> Procedures > Molecular Biology Research Technique > Nested Polymerase Chain Reaction

Nested Polymerase Chain Reaction

Nested Polymerase Chain Reaction (Nested PCR) is a highly sensitive molecular technique used to amplify specific DNA sequences.
It involves two consecutive PCR reactions, where the product from the first reaction is used as the template for the second reaction with inner primers.
This nested approach increases the specificity and sensitivity of target DNA detection, making it a valuable tool in areas such as genetic analysis, pathogen identification, and gene expression studies.
Nested PCR is particularly useful when the target sequence is present in low abundance or when non-specific amplification is a concern.
The technique allows for the selective amplification of the desired DNA fragment, even in the presence of complex biological samples or high background DNA.
Nested PCR is widely employed in basic research, diagnostic applications, and forensic investigations, contributing to advancements in molecular biology and biomedical reserach.

Most cited protocols related to «Nested Polymerase Chain Reaction»

Artemisinin-Resistant Malaria Parasite Profiling

Cited 145 times

The ART-resistant F32-ART5 parasite line was selected by culturing the ART-sensitive F32-Tanzania clone under a dose-escalating regimen of artemisinin for 5 years. The F32-TEM line was obtained by culturing F32-Tanzania in parallel without artemisinin exposure. Reference DNA was extracted from P. falciparum lines 3D7, 89F5 Palo Alto Uganda and K1992. The ring-stage survival assay (RSA_{0–3 h}) was performed as described previously^{13 (link)}. Whole-genome sequencing was performed on F32-Tanzania, F32-TEM, F32-ART5 (4 time points), three reference strains (3D7, 89F5 and K1992) and 21 Cambodian parasite isolates, using an Illumina paired-reads sequencing technology. A set of 1091 clinical P. falciparum isolates was collected from patients participating in ACT efficacy studies in 2001–2012. The K13-propeller was amplified using nested PCR. Double-strand sequencing of PCR products was performed by Macrogen. Sequences were analysed with MEGA 5 software version 5.10 to identify specific SNP combinations. Data were analysed with Microsoft Excel and MedCalc version 12. Differences were considered statistically significant when P values were less than 0.05. Ethical clearances for parasite isolate collections were obtained from the Cambodian National Ethics Committee for Health Research, the Institutional Review Board of the Naval Medical Research Center, the Technical Review Group of the WHO Regional Office for the Western Pacific, and the Institutional Review Board of the National Institute of Allergy and Infectious Diseases.

Ariey F., Witkowski B., Amaratunga C., Beghain J., Langlois A.C., Khim N., Kim S., Duru V., Bouchier C., Ma L., Lim P., Leang R., Duong S., Sreng S., Suon S., Chuor C.M., Bout D.M., Ménard S., Rogers W.O., Genton B., Fandeur T., Miotto O., Ringwald P., Le Bras J., Berry A., Barale J.C., Fairhurst R.M., Benoit-Vical F., Mercereau-Puijalon O, & Ménard D. (2013). A molecular marker of artemisinin-resistant Plasmodium falciparum malaria. Nature, 505(7481), 50-55.

Publication 2013

artemisinine Biological Assay Cambodians Clone Cells Ethics Committees Ethics Committees, Research MEGA-10 Nested Polymerase Chain Reaction Parasites Patients Strains Treatment Protocols

