoxicity and complement-dependent cytotoxicity (Jefferis 2009). In mice, these interactions are controlled in part by IgG subtypes. IgG1 is associated with a Th2 response and has limited effector functions. By contrast, IgG2a is associated with a Th1 response and more strongly binds complement components (Neuberger and Raj ewsky 1981) and Fc receptors (Radaev 2002), enhancing effector functions and opsonophagocytosis by macrophages (Takai et al. 1994). Immunization with L2 alone was found to produce low levels of IgG2a, however immunization with RIC and VLP produced significant increases in IgG2a titers. VLP-containing groups in particular showed a 3-fold increase in the ratio of IgG2a to IgG1 antibodies (FIG. 7). Importantly, production of IgG2a is associated with successful clearance of a plethora of viral pathogens (Coutelier et al. 1988; Gerhard et al. 1997; Wilson et al. 2000; Markine-Goriaynoff and Coutelier 2002).

The glycosylation state of the Fc receptor also plays an important role in antibody function. Advances in glycoengineering have led to the development of transgenic plants with silenced fucosyl- and xylosyl-transferase genes capable of producing recombinant proteins with authentic human N-glycosylation (Strasser et al. 2008). Antibodies produced in this manner have more homogenous glycoforms, resulting in improved interaction with Fc gamma and complement receptors compared to the otherwise identical antibodies produced in mammalian cell culture systems (Zeitlin et al. 2011; Hiatt et al. 2014; Strasser et al. 2014; Marusic et al. 2017). As the known mechanisms by which RIC vaccines increase immunogenicity of an antigen depend in part on Fc and complement receptor binding, HPV L2 RIC were produced in transgenic plants with silenced fucosyl- and xylosyl-transferase. Consistent with these data, we found that L2 RIC strongly enhanced the immunogenicity of L2 (FIG. 6). However, yield suffered from insolubility of the RIC (FIG. 4C). We found that the 11-128 segment of L2 expresses very poorly on its own in plants and may be a contributing factor to poor L2 RIC yield. Importantly, we have produced very high yields of RIC with different antigen fusions. Thus, in some aspects, antibody fusion with a shorter segment of L2 could substantially improve the yield of L2 RIC.

e. Neutralization of HPV Pseudovirions

Neutralization of papilloma pseudoviruses (HPV 16, 18, and 58) with sera from mice immunized IP with HBc-L2 VLP and L2(11-128) showed neutralization of HPV 16 at titers of 400-1600 and 200-800, respectively (Table 1). More mice IP-immunized with HBc-L2 VLP had antisera that cross-neutralized HPV 18 and HPV 58 pseudoviruses, compared with mice immunized with L2(11-128). Anti-HBc-L2 VLP sera neutralized HPV 18 at titers of 400 and HPV 58 at titers ranging from 400-800 (Table 1), while anti-L2(11-128) sera neutralized HPV 18 at a titer of 200 and HPV 58 at a titer of 400 (Table 1). None of the sera from intranasal-immunized mice demonstrated neutralizing activity, consistent with lower anti-L2 titers for intranasal than for intraperitoneal immunized mice.

TABLE 1
L2-specific serum IgG and pseudovirus neutralization
titers from IP immunized mice
Neutralization of Pseudoviruses
ImmunogenSerum IgGHPV 16HPV 18HPV 58
HBc-L2>50,000 400
~70,0001600400400
>80,0001600400800
L2 (11-128)~8000 200
~12,000 400
~50,000 800200400

