Log In Sign up
The largest database of trusted experimental protocols
> Procedures > Molecular Biology Research Technique > In Situ Hybridization

In Situ Hybridization

In situ hybridization (ISH) is a powerful technique used to detect and localize specific nucleic acid sequences within intact cells or tissue sections.
It involves the hybridization of a labeled probe to a complementary target sequence, allowing for the visualization and analysis of gene expression patterns, chromosome structure, and viral infections.
ISH has numerous applications in basic research, diagnostic medicine, and drug discovery, enabling researchers to gain insights into cellular and molecular processes.
This versatile method can be applied to a wide range of sample types, including cultured cells, tissue sections, and whole organisms.
With its ability to provide spatial and temporal information about target molecules, in situ hybridization has become an indispensable tool in the field of molecular biology and genetics.

Most cited protocols related to «In Situ Hybridization»

1
Comprehensive Neuronal Tracing and Characterization
For in situ hybridization analysis, cryostat sections were hybridized using digoxigenin-labeled probes [45 (link)] directed against mouse TrkA or TrkB, or rat TrkC (gift from L. F. Parada). Antibodies used in this study were as follows: rabbit anti-Er81 [14 (link)], rabbit anti-Pea3 [14 (link)], rabbit anti-PV [14 (link)], rabbit anti-eGFP (Molecular Probes, Eugene, Oregon, United States), rabbit anti-Calbindin, rabbit anti-Calretinin (Swant, Bellinzona, Switzerland), rabbit anti-CGRP (Chemicon, Temecula, California, United States), rabbit anti-vGlut1 (Synaptic Systems, Goettingen, Germany), rabbit anti-Brn3a (gift from E. Turner), rabbit anti-TrkA and -p75 (gift from L. F. Reichardt), rabbit anti-Runx3 (Kramer and Arber, unpublished reagent), rabbit anti-Rhodamine (Molecular Probes), mouse anti-neurofilament (American Type Culture Collection, Manassas, Virginia, United States), sheep anti-eGFP (Biogenesis, Poole, United Kingdom), goat anti-LacZ [14 (link)], goat anti-TrkC (gift from L. F. Reichardt), and guinea pig anti-Isl1 [14 (link)]. Terminal deoxynucleotidyl transferase-mediated biotinylated UTP nick end labeling (TUNEL) to detect apoptotic cells in E13.5 DRG on cryostat sections was performed as described by the manufacturer (Roche, Basel, Switzerland). Quantitative analysis of TUNEL+ DRG cells was performed essentially as described [27 (link)]. BrdU pulse-chase experiments and LacZ wholemount stainings were performed as previously described [46 (link)]. For anterograde tracing experiments to visualize projections of sensory neurons, rhodamine-conjugated dextran (Molecular Probes) was injected into single lumbar (L3) DRG at E13.5 or applied to whole lumbar dorsal roots (L3) at postnatal day (P) 5 using glass capillaries. After injection, animals were incubated for 2–3 h (E13.5) or overnight (P5). Cryostat sections were processed for immunohistochemistry as described [14 (link)] using fluorophore-conjugated secondary antibodies (1:1,000, Molecular Probes). Images were collected on an Olympus (Tokyo, Japan) confocal microscope. Images from in situ hybridization experiments were collected with an RT-SPOT camera (Diagnostic Instruments, Sterling Heights, Michigan, United States), and Corel (Eden Prairie, Minnesota, United States) Photo Paint 10.0 was used for digital processing of images.
Hippenmeyer S., Vrieseling E., Sigrist M., Portmann T., Laengle C., Ladle D.R, & Arber S. (2005). A Developmental Switch in the Response of DRG Neurons to ETS Transcription Factor Signaling. PLoS Biology, 3(5), e159.
Full text: Click here
Publication 2005
Anabolism Animals Antibodies Apoptosis Bromodeoxyuridine Calbindins Calretinin Capillaries Cavia Cells Diagnosis Digoxigenin DNA Nucleotidylexotransferase Domestic Sheep Goat Immunohistochemistry In Situ Hybridization In Situ Nick-End Labeling LacZ Genes Lumbar Region Mice, House Microscopy, Confocal Molecular Probes Neurofilaments Neuron, Afferent Pulse Rate Rabbits Rhodamine rhodamine dextran Root, Dorsal Staining transcription factor PEA3 tropomyosin-related kinase-B, human
2
Allen Mouse Brain Atlas: Tissue Processing
The systems developed for processing tissue, RNA in situ hybridization (ISH), Nissl staining, image acquisition, and data processing for the generation of the Allen Mouse Brain Atlas (http://mouse.brain-map.org) were used. The framework, workflow, and equipment were previously described24 (link) and can be found at Data Production Processes in the Documentation – Supplementary Materials section of the Allen Mouse Brain Atlas (http://mouse.brain-map.org/pdf/ABADataProductionProcesses.pdf). Information about Cre or reporter specific probes used in ISH can be found at the Transgenic Mouse database (http://transgenicmouse.alleninstitute.org/).
Madisen L., Zwingman T.A., Sunkin S.M., Oh S.W., Zariwala H.A., Gu H., Ng L.L., Palmiter R.D., Hawrylycz M.J., Jones A.R., Lein E.S, & Zeng H. (2009). A robust and high-throughput Cre reporting and characterization system for the whole mouse brain. Nature neuroscience, 13(1), 133-140.
Publication 2009
Brain Brain Mapping In Situ Hybridization Mice, Laboratory Mice, Transgenic Tissues
3
Evaluating Histological Effects on Size