Detecting Genome Rearrangements with LAM-HTGTS

Cited 78 times

The procedure starts with the isolation of genomic DNA from cultured cells using a standard proteinase K digestion method. However, prior to DNA extraction, cells must be cultured for a limited duration to allow for nuclease expression to induce cleavage of the bait break-site and for translocation of bait broken ends to prey DSBs. Prey DSBs can be generated by endogenous mechanisms (e.g. activation-induced cytidine deaminase (AID) or recombination activating gene 1/2 (RAG) cleavage sites, transcriptional start sites, etc.) or ectopic mechanisms (e.g. nuclease-generated DSBs). The numerous approaches available to generate cells with bait DSBs (e.g. transfection, viral transduction, nucleofection) are not described in this procedure but are described elsewhere for commonly used cell lines^{6 (link),7 ,9 (link),10 (link)}.
Genomic DNA is sheared by sonication and the bait-prey junctions are then amplified by LAM-PCR¹⁶, using directional primers lying on one or the other side of the bait break-site (or sites). LAM-PCR with a single 5’ biotinylated primer amplifies across the bait sequence into the unknown prey sequence (Fig. 1b). Junction-containing ssDNAs are enriched via binding to streptavidin-coated magnetic beads (Fig. 1b). After washing, bead-bound ssDNAs are unidirectionally ligated to a bridge adapter^{18 (link)}. Adapter-ligated, bead-bound ssDNA fragments are then subjected to nested PCR to incorporate a barcode sequence necessary for de-multiplexing (Fig. 1b). Following an optional blocking digest to suppress the potentially large number of uncut and/or perfectly rejoined or minimally-modified bait sequences (Figs. 1b and 2a,b), a final PCR step fully reconstructs Illumina Miseq adapter sequences at the ends of the amplified bait-prey junction sequence (Figs. 1b and 2c). Samples are then separated on an agarose gel, and a resulting population of 0.5-1 kb fragments are collected and quantified prior to Miseq paired-end sequencing, with a typical 2x 250bp HTGTS library sampling ~1×10⁶ sequence reads.
We generated a custom bioinformatic pipeline that can be used to characterize the bait-prey junctions from the library of sequence reads and should be sufficient for most LAM-HTGTS applications using long paired-end sequence reads. The pipeline is available at http://robinmeyers.github.io/transloc_pipeline/ and consists of both third-party stand-alone tools (e.g. aligners) as well as custom programs built in Perl and R, enabling the processing of sequence reads directly off the sequencer into fully annotated translocation junctions in as few as two commands (Fig. 3). Briefly, library pre-processing steps consist of deconvoluting the barcoded libraries and trimming Illumina primers. The main processing pipeline is made up of three major steps: 1) local read alignment, 2) junction detection, and 3) results filtering. We use bowtie 2 to perform read alignments¹⁹. The junction detection algorithm is based on the Optimal Query Coverage (OQC) algorithm from the YAHA read aligner and breakpoint detector^{20 (link)}. The OQC attempts to achieve the following objective: to optimally infer the full paired-end query sequence from one or more alignments to a reference sequence. The optimal set is determined by using a best-path search algorithm, which enables the detection of not only simple bait-prey junction reads, but also un-joined bait sequences, as well as reads harboring multiple consecutive junctions. The algorithm allows for overlapping alignments, which is required for micro-homology analyses and naturally extends to paired-end reads. The final characterization is an ordered set of alignments termed the Optimal Coverage Set (OCS). The library of resulting OCSs is subjected to a number of filters; the combination of filters and filter parameters used will depend largely on the application. Description of the filters currently employed can also be found at http://robinmeyers.github.io/transloc_pipeline.

Hu J., Meyers R.M., Dong J., Panchakshari R.A., Alt F.W, & Frock R.L. (2016). Detecting DNA Double-Stranded Breaks in Mammalian Genomes by Linear Amplification-mediated High-Throughput Genome-wide Translocation Sequencing (LAM-HTGTS). Nature protocols, 11(5), 853-871.

Publication 2016

1,2-di-(4-sulfamidophenyl)-4-butylpyrazolidine-3,5-dione Cells Cultured Cells Cytidine Deaminase Cytokinesis Digestion DNA, Single-Stranded DNA Library Endopeptidase K Genome isolation Nested Polymerase Chain Reaction Oligonucleotide Primers RAG-1 Gene Sepharose Sequence Alignment Streptavidin Transcription Initiation Site Transfection Translocation, Chromosomal

Amplification and Sequencing of Immunoglobulin Genes

Cited 40 times

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2009

Anabolism Bone Marrow Clone Cells Diploid Cell DNA, Complementary Gels Genes Genes, Immunoglobulin Homo sapiens IgA1 IgA2 Mutation Nested Polymerase Chain Reaction Oligonucleotide Primers Reverse Transcriptase Polymerase Chain Reaction RNA-Directed DNA Polymerase Sepharose

