We transformed the pHEE2A/B/D1/D2/D3/E/F-TRI, pHEN2C-TRI, pHSE2A-TRI, and pHEE2A-CHLI constructs into Agrobacterium strain GV3101, and transformed pHEN2A/B-TRI into GV3101/pSoup [26 (link)]. We transformed Arabidopsis Col-0 wild-type plants via the floral dip method [45 (link)]. We screened the collected seeds from the T0 plants on MS plates containing 25 mg/L hygromycin, and transplanted the resistant seedlings (T1) to soil. We extracted genomic DNA from T1 transgenic plants grown in soil. To analyze mutations of TRY, CPC, and ETC2, we amplified fragments surrounding the target sites of TRY, CPC, or ETC2 by PCR using gene-specific primers TRY-IDF0/R0, CPC-IDF0/R0, or ETC2-IDF0/R0, respectively [26 (link)]. We submitted purified PCR products for direct sequencing with primers TRY/CPC/ETC2-seqF [26 (link)] located within the PCR fragments. To analyze possible mutations of potential off-target sites of TRY, CPC, and AT5G50230 of the sgRNA targeting ETC2, we amplified fragments surrounding the off-target sites by PCR using gene-specific primers TRY-off-IDF/R, CPC-off-IDF2/R, or 5G50230-off-IDF/R, respectively. We submitted purified PCR products for direct sequencing (as opposed to sequencing of individual clones of PCR products) with primers TRY/CPC/5G50230-off-seqF located within the PCR fragments. To analyze mutations of CHLI1 and CHLI2, we amplified fragments surrounding the target sites of CHLI1 or CHLI2 by PCR using gene-specific primers CHLI1-IDF/R or CHLI2-IDF/R, respectively. We submitted purified PCR products for direct sequencing with primers CHLI1/2-seqF located within the PCR fragments. We then cloned poorly sequenced PCR products, and submitted individual positive clones for sequencing using the T7 primer. To screen the segregated non-transgenic T2 plants, we first screened nine primer combinations, with three forward primers including zCas9-IDF3-2/-IDF5/-IDF6 (located at zCas9) and three reverse primers including rbcS_E9t-IDR/-IDR2 (located at rbcS-E9 terminator) and lacp-IDF (located at the lac promoter of the vector backbone), for more specific primers (Additional file 2 : Table S3). We obtained three more specific primer pairs, including zCas9-IDF3-2/rbcS_E9t-IDR2, zCas9-IDF5/lacp-IDF, and zCas9-IDF6/lacp-IDF, with wild-type genomic DNA serving as a negative control and genomic DNA from T1 transgenic plants serving as a positive control (Additional file 2 : Table S3). We then performed counterselection PCR with the three primer pairs for screening of non-transgenic T2 plants.
>
Procedures
>
Molecular Biology Research Technique
>
DNA Fingerprinting
DNA Fingerprinting
DNA Fingerprinting: A powerful genetic analysis technique that utilizes unique DNA patterns to identify individuals.
This approach compares specific regions of the DNA molecule, known as loci, to create a distinctive genetic profile.
DNA Fingerprinting has revolutionized fields such as forensics, paternity testing, and population genetics, enabling precise identification and establishing relationships between individuals.
The process involves extracting DNA samples, amplifying target regions using specialized techniques, and comparing the resulting patterns to establish identity or family connections.
This versatile method continues to advance, with ongoing research exploring new applications and refining the underlying technologies.
Experieence the power of AI-driven optimization with PubCompare.ai to streamline your DNA Fingerprinting research and discover the latest advancements in this transformative field.
This approach compares specific regions of the DNA molecule, known as loci, to create a distinctive genetic profile.
DNA Fingerprinting has revolutionized fields such as forensics, paternity testing, and population genetics, enabling precise identification and establishing relationships between individuals.
The process involves extracting DNA samples, amplifying target regions using specialized techniques, and comparing the resulting patterns to establish identity or family connections.
This versatile method continues to advance, with ongoing research exploring new applications and refining the underlying technologies.
Experieence the power of AI-driven optimization with PubCompare.ai to streamline your DNA Fingerprinting research and discover the latest advancements in this transformative field.