Patent 2024
3' Untranslated Regions 5' Untranslated Regions AA 149 Agrobacterium tumefaciens aluminum potassium sulfate aluminum sulfate Amino Acids Animals Animals, Transgenic Antibodies Antibody Formation Antigen-Presenting Cells Antigens B-Lymphocytes Bacteria Bromphenol Blue Buffers Cell Culture Techniques Cells Centrifugation Chromatography, Affinity Cloning Vectors Cold Temperature Combined Modality Therapy complement 1q receptor Complement Receptor Complex, Immune Complex Extracts Cytotoxicities, Antibody-Dependent Cell Cytotoxin Digestion DNA, A-Form DNA Sequence Edetic Acid Electron Microscopy Electroporation Enzyme-Linked Immunosorbent Assay Epitopes ethane sulfonate Fc Receptor Females Formvar Fucosyltransferase G-substrate Gamma Rays Genes Genes, vif Glycerin Goat Helix (Snails) Helper-Inducer T-Lymphocyte Homo sapiens Homozygote Horseradish Peroxidase Human papillomavirus 16 Human papillomavirus 18 Human Papilloma Virus Vaccine IGG-horseradish peroxidase IgG1 IgG2A Immune Sera Immunoglobulin Heavy Chains Immunoglobulins Immunologic Factors Institutional Animal Care and Use Committees Introns Inventors L2 protein, Human papillomavirus type 16 Light Macrophage Mammals Matrix Attachment Regions Mice, Inbred BALB C Microscopy Milk, Cow's Morpholinos Mus Necrosis Needles Nicotiana Oligonucleotide Primers Oligonucleotides Open Reading Frames Opsonophagocytosis Papilloma Pathogenicity Plant Development Plant Extracts Plant Leaves Plant Proteins Plants Plants, Transgenic polyacrylamide gels Polystyrenes polyvinylidene fluoride prisma Protein Glycosylation Proteins Punctures Rabbits Receptors, IgG Recombinant Proteins Replicon Reproduction Response, Immune Ribulose-Bisphosphate Carboxylase Large Subunit Satellite Viruses SDS-PAGE Serum Serum Albumin, Bovine Sodium Ascorbate Sodium Chloride sodium phosphate Specimen Collection Stars, Celestial Strains Sucrose Sulfate, Magnesium Syringes System, Immune Technique, Dilution Tissue, Membrane Tissues Transferase Transmission Electron Microscopy Triton X-100 Tromethamine Tween 20 Ultraviolet Rays uranyl acetate Vaccination Vaccines Vaccines, Recombinant Virion Viroids Virus Vision Western Blotting xylosyltransferase

Example 2

Materials Characterization.

Laboratory powder X-ray diffraction data were collected in Bragg-Brentano geometry using a Bruker D8-Focus diffractometer (Cu Kα: λ, =1.5418 Å; 40 kV voltage 25 mA current). Powders were lightly ground and packed into an aluminum sample holder with a Si(111) surface with an average depth of 0.7 mm S. High-resolution synchrotron X-ray diffraction was collected on a sample packed into in a poly(4,4′-oxydiphenylenepyromellitimide) capillary in transmission geometry at 295 K at beamline 11-BM of the Advanced Photon Source (λ=0.4133410 Å). Rietveld refinement of the high-resolution data was performed using the EXPGUI interface of GSAS software suite.27 Details of the refinement and the resulting structure including bond distances and angles are found in Tables 1-3. Structures depicted in FIG. 1 were plotted using the VESTA software suite.28 Scanning electron microscopy (SEM) images were collected using a JEOL JSM-7500F FE-SEM equipped with an Oxford energy-dispersive X-ray spectrometer (EDS), which was used to collect EDS spectra depicted in FIGS. 2, 5, and 6. SEM images were collected at accelerating voltages between 3-5 kV; EDS spectra were collected at an accelerating voltage of 20 kV until a minimum of 450,000 counts was achieved. Prior to SEM characterization, samples were lightly ground in a mortar and pestle and affixed to an aluminum substrate with carbon tape and subsequently analyzed without any further manipulation. Transmission electron microscopy (TEM) images were collected using a JEOL JEM-2010 instrument at an accelerating voltage of 200 kV. Scanning transmission X-ray microscopy (STXM) measurements were collected at beamline 10-ID1 of the Canadian Light Source, a 2.9-GeV third-generation synchrotron facility. A 25-nm outermost-zone zone plate was used to obtain a diffraction-limited spatial resolution of, at all times, greater than 30 nm. A 500-line per mm plane grating monochromator was used to acquire the V L-edge and O K-edge spectral stacks. The incident photon flux (I0) count rate was adjusted to be <20 MHz and was further optimized to 17.5 MHz as read by the STXM detector by adjusting the exit slits of the incident beam. The V L- and O K-edge stacks covered an energy range from 508-560 eV with energy steps of 0.2 eV in regions with spectral features of interest and 1 eV in the continuum region beyond the specific elemental edges with a uniform dwell time of 1 ms for each section. Transmission spectra were converted to absorption spectra using a background spectrum from the STXM maps, selected so as not to include sample signal. All STXM data were analyzed and processed using aXis2000 software (unicorn.mcmaster.ca/aXis2000.html).