Nested PCR protocol for Giardia TPI amplification

Cited 29 times

To amplify the TPI fragment from various Giardia isolates, a nested PCR protocol was developed that used primers complementary to the conserved published TPI nucleotide sequences of various Giardia parasites downloaded from GenBank: G. duodenalis (U57897, AF06957 to AF069563, L02116, L02120), G. muris (AF069565), and G. ardeae (AF069564). For the primary PCR, a PCR product of 605 bp was amplified by using primers AL3543 [5′-AAATIATGCCTGCTCGTCG-3′] and AL3546 [5′-CAAACCTTITCCGCAAACC-3′]. The PCR reaction comprised 0.25–2.0 μL of DNA, 200 μM each of deoxynucleoside triphosphate (dNTP), 1X PCR buffer (Perkin Elmer, Wellesley, MA), 3.0 mM MgCl₂, 5.0 U of Taq polymerase (GIBCO BRL, Frederick, MD), and 200 nM of each primer in a total of 100-μL reaction. The reactions were performed for 35 cycles (94°C for 45 s, 50°C for 45 s, and 72°C for 60 s) in a Perkin-Elmer GeneAmp PCR 9700 thermocycler, with an initial hot start (94°C for 5 min) and a final extension (72°C for 10 min). For the secondary PCR, a fragment of 530 bp was amplified by using 2.5 μL of primary PCR reaction and primers AL3544 [5′-CCCTTCATCGGIGGTAACTT-3′] and AL3545 [5′-GTGGCCACCACICCCGTGCC-3′]. The conditions for the secondary PCR were identical to the primary PCR. The PCR products were analyzed by agarose gel electrophoresis and visualized after ethidium bromide staining.

Sulaiman I.M., Fayer R., Bern C., Gilman R.H., Trout J.M., Schantz P.M., Das P., Lal A.A, & Xiao L. (2003). Triosephosphate Isomerase Gene Characterization and Potential Zoonotic Transmission of Giardia duodenalis. Emerging Infectious Diseases, 9(11), 1444-1452.

Full text: Click here

Publication 2003

Buffers Conserved Sequence Electrophoresis, Agar Gel Ethidium Bromide Giardia Magnesium Chloride Nested Polymerase Chain Reaction Oligonucleotide Primers Parasites Taq Polymerase triphosphate

Generation and Validation of R26 Reporter Mice

Cited 27 times

ES cell electroporation and production of chimeras was performed by the University of Connecticut Gene Targeting and Transgenic Facility (GTTF). The pR26-CLNFZG targeting vector was linearized with SfiI and electroporated into 129S6/C57BL/6 hybrid ES cells (D1: established by GTTF). Southern blot hybridization on BamHI-digested genomic DNA was used to screen for homologous recombination on the 5′ end using a 0.67 kb probe outside of the 5′ homology arm. The probe was liberated by EcoRV digestion of the PCR product generated with the following primers: 5′-TTCCTCTCAATATGCTGCACACAAA-3′ and 5′-GCCCAGAGAGAAAGGCTCTCCTTCA -3′. The targeted and wild-type alleles produced products of 11.5 kb and 5.8 kb, respectively. Nested PCR was used to assay for correct targeting on the 3′ end. The targeted allele generated a 5.8 kb diagnostic fragment with the following primers; 1st PCR, 5′-GGGAAGACAATAGCAGGCATGCTGG-3′ and 5′-GATGCCCAATTCCAACTGTGAAGAC-3′; 2nd PCR, 5′-TTCTGAGGCGGAAAGAACCAGCTAG-3′ and 5′-TTCCTCTCAATATGCTGCACACAAA-3′.
Chimeric mice were produced from two targeted ES cell clones by aggregation with CD1 embryos. Germ line transmission of the targeted allele was assessed by LacZ PCR with primers (5′-GCGGATCCGAATTCGAAGTTCC-3′ and 5′-TGGGTCTCCAAAGCGACTCC-3′) that generate a 333-bp product. R26^ZG was generated by a cross between R26^NZG/+ and Hprt1^Cre/+ mice. Removal of the PGKNEO cassette was verified by the presence of a 193-bp PCR product using primers that flank PGKNEO (5′-ACTGGGCACAACAGACAATCG-3′ and 5′-GCTTCAGTGACAACGTCGAG-3′). R26^NG was generated by a cross between R26^NZG/+ and R26^FLPe/FLPe mice. As R26^FLPe-driven excision of the nlslacZ cassette was incomplete, the resulting mosaic F1 offspring were crossed with R26^FLPe/+ mice to establish the R26^NG line. Removal of the nlslacZ cassette was assessed by PCR with a forward PGK pA cassette primer (5′-GATCAGCAGCCTCTGTTCCACA-3′) and a reverse EGFP primer (5′-CGCTGAACTTGTGGCCGTTTAC-3′) that amplifies a 264-bp product. Lines were maintained by breeding to FVB mice.