Most cited protocols related to «DNA Fingerprinting»
Agrobacterium
Arabidopsis
Clone Cells
Cloning Vectors
DNA Fingerprinting
Erythrocytes
Genes
Genome
hygromycin A
Mutation
Oligonucleotide Primers
Plant Embryos
Plants
Plants, Transgenic
Seedlings
Strains
Vertebral Column
The p2gR-TRI-A and p2gR-TRI-B vectors were transformed into Agrobacterium strain GV3101/pSoup using the freeze-thaw method, whereas pHSE-2gR-CHLI was transformed into Agrobacterium strain GV3101. Arabidopsis Col-0 wild-type plants were used for transformation via the floral dip method. The collected seeds were screened on MS plates containing 25 mg/L hygromycin. Genomic DNA was extracted from T1 transgenic plants grown in soil. Fragments surrounding the target sites were amplified by PCR using gene-specific primers TRY-IDF/R, CPC-IDF/R, and ETC2-IDF/R (Additional file 1 : Table S1). The purified PCR product was cloned into cloning vector pCBC, and DNA from positive clones for each PCR fragment was sequenced using the T7 primer to identify mutations. To screen segregated nontransgenic T2 plants, genomic DNA was extracted from T2 plants grown in soil. With wild-type genomic DNA serving as a negative control and genomic DNA from T1 transgenic plants serving as a positive control, counterselection PCR was performed with three primer pairs, including Hyg-IDF/R and Hyg-IDF2/R2 for the hygromycin-resistance gene and zCas9-IDF/R for zCas9 (Additional file 1 : Table S1). To analyze mutations of nontransgenic T2 plants, fragments surrounding the target sites of TRY, CPC or ETC2 were amplified by PCR using gene-specific primers TRY-IDF0/R0, CPC-IDF0/R0, and ETC2-IDF0/R0 (Additional file 1 : Table S1). Purified PCR products were submitted for sequencing with primers (TRY/CPC/ETC2-seqF) located within the PCR fragments (Additional file 1 : Table S1). Badly sequenced PCR products were then cloned into cloning vector pCBC and DNA from positive clones was sequenced using the T7 primer.
Agrobacterium
Arabidopsis
Clone Cells
Cloning Vectors
DNA Fingerprinting
Freezing
Genes
Genome
hygromycin A
Mutation
Oligonucleotide Primers
Plant Embryos
Plants
Plants, Transgenic
S-pentachlorobuta-1,3-dien-yl-cysteine
Strains
Induced electrocompetent M. smegmatis mc2155:pJV53 cells were prepared as described previously[27] (link). Briefly, after growth to OD600 of ∼0.4 in Middlebrook 7H9 with 0.2% glycerol, 0.05% Tween 80, and 0.2% succinate, cells were induced with 0.2% acetamide, grown for 3 hours, washed three times with ice-cold 10% glycerol, and stored at −80°C. Aliquots (100 µl) were co-electroporated with phage DNA and recombineering substrate, recovered at 37°C in 7H9 containing 10% ADC and 1 mM CaCl2 for ∼2 hours (lysis does not occur until after 3 hours), and plated on 7H10 agar as top agar lawns with approximately 300 µl of M. smegmatis mc2155.
Plaques were picked into 100 µl phage buffer (10 mM Tris-HCl, pH 7.5; 10 mM MgSO4; 68.5 mM NaCl; 1 mM CaCl2). One microliter was PCR amplified with flanking primers (25–35 bp) annealing upstream and downstream of the mutant allele, or by Deletion Amplification Detection Assay (DADA)-PCR using Platinum Taq High Fidelity DNA Polymerase (Invitrogen) and an upstream primer whose 3′ end anneals over the deletion junction. DADA-PCR parameters were similar to those described for MAMA-PCR[30] (link), with the combined annealing and extension step performed at or just above the melting temperature of the DADA-PCR primer. Plaques containing mixtures of deletion and wild-type DNA were picked into 100 µl buffer, and 10 µl of 10−3, 10−4 and 10−5 dilutions were plated with 300 µl M. smegmatis cells. Either individual plaques from the 10−4 and 10−5 plates or lysates from 10−3 or 10−4 plates were screened for the presence of the mutation by PCR as described above.