Calcein and FM1-43 staining followed published methods (Elizondo et al., 2005 (link); Ma et al., 2008 (link)). For determining the effects of histological processing on size, fish were measured then placed for two nights in 4% paraformaldeyde in phosphate buffered saline, then rinsed and remeasured. Additional fish were processed individually for in situ hybridization using standard methods for whole mount zebrafish larvae (available at: http://protist.biology.washington.edu/dparichy/), and then remeasured after incubation in staining solution.
Parichy D.M., Elizondo M.R., Mills M.G., Gordon T.N, & Engeszer R.E. (2009). Normal Table of Post-Embryonic Zebrafish Development: Staging by Externally Visible Anatomy of the Living Fish. Developmental dynamics : an official publication of the American Association of Anatomists, 238(12), 2975-3015.
Publication 2009
Fishes fluorexon FM1 43 In Situ Hybridization Larva Phosphates Saline Solution Zebrafish
4
Single-Cell Analysis of Pulmonary Fibrosis
Here, we used single-cell RNA-Seq to analyze lung tissue from patients with pulmonary fibrosis and lung tissue from transplant donors, which we used as a normal comparison. We compared these data with bulk RNA-Seq data from whole-lung tissue and flow cytometry–sorted alveolar macrophages and alveolar type II cells generated from a separate cohort. Combined with in situ RNA hybridization, these data provide a molecular atlas of disease pathobiology. We observed emergence of a distinct, novel population of macrophages exclusively in patients with fibrosis that demonstrated enhanced expression of profibrotic genes. Within epithelial cells, we observed that the expression of genes involved in Wnt secretion and response was restricted to nonoverlapping cells. We identified rare cell populations including airway stem cells and senescent cells emerging during pulmonary fibrosis in the single-cell RNA-Seq data. We performed analysis of a cryobiopsy specimen from a patient with early disease, supporting the clinical application of single-cell RNA-Seq to develop personalized approaches to therapy. Some of the results of these studies have been previously reported in the form of a preprint (https://doi.org/10.1101/296608) and conference abstracts (16 , 17 ). The dataset is available at nupulmonary.org/resources/.
Reyfman P.A., Walter J.M., Joshi N., Anekalla K.R., McQuattie-Pimentel A.C., Chiu S., Fernandez R., Akbarpour M., Chen C.I., Ren Z., Verma R., Abdala-Valencia H., Nam K., Chi M., Han S., Gonzalez-Gonzalez F.J., Soberanes S., Watanabe S., Williams K.J., Flozak A.S., Nicholson T.T., Morgan V.K., Winter D.R., Hinchcliff M., Hrusch C.L., Guzy R.D., Bonham C.A., Sperling A.I., Bag R., Hamanaka R.B., Mutlu G.M., Yeldandi A.V., Marshall S.A., Shilatifard A., Amaral L.A., Perlman H., Sznajder J.I., Argento A.C., Gillespie C.T., Dematte J., Jain M., Singer B.D., Ridge K.M., Lam A.P., Bharat A., Bhorade S.M., Gottardi C.J., Budinger G.R, & Misharin A.V. (2019). Single-Cell Transcriptomic Analysis of Human Lung Provides Insights into the Pathobiology of Pulmonary Fibrosis. American Journal of Respiratory and Critical Care Medicine, 199(12), 1517-1536.
Publication 2019
Cells Conferences Dietary Fiber Donors Epithelial Cells Fibrosis Flow Cytometry Gene Expression Grafts Hereditary Diseases In Situ Hybridization Lung Lung Transplantation Macrophage Macrophages, Alveolar Patients Population Group Pulmonary Fibrosis RNA-Seq secretion Single-Cell RNA-Seq Stem Cells Therapeutics Tissue Donors Tissue Grafts Tissues Transplant Donors Type-II Pneumocytes
5
Mapping Gene Expression to Mouse Brain Atlas
Our aim here is the try and map the gene expression profile at the cluster level to the mouse in situ hybridization atlas of the Allen Institute for Brain Research (http://mouse.brain-map.org) (Lein et al., 2007 (link)). The Allen Mouse Brain Atlas was summarized into a 200 μm voxel dataset, providing the gene expression profile (all genes) for each voxel. In this analysis we used simple correlation between the voxel gene expression (from in situ hybridization) and the cluster gene expression profile (from scRNaseq).
For each gene, the voxel data is a 67 × 41 × 58 (rows × columns × depth) array, giving an “energy” value representing the expression. In addition, for each voxel we know the anatomical annotation. The Allen Brain reference atlas is given at a finer resolution with voxels of 25μm (528 × 320 × 456). In order to achieve finer resolution and smoother images we used linear interpolation of the coarse (200μm) in situ data into the finer grid (25μm). For annotation we used the color code of the Allen reference atlas.
Since many genes have information only from sagittal sections of one hemisphere, we can neglect one hemisphere also from the genes that have coronal data. Coronal data is preferred since it has better sampling.
Zeisel A., Hochgerner H., Lönnerberg P., Johnsson A., Memic F., van der Zwan J., Häring M., Braun E., Borm L.E., La Manno G., Codeluppi S., Furlan A., Lee K., Skene N., Harris K.D., Hjerling-Leffler J., Arenas E., Ernfors P., Marklund U, & Linnarsson S. (2018). Molecular Architecture of the Mouse Nervous System. Cell, 174(4), 999-1014.e22.
Full text: Click here
Publication 2018
Brain Brain Mapping Gene Expression Genes In Situ Hybridization Mice, Laboratory Single-Cell RNA-Seq