Yamamoto M., Shook N.A., Kanisicak O., Yamamoto S., Wosczyna M.N., Camp J.R, & Goldhamer D.J. (2009). A Multifunctional Reporter Mouse Line for Cre- and FLP-Dependent Lineage Analysis. Genesis (New York, N.Y. : 2000), 47(2), 107-114.

Publication 2009

Alleles Animals, Transgenic Biological Assay Chimera Clone Cells Cloning Vectors Diagnosis Digestion Electroporation Embryo Embryonic Stem Cells Genome Germ Line Homologous Recombination Hybrid Cells KB 11 LacZ Genes Mus N-fluoresceinylphosphatidylethanolamine Nested Polymerase Chain Reaction Oligonucleotide Primers Southern Blotting Transmission, Communicable Disease

Most recents protocols related to «Nested Polymerase Chain Reaction»

Isolation of Camel-Derived VHH Fragments

Not available on PMC !

Example 2

A blood sample was collected from the camel three days following the last injection in the immunization protocol. RNA was extracted from blood and transcribed to cDNA. The approximately 900 bp reverse transcribed sequences encoding the VH-CH1-hinge-CH2-CH3 constructs were isolated from the approximately desired 700 bp fragments encoding the VHH-hinge-CH2-CH3 species. The purified approximately 700 bp fragments were amplified by nested PCR. The amplified sequences were digested using Pst1 and Not1. The approximately 400 bp PST1/Not1 digested fragments were inserted into a Pst1/Not1 digested pMECS phagemid vector such that the sequence encoding the VHH was in frame with a DNA sequence encoding a HA/His sequence. The PCR generated sequences and the vector of pMECS phagemid were digested with PstI and NotI, subsequently, ligated to pMECS/Nb recombinant. After ligation, the products were transformed into Escherichia coli (E. coli) TG1 cells by electroporation. The transformants were enriched in growth medium, followed by transfer to 2YT+2% glucose agar plates.

US11859001B2. IL12RB1-Binding molecules and methods of use (2024-01-02). SYNTHEKINE, INC. [US], None [US]. Inventors: Robert Kastelein [US], Deepti Rokkam [US], Patrick J. Lupardus [US], Sandro Vivona [US].

Full text: Click here

Patent 2024

Agar Bacteriophages BLOOD Camels Cells Cloning Vectors Culture Media DNA, Complementary DNA Library Electroporation Escherichia coli Glucose Ligation Nested Polymerase Chain Reaction Reading Frames Vaccination