Plaques were picked into 100 µl phage buffer (10 mM Tris-HCl, pH 7.5; 10 mM MgSO4; 68.5 mM NaCl; 1 mM CaCl2). One microliter was PCR amplified with flanking primers (25–35 bp) annealing upstream and downstream of the mutant allele, or by Deletion Amplification Detection Assay (DADA)-PCR using Platinum Taq High Fidelity DNA Polymerase (Invitrogen) and an upstream primer whose 3′ end anneals over the deletion junction. DADA-PCR parameters were similar to those described for MAMA-PCR[30] (link), with the combined annealing and extension step performed at or just above the melting temperature of the DADA-PCR primer. Plaques containing mixtures of deletion and wild-type DNA were picked into 100 µl buffer, and 10 µl of 10−3, 10−4 and 10−5 dilutions were plated with 300 µl M. smegmatis cells. Either individual plaques from the 10−4 and 10−5 plates or lysates from 10−3 or 10−4 plates were screened for the presence of the mutation by PCR as described above.
acetamide
Agar
Alleles
Bacteriophages
Biological Assay
Buffers
Cells
Cold Temperature
Deletion Mutation
DNA Fingerprinting
Glycerin
M Cells
Mutation
Oligonucleotide Primers
Platinum
Senile Plaques
Sodium Chloride
Succinate
Sulfate, Magnesium
Taq Polymerase
Technique, Dilution
Tromethamine
Tween 80
For construction of deletion vectors for the selected genes (Table 1 ) the orotidine-5'-phosphate decarboxylase gene of T. reesei (pyr4, TR_74020) was used as selectable marker. The marker gene was amplified using primers pyr4F and pyr4R (supplementary file 1). The 50 μl reaction mixture contained 1.25 U Takara Ex Taq™ (Takara Bio, Madison, Wisconsin), 1 × Ex Taq™ Buffer, 0.2 mM dNTP, 0.1 μM forward and reverse primer, 1 μl T. reesei QM9414 genomic DNA (90 ng/μl) as template and nuclease free water. The selectable marker PCR fragment was purified using the E.Z.N.A. Gel Extraction Kit (Omega Bio-Tek, Inc., Norcross, USA).
For generation of the respective 5' and 3' flanking sequences, primers (Table1 ) were designed with the OligoExplorer software (version 1.1.2; http://www.genelink.com/tools/gl-oe.asp ). In order to enable yeast-mediated recombination of the deletion cassette, linker sequences were added to the primers for amplification of the 5' and 3' flanking region (supplementary file 1; Figure 1 ). Sequences were obtained from: T. reesei genome database (JGI webpage: http://genome.jgi-psf.org/ ).
The PCR mixture contained 1.25 U Takara Ex Taq™ (Takara Bio, Madison, Wisconsin), 1 × Ex Taq™ Buffer, 0.2 mM dNTP, 0.1 μM forward and reverse primer, 1 μl T. reesei wild-type genomic DNA (90 ng/μl) as template and nuclease free water.
For generation of the respective 5' and 3' flanking sequences, primers (Table
The PCR mixture contained 1.25 U Takara Ex Taq™ (Takara Bio, Madison, Wisconsin), 1 × Ex Taq™ Buffer, 0.2 mM dNTP, 0.1 μM forward and reverse primer, 1 μl T. reesei wild-type genomic DNA (90 ng/μl) as template and nuclease free water.
3' Flanking Region
Buffers
Cloning Vectors
Deletion Mutation
DNA Fingerprinting
Genes
Genome
Oligonucleotide Primers
Orotidine-5'-Phosphate Decarboxylase
Recombination, Genetic
Saccharomyces cerevisiae
The mutants were complemented with native gene copies of the wild-type strain 70-15. First, the pKO1B-HPH was built by the replacement of Ph3-GFP cassette with a HPH gene from pCB1003 [78] in pKO1B. The copies of the complementation genes were then cloned from the genomic DNA of the wild-type strain with the primers listed in Table S1 in Text S1 and were inserted into the XbaI/HindIII sites of pKO1B-HPH by the yeast recombinational cloning method. The constructed complementation plasmids were transformed into the mutants using the ATMT method, and the transformants were screened on selective medium containing 200 µg/ml hygromycin B. The gene-rescued transformants were identified by RT-PCR at the mRNA level (Figure S4C ) with primers specific for the targeted genes (Table S1 in Text S1 ).