Most recents protocols related to «In Situ Hybridization»

1
Evaluating DsiRNA Knockdown of HAO1 in Primary Hyperoxaluria
Not available on PMC !

Example 4

The ability of certain, active HAO1-targeting DsiRNAs to reduce HAO1 levels within the liver of a mouse was examined. DsiRNAs employed in the study were: HAO1-1105, HAO1-1171, HAO1-1221, HAO1-1272, HAO1-1273, HAO1-1316, HAO1-1378 and HAO1-1379, each of which were synthesized with passenger (sense) strand modification pattern “SM107” and guide (antisense) strand modification pattern “M48” (patterns described above). To perform the study, a primary hyperoxaluria model was generated through oral gavage of 0.25 mL of 0.5 M glycolate to cause urine oxalate accumulation in C57BL/6 female mice. Animals were randomized and assigned to groups based on body weight. Intravenous dosing of animals with lipid nanoparticles (LNPs; here, an LNP formulation named EnCore-2345 was employed) containing 1 mg/kg or 0.1 mg/kg of DsiRNA was initiated on day 0. Dosing continued BIW for a total of three doses in mice prior to glycolate challenge. Four hour and 24 h urine samples were collected after glycolate challenge for assessment of oxalate/creatinine levels (see FIG. 4 for experimental flow chart). Animals were then sacrificed at 24 hrs after glycolate challenge. Liver was dissected and weighed, and HAO1 levels were assessed using RT-qPCR, ViewRNA, western blot for glycolate oxidase and/or glycolate oxidase immunohistochemistry (ViewRNA, western blot for glycolate oxidase and glycolate oxidase immunohistochemistry data not shown). Serum samples were also subjected to ELISA for detection of glycolate oxidase (data not shown). Notably, all eight DsiRNAs showed robust knockdown of HAO1 when administered at 1 mg/kg (FIG. 5). At least two (HAO1-1171 and HAO1-1378) of the eight DsiRNAs tested in vivo also showed robust knockdown of HAO1 in all treated animals when administered at 0.1 mg/kg. As shown in FIG. 5, administration of the HAO1-1171-M107/M48 DsiRNA at 0.1 mg/kg caused an average knockdown of 70% in liver tissue of treated mice, while administration at 1 mg/kg produced an average knockdown of 97% in liver tissue of treated mice. Similarly, administration of the HAO1-1378-M107/M48 DsiRNA at 0.1 mg/kg caused an average knockdown of 53% in liver tissue of treated mice, while administration at 1 mg/kg produced an average knockdown of 97% in liver tissue of treated mice. HAO-1171-induced knockdown at both 0.1 mg/kg and 1 mg/kg was further confirmed by ViewRNA in situ hybridization assays.