Patent 2024
Aluminum Anabolism As-A 2 BM 11 Capillaries Carbon Figs Light Microscopy Microtubule-Associated Proteins Poly A Powder Radiography Scanning Electron Microscopy Transmission, Communicable Disease Transmission Electron Microscopy vanadium pentoxide X-Ray Diffraction

Example 3

The morphological characterization of the GQDs synthesized by a top-down/bottom-up approach was performed using HRTEM (High-Resolution Transmission Electron Microscope, JEOL JEM-2100). For the TEM measurements, the samples were prepared on the carbon-coated 200-mesh copper grid under ambient conditions. The photoluminescence spectra of Nd/Tm doped GQDs and RGQDs were measured utilizing Horiba Scientific SPEX NanoLog. The absorbance of Nd3+/Tm3+ doped GQDs and RGQDs samples were measured within the range of 200-1000 nm using Agilent Technologies (Cary 60 UV-vis) absorption spectrometer. RGQDs graphitic structure was characterized using a DeltaNu Raman spectrometer with 785 nm excitation at 100 mW maximum power. The quantum yield of the RGQDs was determined using a Newport 819C-SL integrating sphere with Spectralon coating. Fluorescence microscopy was performed using an Olympus IX73 fluorescence microscope with 60× (IR-corrected Olympus Plan Apo) water immersion objective coupled to the NIR detector InGaAs Photon etc (ZEPHIR™ 1.7), which is connected to a hyperspectral fluorescence imager (Photon etc.) to enable spectrally-resolved imaging in the near-infrared region.

Patent 2024
Carbon Copper Fluorescence Graphite Microscopy, Fluorescence Submersion Transmission Electron Microscopy Vision
Using a dose of 50 μg/mL, the five types of Mt (Na-Mt, H-Na-Mt, C-H-Na-Mt, Ca-Mt, and MMt) were respectively used to treat HCEC-B4G12 cells for 24 h, after which the cells were seeded in 6-cm-diameter dish and cultured overnight at 37 °C in a 5%-CO2 incubator. The cells were washed three times with PBS and collected, then fixed overnight with 2.5% glutaraldehyde solution at 4 °C. After undergoing gradient dehydration and embedding, the sample cells were sectioned by ultrathin slicer, stained and dried, and examined with transmission electron microscope (TEM; Hitachi H7650, Japan).
Publication 2023
3-hydroxycholest-7-ene-14-carbaldehyde Cells Dehydration Glutaral Hyperostosis, Diffuse Idiopathic Skeletal Transmission Electron Microscopy
Colonic tissues were fixed with 2.5% glutaraldehyde. After removal of excess fixative with PBS, samples were fixed with 1% osmic acid at 20 °C for 2 h, dehydrated in acetone, and then infiltrated with acetone and epoxy. Epoxy resin-embedded tissues were sectioned (80 nm in thickness), stained with uranyl acetate and lead citrate, and finally viewed under a transmission electron microscope (FEI, Hillsboro, America).
Publication 2023
Acetone Citrate Colon Epoxy Resins Fixatives Glutaral Osmium Tetroxide Tissues Transmission Electron Microscopy uranyl acetate