DNA Fingerprinting
Genes
Genome
Hygromycin B
Oligonucleotide Primers
Plasmids
Recombination, Genetic
Reverse Transcriptase Polymerase Chain Reaction
RNA, Messenger
Saccharomyces cerevisiae
Strains
Most recents protocols related to «DNA Fingerprinting»
Example 8
GuideSeq was performed to test whether end-modifications prevent double stranded DNA from directly ligating into the off-target cut sites of the guide RNA (Tsai et al., Nature Biotechnology. 33″ 187-197 (2015)). SpyCas9 protein and synthetic guide RNA targeting ARHGEF9 locus were used in HEK293 cells. The ARHGEF9 locus was chosen because it has been shown to have multiple off-target sites (Amrani et al., Genome Biology. 19: 214 (2018)). Three different types of DNA donors were used, each one being 34 bp in length and lacking homology arms. The three types were 1) a 5′ phosphorothioate modified DNA donor, 2) a 5′ phosphorothioate and phosphate modified DNA donor, and 3) a 5′ TEG and phosphate DNA donor. Over-all integration of this non-homology based direct ligation is much lower when TEG is used as the end-modification (
Arm, Upper
DNA, Double-Stranded
DNA Fingerprinting
Donors
Genome
HEK293 Cells
Ligation
Phosphates
Proteins
Tissue Donors
C57BL/6NJ wild type and Tirap-/- mice were purchased from The Jackson Laboratory (Bar Harbor, ME, USA). Mice genotyping was performed using the KAPA Taq EXtra HotStart ReadyMix PCR Kit according to the manufacturer instructions (Biosystems). The following primer pairs were used to amplify a 900 bp DNA fragment of the wild type (a+b) and the mutant genes (b+c). Primer a CATCCTGTGTGGCTGTCTGTGAACCAT, Primer b TGGCCAATGTGTGAGCAAGTTCTGTGC, Primer c ATCGCCTTCTATCGCCTTCTTGACGAG.
DNA, A-Form
DNA Fingerprinting
Genes
Mus
Oligonucleotide Primers
HEK293-H cells were maintained in suspension at 37 °C with 5% CO2 in CD293 medium supplemented with 4 mM GlutaMAX (Invitrogen). The HEK293 cell line is a permanent line established from primary embryonic human kidney and transformed with sheared human adenovirus type 5 DNA. The E1A adenovirus gene is expressed in these cells to optimize protein production. HEK293-H cells were cloned from the original 293 cell line and adapted to CD293 serum-free medium for growth in suspension. Cell line identity has been authenticated by Thermo- Fisher Scientific, and cells were tested negative for mycoplasma by qPCR detection assay. For imaging and electrophysiology, cells were plated onto poly-L-lysine coated coverslips one day before transfection and grown in a medium containing 44% DMEM (Corning), 44% Ham’s F12 (Corning), 10% fetal bovine serum (HyClone), 2 mM glutamine, 50 U/ml penicillin and 50 µg/ml streptomycin.
Adenoviruses, Human
Adenovirus Vaccine
Biological Assay
Cell Lines
Cells
DNA Fingerprinting
Embryo
Fetal Bovine Serum
Genes
Glutamine
HEK293 Cells
Homo sapiens
Kidney
Lysine
Mycoplasma
Penicillins
Poly A
Proteins
Serum
Streptomycin
Transfection
To assess SNV detection performance, Horizon Tru-Q DNA reference material (Horizon Discovery, Cambridge, UK) was used. Tru-Q4 contains six validated somatic mutations targeted by the panel. Serial dilutions of the reference material were prepared using Horizon Tru-Q0 wild-type DNA as a diluent to generate mixtures with 5.00%, 0.50%, 0.250%, 0.125%, and 0.006% variant allele frequency (VAF). Droplet digital PCR (ddPCR) testing was performed on certain SNVs to verify the accuracy of the panel tests. Two SNVs were selected from the manufacturer’s commercial pre-designed and validated probes. Detailed ddPCR methods are provided in the Supplemental Materials and Methods .
Diploid Cell
DNA Fingerprinting
Fingers
Mutation
Technique, Dilution
The AsCEP50 gene was replaced with Hyg using homologous recombination technology. Approximately 1-kb upstream and downstream fragments from the wild-type HWC-168 genomic DNA were amplified and linked to Hyg gene to construct the Δ50 deletion mutant strains. The fusion fragments were used for the protoplast mediated transformation of HWC-168.