Robust levels of HAO1 mRNA knockdown were observed in liver tissue of mice treated with 1 mg/kg amounts of HAO1-targeting DsiRNAs HAO1-1171 and HAO1-1378 (FIG. 6 and data not shown), and even 0.1 mg/kg amounts of these HAO1-targeting DsiRNAs produced robust HAO1 knockdown. As shown in FIG. 6, single dose HAO1-1171 DsiRNA treatment achieved durable HAO1 mRNA target knockdown for at least 120 hours post-administration in the liver of treated animals. While robust HAO1 knockdown was achieved in liver, initial glycolate challenge experiments yielded inconclusive phenotypic results (data not shown).

In additional in vivo experiments, both HAO1 and oxalate levels were assessed in both control- and DsiRNA-treated genetically engineered PH1 model mice.

US11873493B2. Methods and compositions for the specific inhibition of glycolate oxidase (HAO1) by double-stranded RNA (2024-01-16). Dicerna Pharmaceuticals, Inc. [US]. Inventors: Bob D. Brown [US], Henryk T. Dudek [US].
Full text: Click here
Patent 2024
Animals Biological Assay Body Weight Creatinine Enzyme-Linked Immunosorbent Assay Females Glycolates glycollate oxidase Immunohistochemistry In Situ Hybridization Lipid Nanoparticles Liver Mice, House Mice, Inbred C57BL Oxalates Phenotype Primary Hyperoxaluria RNA, Messenger Serum Tissues Tube Feeding Urine Western Blot
2
LacZ and Luciferase RNA Cardiac Transfection
Not available on PMC !

Example 10

LacZ and Luciferase Modified RNA Cardiac Transfection and Translation in a Citrate Saline Buffer

As depicted, 75 μg of LacZ encoding modified RNA with cardiac injections was transfected and translated in approximately 10% of the left ventricle (FIGS. 11A, 11B, 11C, and 11D). RNA in situ hybridization for luciferase modified RNA revealed staining expression in the myocardium at the site of injection (FIGS. 11E and 11F) and correlative luciferase protein expression shown via immunohistochemical analysis in the serial section (FIG. 11G).

US11866475B2. Modified RNA encoding VEGF-A polypeptides, formulations, and uses relating thereto (2024-01-09). MODERNATX, INC [US]. Inventors: Leif Karlsson Parinder [SE], Regina Desirée Fritsche Danielson [SE], Kenny Mikael Hansson [SE], Li Ming Gan [SE], Jonathan Clarke [SE], Ann-Charlotte Eva Egnell [SE], Kenneth Randall Chien [SE].
Full text: Click here
Patent 2024
Buffers Citrate Heart In Situ Hybridization LacZ Genes Left Ventricles Luciferases Myocardium Polypeptides Proteins Saline Solution Transfection Vascular Endothelial Growth Factors
3
Histological Analysis of African and South American Lungfish Olfactory Organs
All procedures were approved by the local Animal Ethics Committee of Iwate University. The African lungfish P. aethiopicus and South American lungfish, L. paradoxa, were purchased from commercial suppliers. The fishes were anesthetized with tricaine methanesulfonate and euthanized by decapitation. Information pertaining to the animals is shown in Table 1. Juvenile and adult individuals of each lungfish were used. According to Mlewa and Green (2004) [29 (link)] and Jorgensen and Joss (2010) [30 ], P. aethiopicus individuals over 43 cm in body length (BL) reach sexual maturity. Thus, P. aethiopicus #1 (BL 50 cm) and L. paradoxa #1 (BL 65 cm) were regarded as adults, whereas P. aethiopicus #2–4 and L. paradoxa #3 (BL 35 cm or less) were regarded as juveniles [29 (link), 30 ]. Also, we confirmed during dissection whether they had functional genital organs or not.