Top products related to «Transmission Electron Microscopy»

Sourced in Japan, United States, Germany, United Kingdom, China, France
The Hitachi H-7650 is a transmission electron microscope (TEM) designed for high-resolution imaging of materials. It provides a core function of nanoscale imaging and analysis of a wide range of samples.
Sourced in Japan, United States, Germany, United Kingdom, China, France
The JEM-2100 is a transmission electron microscope (TEM) manufactured by JEOL. It is designed to provide high-quality imaging and analysis of a wide range of materials at the nanoscale level. The instrument is equipped with a LaB6 electron source and can operate at accelerating voltages up to 200 kV, allowing for the investigation of a variety of samples.
Sourced in Japan, United States, Germany, United Kingdom
The JEM-2100F is a transmission electron microscope (TEM) designed and manufactured by JEOL. It is capable of high-resolution imaging and analytical capabilities. The JEM-2100F is used for a variety of research and industrial applications that require advanced electron microscopy techniques.
Sourced in Japan, United States, Germany, China, United Kingdom
The HT7700 is a high-resolution transmission electron microscope (TEM) designed for materials analysis and characterization. It provides advanced imaging and analytical capabilities for a wide range of applications in materials science, nanotechnology, and life sciences. The core function of the HT7700 is to enable high-resolution, high-contrast imaging and elemental analysis of nanoscale structures and materials.
Sourced in Japan, United States, China, Germany, United Kingdom, Spain, Canada, Czechia
The S-4800 is a high-resolution scanning electron microscope (SEM) manufactured by Hitachi. It provides a range of imaging and analytical capabilities for various applications. The S-4800 utilizes a field emission electron gun to generate high-quality, high-resolution images of samples.
Sourced in Japan, United States, Germany, United Kingdom, France, Spain
The JEM-1400 is a transmission electron microscope (TEM) produced by JEOL. It is designed to provide high-quality imaging and analysis of a wide range of materials at the nanoscale level. The JEM-1400 offers a maximum accelerating voltage of 120 kV and features advanced optics and detectors to enable detailed examination of samples.
Sourced in United Kingdom, Germany, United States, France, Japan, China, Netherlands, Morocco, Spain, Cameroon
The Zetasizer Nano ZS is a dynamic light scattering (DLS) instrument designed to measure the size and zeta potential of particles and molecules in a sample. The instrument uses laser light to measure the Brownian motion of the particles, which is then used to calculate their size and zeta potential.
Sourced in Germany, United States, Japan, United Kingdom, China, France, India, Greece, Switzerland, Italy
The D8 Advance is a versatile X-ray diffractometer (XRD) designed for phase identification, quantitative analysis, and structural characterization of a wide range of materials. It features advanced optics and a high-performance detector to provide accurate and reliable results.
Sourced in Japan, United States, Germany, United Kingdom, France
The JEM-1230 is a transmission electron microscope (TEM) manufactured by JEOL. It is designed to provide high-quality imaging and analysis of a wide range of materials. The JEM-1230 operates at an accelerating voltage of 120 kV and offers a resolution of 0.2 nanometers.
Sourced in United States, United Kingdom, Japan, China, Germany, Netherlands, Switzerland, Portugal
The ESCALAB 250Xi is a high-performance X-ray photoelectron spectroscopy (XPS) system designed for surface analysis. It provides precise and reliable data for the characterization of materials at the nanoscale level.

More about "Transmission Electron Microscopy"

Transmission Electron Microscopy, TEM, Nanoscale, Materials Science, Nanotechnology, Biology, Imaging, Protocols, PubCompare.ai, JEM-2100, JEM-2100F, HT7700, S-4800, JEM-1400, Zetasizer Nano ZS, D8 Advance, JEM-1230, ESCALAB 250Xi