The wild-type HWC-168 hyphae were inoculated into 200-mL flasks containing 100 mL Potato Dextrose Broth (PDB) medium, incubated at 25°C and shaken at 120 rpm for 36 h. The mycelia were filtered through three layers of gauze and thoroughly rinsed with 0.7 mol L-1 NaCl solution 2–3 times. The hyphae were transferred to a 50-mL centrifuge tube using tweezers, and digested with a mixture of enzymes, 0.1 mg of snailase (Solarbio, Beijing, China), 0.1 mg of driselase (Biotopped, Beijing, China) and 0.1 mg of lysing enzyme (SIGMA, Shanghai, China) in 10 mL of 0.7 mol L-1 NaCl. The protoplasts were resuspended in STC buffer (1.168 M D-Sorbitol, 10 mM Tris-HCl and 4.96 mM CaCl2) and the fusion fragments mixtures were added to the PTC buffer (15 mM PEG4000, 10 mM Tris-HCl and 10 mM CaCl2). The transformants were screened on Regeneration PDA medium containing ampicillin (50 μg mL–1) and hygromycin (50 μg mL–1), and PCR was performed using specific primers of Hyg, upstream and downstream fragments to confirm the transformants.
After obtaining the mutant strains, the protoplasts were obtained from the Δ50 mutant strains. The recombinant KN vector was transformed into the protoplasts of mutant strains by PEG-mediated protoplast transformation. The neomycin resistance was used to screen the revertant strains.
The wild-type HWC-168 hyphae were inoculated into 200-mL flasks containing 100 mL Potato Dextrose Broth (PDB) medium, incubated at 25°C and shaken at 120 rpm for 36 h. The mycelia were filtered through three layers of gauze and thoroughly rinsed with 0.7 mol L-1 NaCl solution 2–3 times. The hyphae were transferred to a 50-mL centrifuge tube using tweezers, and digested with a mixture of enzymes, 0.1 mg of snailase (Solarbio, Beijing, China), 0.1 mg of driselase (Biotopped, Beijing, China) and 0.1 mg of lysing enzyme (SIGMA, Shanghai, China) in 10 mL of 0.7 mol L-1 NaCl. The protoplasts were resuspended in STC buffer (1.168 M D-Sorbitol, 10 mM Tris-HCl and 4.96 mM CaCl2) and the fusion fragments mixtures were added to the PTC buffer (15 mM PEG4000, 10 mM Tris-HCl and 10 mM CaCl2). The transformants were screened on Regeneration PDA medium containing ampicillin (50 μg mL–1) and hygromycin (50 μg mL–1), and PCR was performed using specific primers of Hyg, upstream and downstream fragments to confirm the transformants.
After obtaining the mutant strains, the protoplasts were obtained from the Δ50 mutant strains. The recombinant KN vector was transformed into the protoplasts of mutant strains by PEG-mediated protoplast transformation. The neomycin resistance was used to screen the revertant strains.
Ampicillin
Buffers
Cloning Vectors
Deletion Mutation
DNA Fingerprinting
driselase
Enzymes
Genes
Genome
Glucose
Homologous Recombination
hygromycin A
Hyphae
Mycelium
Neomycin
Oligonucleotide Primers
Protoplasts
Regeneration
Sodium Chloride
Solanum tuberosum
Sorbitol
Strains
Tromethamine
Top products related to «DNA Fingerprinting»
Sourced in Germany, United States, France, United Kingdom, Netherlands, Spain, Japan, China, Italy, Canada, Switzerland, Australia, Sweden, India, Belgium, Brazil, Denmark
The QIAamp DNA Mini Kit is a laboratory equipment product designed for the purification of genomic DNA from a variety of sample types. It utilizes a silica-membrane-based technology to efficiently capture and purify DNA, which can then be used for various downstream applications.
Sourced in Germany, United States, United Kingdom, Netherlands, Spain, France, Japan, China, Canada, Italy, Australia, Switzerland, Singapore, Sweden, India, Malaysia
The QIAquick PCR Purification Kit is a lab equipment product designed for the rapid purification of PCR (Polymerase Chain Reaction) amplicons. It utilizes a silica-membrane technology to efficiently capture and purify DNA fragments from PCR reactions, removing unwanted primers, nucleotides, and enzymes.
Sourced in Germany, United States, United Kingdom, Spain, Canada, Netherlands, Japan, China, France, Australia, Denmark, Switzerland, Italy, Sweden, Belgium, Austria, Hungary
The DNeasy Blood and Tissue Kit is a DNA extraction and purification product designed for the isolation of genomic DNA from a variety of sample types, including blood, tissues, and cultured cells. The kit utilizes a silica-based membrane technology to efficiently capture and purify DNA, providing high-quality samples suitable for use in various downstream applications.
Sourced in United States, Germany
The QX200 ddPCR system is a digital PCR platform designed for sensitive and precise quantification of nucleic acids. It utilizes a water-oil emulsion droplet technology to partition samples into thousands of individual reaction chambers, enabling highly accurate and sensitive detection of target molecules.