Animals

Animal NoTotal body length (cm)Body weight (g)SexApplication
P. aethiopicus150.0349.0FISH (left)/RNA extraction (right)
235.0150.6MDice CT
331.5100.0unknownISH
434.0118.3FSEM
L. paradoxa165.0994.5FRNA extraction (left)/ISH (right)
318.518.6MISH

ISH in situ hybridization; Dice CT Diffusible iodine-based contrast-enhanced computed tomography; SEM Scanning Electron Microscopy

For histological examination, olfactory organs were dissected from the heads and fixed in 4% paraformaldehyde in 0.1 M phosphate buffer (PB, pH 7.4). The specimens were cryoprotected in a sucrose gradient (10%, 20%, and 30% in 0.1 M PB), embedded in O.C.T. compound (Sakura Finetek, Tokyo, Japan), and sectioned sagittally using a cryostat. Sections (20 µm in thickness) were thaw mounted on MAS-coated slides (Matsunami, Osaka, Japan), air-dried, and processed for hematoxylin–eosin staining, immunohistochemistry, and in situ hybridization.
Nakamuta S., Yamamoto Y., Miyazaki M., Sakuma A., Nikaido M, & Nakamuta N. (2023). Type 1 vomeronasal receptor expression in juvenile and adult lungfish olfactory organ. Zoological Letters, 9, 6.
Full text: Click here
Publication 2023
Adult Animal Ethics Committees Animals Body Weight Buffers Decapitation Dissection Electrons Eosin Fishes Genitalia Head Human Body Immunohistochemistry In Situ Hybridization Iodine methanesulfonate Negroid Races paraform Phosphates Sense of Smell Sexual Maturation South American People Sucrose tricaine X-Ray Computed Tomography
4
Quantifying Cell Densities in Olfactory Lamellae
In sections subjected to in situ hybridization using each V1R probe, labeled cells in the lamellae and recesses were counted, and their areas were measured using ImageJ software (https://imagej.nih.gov/ij/) as described previously [28 (link)]. The number of labeled cells in the lamellae or recesses was divided by the respective area to calculate the density of labeled cells for each probe (number of labeled cells per 1 mm2).
Nakamuta S., Yamamoto Y., Miyazaki M., Sakuma A., Nikaido M, & Nakamuta N. (2023). Type 1 vomeronasal receptor expression in juvenile and adult lungfish olfactory organ. Zoological Letters, 9, 6.
Full text: Click here
Publication 2023
Cells In Situ Hybridization PER1 protein, human
5
Whole-mount in situ hybridization protocol
Whole-mount in situ hybridization was carried out as described previously in Thisse et al. [89 (link)] and Sun et al [90 (link)]. The probe DNA template was amplified from the embryonic genome or cDNA using primers (GAGCTGGAGATCCAGGCTCAT, GAAATTAATACGACTCACTATAgggagacccGAAACGGGAGGTCATTCTGAGAGT). Antisense probe RNAs for in situ hybridization were synthesized using a DIG RNA Labeling Kit (SP6/T7) (Roche) and purified using MEGAclear (Ambion).
Tang C.Y., Zhang X., Xu X., Sun S., Peng C., Song M.H., Yan C., Sun H., Liu M., Xie L., Luo S.J, & Li J.T. (2023). Genetic mapping and molecular mechanism behind color variation in the Asian vine snake. Genome Biology, 24, 46.
Full text: Click here
Publication 2023
DNA, Complementary DNA Probes Embryo Genome In Situ Hybridization Oligonucleotide Primers

Top products related to «In Situ Hybridization»