Molecular Characterization of Tick-Borne Bacteria

PCRs were performed to characterize notable bacterial species detected in tick samples through the NGS screening. The bacteria Anaplasma, Ehrlichia, Bartonella, Coxiella, Francisella and Rickettsia were targeted in the PCR amplification and sequencing. The details of all primers used for the bacteria species identification are described in Table S1.
PCRs targeting the citrate synthase gene (gltA), which amplified a 694 bp fragment, and cell division protein gene (ftsZ), which amplified a 900 bp fragment of Bartonella, were conducted in semi-nested and single PCR, respectively. For Francisella species characterization, a fraction of the T-cell epitope gene (tul4) and 16S rDNA of Francisella were targeted in a single PCR to amplify 248 bp and 1 kb fragments, respectively. Single PCRs were conducted for Rickettsia species characterization by targeting six genes: gltA gene for 580 bp, outer membrane A gene (ompA) for 542 bp, outer membrane protein B gene (ompB) for 816 bp, 17 kDa common antigen gene (htrA) for 550 bp, 16S rDNA for 1.3 kb and surface cell antigen-4 gene (Sca4) for 928 bp fragment. All PCRs for Bartonella, Francisella and Rickettsia were conducted using Ex Taq Hot Start Version (Takara Bio) in a reaction mixture of 20 µl. The conditions used in the PCR assays were as follows: 35 or 40 cycles of denaturation at 94 °C for 30 s, annealing temperature according to each respective primer set for 30 s, and extension at 72 °C for 30 s, 60 s or 90 s depending on the targeted amplicon size.
Next, to characterize the species of Anaplasma, Ehrlichia and Coxiella, we used Tks Gflex DNA Polymerase (Takara Bio) with a 25 µl reaction mixture preparation. Nested PCR was conducted for Anaplasma and Ehrlichia by amplifying a 1.3 kb fragment of 16S rDNA of Anaplasmatacea with the following conditions: initial denaturation at 95 °C for 3 min, followed by 40 cycles of denaturation step at 95 °C for 30 s, 48 or 54 °C of annealing for 30 s, and extension at 68 °C for 90 s, with a final extension at 68 °C for 5 min. A total of five genes were used for Coxiella species characterization, which included chaperone protein DnaK gene (dnaK) for 512 bp, chaperone protein GROEL gene (groEL) for 619 bp, β subunit of bacterial RNA polymerase gene (rpoB) for an estimate of 550 bp, 16S rDNA for an estimate of 1 kb and large ribosomal subunit (23S rDNA) for a 583–867 bp fragment. DNA of Coxiella was amplified with nested or semi-nested PCRs, with the following conditions: initial denaturation at 94 °C for 1 min, followed by 40 cycles of denaturation at 98 °C for 10 s, 54 or 56 °C of annealing for 15 s, and extension at 68 °C for 1 min, with a final extension at 68 °C for 5 min.
Finally, the amplicon size was verified with electrophoresis and visualized as described above. Sanger sequencing was performed on the successfully amplified samples using the BigDye Terminator version 3.1 Cycle Sequencing Kit (Applied Biosystems). The obtained sequencing products were analysed on an ABI Prism 3130X genetic analyzer (Applied Biosystems), as per the manufacturer’s instructions. The resulting sequences were assembled and trimmed using the ATGC software version 9.0.0 (GENETYX) and compared with the sequences available in the public databases using the Nucleotide Basic Local Alignment Search Tool (BLASTn) (https://blast.ncbi.nlm.nih.gov/Blast.cgi).

Lau A.C., Mohamed W.M., Nakao R., Onuma M., Qiu Y., Nakajima N., Shimozuru M., Mohd-Azlan J., Moustafa M.A, & Tsubota T. (2023). The dynamics of the microbiome in Ixodidae are shaped by tick ontogeny and pathogens in Sarawak, Malaysian Borneo. Microbial Genomics, 9(2), mgen000954.

Full text: Click here

Publication 2023

Anaplasma Antigens Bacteria Bartonella beta' subunit of RNA polymerase Biological Assay Citrate (si)-Synthase Coxiella Division, Cell DNA, Ribosomal DNA-Directed DNA Polymerase Ehrlichia Electrophoresis Epitopes, T-Lymphocyte Francisella Gene Products, Protein Genes Genes, vif Membrane Proteins Molecular Chaperones Nested Polymerase Chain Reaction Nucleotides Oligonucleotide Primers protein B Reproduction Ribosome Subunits, Large Rickettsia Surface Antigens Ticks Tissue, Membrane