Sourced in Germany, United States, United Kingdom, Netherlands, Spain, Japan, China, Canada, France, Australia, Switzerland, Italy, Belgium, Denmark, Sweden
The DNeasy Blood & Tissue Kit is a DNA extraction and purification kit designed for the efficient isolation of high-quality genomic DNA from a variety of sample types, including whole blood, tissue, and cultured cells. The kit utilizes a silica-based membrane technology to capture and purify DNA, providing a reliable and consistent method for DNA extraction.
Sourced in United States, China, Germany, Japan, United Kingdom, France, Canada, Italy, Australia, Switzerland, Denmark, Spain, Singapore, Belgium, Lithuania, Israel, Sweden, Austria, Moldova, Republic of, Greece, Azerbaijan, Finland
Lipofectamine 3000 is a transfection reagent used for the efficient delivery of nucleic acids, such as plasmid DNA, siRNA, and mRNA, into a variety of mammalian cell types. It facilitates the entry of these molecules into the cells, enabling their expression or silencing.
Sourced in United States, Germany
QuantaSoft is a software application developed by Bio-Rad for data analysis and management of qPCR (quantitative Polymerase Chain Reaction) experiments. The software's core function is to provide users with tools for analyzing and interpreting qPCR data generated from Bio-Rad's qPCR instruments.
Sourced in United States, France, Germany, China, United Kingdom, Japan, Switzerland, Australia, Italy, Spain, Ireland, Canada, Brazil
The Wizard Genomic DNA Purification Kit is a product designed to isolate and purify genomic DNA from a variety of sample types. It utilizes a simple, rapid, and efficient protocol to extract high-quality DNA that can be used in various downstream applications.
Sourced in Germany, Switzerland, United States, China, Spain
The DIG High Prime DNA Labeling and Detection Starter Kit is a laboratory tool used for the labeling and detection of DNA molecules. It provides the necessary reagents and components to enable the incorporation of digoxigenin-labeled nucleotides into DNA sequences, facilitating their subsequent identification and analysis.
Sourced in United States, China, Germany, United Kingdom, Canada, Japan, France, Italy, Switzerland, Australia, Spain, Belgium, Denmark, Singapore, India, Netherlands, Sweden, New Zealand, Portugal, Poland, Israel, Lithuania, Hong Kong, Argentina, Ireland, Austria, Czechia, Cameroon, Taiwan, Province of China, Morocco
Lipofectamine 2000 is a cationic lipid-based transfection reagent designed for efficient and reliable delivery of nucleic acids, such as plasmid DNA and small interfering RNA (siRNA), into a wide range of eukaryotic cell types. It facilitates the formation of complexes between the nucleic acid and the lipid components, which can then be introduced into cells to enable gene expression or gene silencing studies.
More about "DNA Fingerprinting"
DNA profiling, genetic fingerprinting, STR analysis, RFLP analysis, PCR-based DNA typing, forensic genetics, paternity testing, kinship analysis, population genetics, genetic identification, molecular markers, DNA amplification, DNA extraction, DNA purification, ddPCR, qPCR, transfection reagents, bioinformatics software.
Revolutionize your DNA fingerprinting research with PubCompare.ai - an AI-driven platform that helps you locate the best protocols from literature, pre-prints, and patents.
Our cutting-edge technology enables you to compare protocols and identify the optimal solutions for your needs.
Streamline your research process and discover the latest advancements in DNA fingerprinting technology, such as the use of the QIAamp DNA Mini Kit, QIAquick PCR Purification Kit, DNeasy Blood and Tissue Kit, QX200 ddPCR system, and Wizard Genomic DNA Purification Kit.
Leverage the power of AI-driven optimization with PubCompare.ai to enhance your DNA fingerprinting research and stay ahead of the curve in this transformative field.
Revolutionize your DNA fingerprinting research with PubCompare.ai - an AI-driven platform that helps you locate the best protocols from literature, pre-prints, and patents.
Our cutting-edge technology enables you to compare protocols and identify the optimal solutions for your needs.
Streamline your research process and discover the latest advancements in DNA fingerprinting technology, such as the use of the QIAamp DNA Mini Kit, QIAquick PCR Purification Kit, DNeasy Blood and Tissue Kit, QX200 ddPCR system, and Wizard Genomic DNA Purification Kit.
Leverage the power of AI-driven optimization with PubCompare.ai to enhance your DNA fingerprinting research and stay ahead of the curve in this transformative field.