1
Dig rna labeling kit by Roche
Sourced in Switzerland, Germany, United States, United Kingdom, Canada, Japan
The DIG RNA Labeling Kit is a laboratory product used for the in vitro transcription of labeled RNA probes. It incorporates digoxigenin-labeled nucleotides into the synthesized RNA, enabling their detection in subsequent applications such as Northern blotting, in situ hybridization, and RNase protection assays.
2
Nbt bcip by Roche
Sourced in Germany, Switzerland, United States, France, Japan, Australia, China
NBT/BCIP is a chromogenic substrate used for the detection and visualization of alkaline phosphatase activity in various biological and biochemical assays. The product consists of two components, nitro-blue tetrazolium chloride (NBT) and 5-bromo-4-chloro-3'-indolyphosphate p-toluidine salt (BCIP), which together produce a dark-purple insoluble precipitate upon enzymatic cleavage by alkaline phosphatase.
3
Pgem t easy vector by Promega
Sourced in United States, China, Germany, United Kingdom, Japan, France, Italy, Australia, Switzerland, Spain, Israel, Canada
The pGEM-T Easy Vector is a high-copy-number plasmid designed for cloning and sequencing of PCR products. It provides a simple, efficient method for the insertion and analysis of PCR amplified DNA fragments.
4
Bm purple by Roche
Sourced in United States, Switzerland, Germany
BM Purple is a laboratory product manufactured by Roche. It is a chromogenic substrate used in various biochemical and immunological assays. BM Purple provides a colorimetric detection method to visualize the presence or activity of target analytes in a sample.
5
Dig rna labeling mix by Roche
Sourced in United States, Switzerland, Germany, Japan, China
The DIG RNA Labeling Mix is a labeling reagent used for the incorporation of digoxigenin-labeled nucleotides into RNA molecules during in vitro transcription. This mix contains all the necessary components, including the digoxigenin-labeled UTP, to facilitate the synthesis of digoxigenin-labeled RNA probes.
6
Superfrost plus slide by Thermo Fisher Scientific
Sourced in United States, Germany, United Kingdom, France, Canada, Switzerland, Denmark, Australia, Japan, Sweden, Spain, New Zealand, China
Superfrost Plus slides are high-quality, positively charged microscope slides designed for improved tissue adhesion and cell attachment. These slides feature a specialized coated surface that enhances the binding of biological samples, ensuring secure sample mounting and reliable results during histological and cytological applications.
7
Alkaline phosphatase conjugated anti dig antibody by Roche
Sourced in Switzerland, Germany, United States, Japan
Alkaline phosphatase-conjugated anti-DIG antibody is a laboratory reagent used to detect the presence of digoxigenin (DIG) in biological samples. The antibody is conjugated with the enzyme alkaline phosphatase, which facilitates the visualization of DIG-labeled targets through a colorimetric or chemiluminescent reaction.
8
Rnascope by Advanced Cell Diagnostics
Sourced in United States
RNAscope is a proprietary in situ hybridization technology developed by Advanced Cell Diagnostics. It enables the detection and quantification of RNA targets in intact cells and tissues. RNAscope provides a sensitive and specific platform for analyzing gene expression at the single-cell level.
9
T7 rna polymerase by Roche
Sourced in United States, Switzerland, Germany
T7 RNA polymerase is an enzyme that transcribes DNA into RNA. It is commonly used in molecular biology and biochemistry research to produce large quantities of RNA from DNA templates.
10
Pgem t easy by Promega
Sourced in United States, Germany, United Kingdom, Japan, France, China, Italy, Australia
The pGEM-T Easy Vector is a linear plasmid vector used for cloning PCR products. It contains T7 and SP6 RNA polymerase promoters flanking a multiple cloning region within the α-peptide coding region of the enzyme β-galactosidase. The vector is supplied pre-cut with a single 3' terminal thymidine (T) to the multiple cloning region, which greatly improves the efficiency of ligation of PCR products by preventing recircularization of the vector and providing a compatible overhang for PCR products generated by certain thermostable DNA polymerases.

More about "In Situ Hybridization"

In situ hybridization (ISH) is a versatile technique that allows researchers to visualize and analyze the expression patterns of specific nucleic acid sequences within intact cells or tissue samples.
This powerful method, also known as in-situ hybridization or in-situ hybridisation, involves the hybridization of a labeled probe to a complementary target sequence, enabling the detection and localization of genes, chromosomes, and viral infections.
ISH has numerous applications in basic research, diagnostic medicine, and drug discovery, providing valuable insights into cellular and molecular processes.
The technique can be applied to a wide range of sample types, including cultured cells, tissue sections, and whole organisms, making it an indispensable tool in the field of molecular biology and genetics.
ISH techniques often utilize specialized reagents and equipment, such as the DIG RNA Labeling Kit, which allows for the generation of digoxigenin-labeled RNA probes, and the NBT/BCIP substrate, which produces a purple/blue precipitate upon detection of the target sequence.
The pGEM-T Easy vector is a commonly used plasmid for cloning and in vitro transcription of RNA probes, while the BM Purple alkaline phosphatase substrate provides a visual readout of the hybridization signal.
In addition to traditional ISH methods, more advanced techniques, such as RNAscope, have been developed to enhance sensitivity and specificity.
These newer approaches often incorporate the use of enzymes like T7 RNA polymerase for efficient probe synthesis and Superfrost Plus slides to ensure optimal sample adhesion and preservation.
The field of in situ hybridization continues to evolve, with researchers utilizing innovative tools and techniques to unlock the full potential of this powerful analytical method.
By leveraging the insights gained from ISH, scientists can deepen their understanding of cellular mechanisms, advance diagnostic capabilities, and accelerate drug discovery effeorts.