Multiplex Nested PCR for Metastrongylid Nematodes

Cited 3 times

A nested PCR approach that provided higher sensitivity and specificity was chosen for the detection of A.cantonensis, A.vasorum, Ae.abstrusus, C.striatum and C.vulpis. Universal primers amplifying the entire internal transcribed spacer 1 (ITS1) region of all the metastrongylid nematodes included in this study were used for the first round of PCR [38 (link)]. For the second round, species-specific primers were designed based on multiple sequence alignment of the ITS1 of A.cantonensis, A.vasorum, Ae.abstrusus, C.striatum and C.vulpis using sequences available in GenBank and Geneious Prime® version 2019.2.1 software [24 (link)]. To facilitate the identification of products following gel electrophoresis, the size of the product for each targeted species differs by > 40 nt (Table 1). Both rounds of PCRs were performed using the Qiagen Multiplex PCR plus Kit under the following conditions: 95 ºC for 15 min to enable the Hotstart activation, followed by 35 cycles of 94 ºC for 30 s, 57 ºC for 90 s and 72 ºC for 90 s, with a final step of 72 ºC for 10 min. The reaction was performed in a total volume of 25 μl, containing 2 μM of each primer, 12.5 μl of Multiplex PCR Master Mix and 1 μl of DNA template. The specificity of the technique was confirmed by using DNA of helminths from each species with all the primers separately and the same multiplex set-up. Amplified products of the multiplex PCR were visualised in 2% agarose gel, at 75 V for at least 90 min, and the separated bands were later purified using the Gel/PCR DNA Fragments Extraction Kit (Geneaid Biotech Ltd., New Taipei City, Taiwan) and sent for capillary sequencing using the amplification primers to Macrogen Europe BV (Amsterdam, The Netherlands). The obtained sequences were assembled and edited using the Geneious Prime® 2019.2.1 software [24 (link)] and identified by BLASTn analysis of the NCBI GenBank database. All unique sequences were deposited into GenBank under accession numbers OP210306-11.Table 1

Primers designed for the multiplex-nested PCR analysis and the molecular weights of the resulting products

PCR Round	Primer	Sequence (5′–3′)	Product size (bp)^a	Species^a
1	ITS1_F1674	GTCGTAACAAGGTATCTGTAGGTG
1	ITS1_58SR4	TAGCTGCGTTTTTCATCGATA
2	ITS1_Canto_F3	AACAACTAGCATCATCTACGTC	642	Angiostrongyluscantonensis
	ITS1_Canto_R1	CATCCTGTGTATCTCGTTCC	642	Angiostrongyluscantonensis
	ITS1_Aeluro_F1	GCTTTGATCAACGAGAAACC	537	Aelurostronylusabstrusus
	ITS1_Aeluro_R2	CATACGTGCACAGTATAATCTC	537	Aelurostronylusabstrusus
	ITS1_Vasor_F1	CTCATCGTCATCATCGTTATAG	492	Angiostrongylusvasorum
	ITS1_Vasor_R1	ACCATATTCAGTAGTCATTGTC	492	Angiostrongylusvasorum
	ITS1_Creno_s_R2	GTACCACGTAACACACGA	377	Crenosomastriatum
	ITS1_Creno_F2	TCTGGAATTTTTGTGGATTGG	377	Crenosomastriatum
	ITS1_Creno_v_R1	GCTACTTATCAAGTAAGCTAGC	299	Crenosomavulpis

ITS1 Internal transcribed spacer 1

^aDetection method for C.striatum and C.vulpis share the forward primer

Izquierdo-Rodriguez E., Anettová L., Hrazdilová K., Foronda P, & Modrý D. (2023). Range of metastrongylids (superfamily Metastrongyloidea) of public health and veterinary concern present in livers of the endemic lizard Gallotia galloti of Tenerife, Canary Islands, Spain. Parasites & Vectors, 16, 81.

Full text: Click here

Publication 2023

Capillaries DNA, Helminth Electrophoresis Multiplex Polymerase Chain Reaction Nematoda Nested Polymerase Chain Reaction Oligonucleotide Primers Sepharose Sequence Alignment Striatum, Corpus

Nested PCR for PCV2 Genome Acquisition

We designed nested PCR (nPCR) primers for PCV2 screening and full-genome acquisition based on the assembled PCV2-related contigs and the best hits of them to nucleotide sequences in the NCBI database. Three sets of specific nPCR primers were used to generate three overlapping fragments. Primers used in this study are listed in Table 1. The nPCR conditions are as follows: 95 °C for 5 min for initial denaturation, 31 cycles of denaturation at 95 °C for 30 s, annealing at 52 °C (first round) or 60 °C (second round) for 30 s, and elongation at 72 °C for 40 s, ended with a final elongation at 72 °C for 5 min. PCR products of fragments were purified with MiniBEST Agarose Gel DNA Extraction Kit (TakaRa, Dalian, China), subcloned into the plasmid pMD™-18T vector (TaKaRa, Dalian, China), and subsequently transformed into competent Escherichia coli DH5α cells (TaKaRa, Dalia, China). At least three positive clones of each fragment were sent to Sangon Biotech for Sanger sequencing. Subsequently, the sequencing data were reassembled to generate the complete genomes of PCV2 in Geneious Prime.Table 1

The primers of nested PCR used for detection and amplification of the PCV2 genome

Fragment	Primer name	Application	Primer sequence (5′–3′)
1	1WF/1NF	1st and 2nd round	TGCTGTGAGTACCTTGCTGG
1	1WR	1st round	CCGTGGATTGTTCTGTAGCA
1	1NR	2nd round	GTAGATCATCCCAGGGCAGC
2	2WF^a	1st round	TGCTGTGAGTACCTTGCTGG
2	2WR^a	1st round	CCATCTTGGCCAGATCCTCC
2	2NF^a	2nd round	GCAGACCCGGAAACCACATA
2	2NR^a	2nd round	GAATGTGGACATGATGAGAT
3	3WF	1st round	GGGTTATGGTATGGCGGGAG
3	3WR	1st round	CAAACGTTACAGGGTGCTGC
3	3NF	2nd round	ATAACAGCAGTGGAGCCCAC
3	3NR	2nd round	CCAGCAAGGTACTCACAGCA

^aThe primers were also used to detect the tissue distribution of PCV2 in wild rats

Zhao M., Bao S., Xu D., He J., Zhang H., Ji L., Yang S., Wang X., Shen Q., Liu J., Zhang Q., Ma X., Zhang W, & Shan T. (2023). Virome of wild rats (Rattus norvegicus) captured far from pig farms in Jiangsu province of China reveals novel porcine circovirus type 2d (PCV2d) sequences. Virology Journal, 20, 46.

Full text: Click here

Publication 2023

Base Sequence Cells Clone Cells Cloning Vectors Escherichia coli Genome Nested Polymerase Chain Reaction Oligonucleotide Primers Plasmids Rattus Sepharose

Molecular Analysis for Malaria Recrudescence

To distinguish between recrudescence and re-infection, 4 drops of blood from malaria-positive patients were collected on filter paper on day zero before treatment, and on any day of recurrent P. falciparum malaria. Molecular analysis was conducted following the previously described method [19 (link)], with slight modifications. Briefly, blood spotted filter papers were soaked for 24 h in 1 mL of 0.5% saponin-1 phosphate buffered saline. The mixture was washed twice in 1-mL PBS and boiled for 8 min in 100 mL PCR-grade water to release DNA from the cells. To elute the extracted DNA, 150 µL Buffer AE was added to each well using a multichannel pipette and incubated for 1 min at room temperature. This setup was then centrifuged at 2608 RCF for 8 min. DNA was recovered and stored at -80 °C. Nested PCR was performed on the extracted DNA for subsequent genotyping of P. falciparum polymorphic gene loci encoding Merozoite surface protein 2 (MSP-2) using the method described by [20 (link)]. A master mix was prepared according to manufacturer instructions (New England Bio Labs, Massachusetts, USA). 24 µL of the Master Mix was added to the PCR 96 well plate and 25 µL of the master mix was also added to the negative PCR control. The plates were sealed using a thermo-seal plate sealer and placed in the PCR thermo-cycler. Amplification was then performed under the following conditions; denaturation (94 °C), annealing (55 °C), and extension (72 °C). Amplification was confirmed by running the nested PCR product together with a DNA ladder on the QIAxcel capillary electrophoresis. The result was classified as recrudescence if at least one identical MSP2 allele was detected in both ACT pre-treatment and ACT post-treatment blood samples. Blood samples where MSP2 alleles did not match ACT pre- and ACT post-treatment were classified as new infections. Any sample, which failed to amplify was classified as undetermined. Blood samples, which showed recrudescence of parasites during any follow up day were further genotyped for P. falciparum k13 resistance markers. The primers used in this protocol are shown in Table 1.Table 1

Showing Merozoite Surface Proteins-2 (MSP-2) Amplification primers

Primer name	Sequence (5′ → 3′)	Purpose
MSP-2(1)	ATGAAGGTAATTAAAACATTGTCTATTATA	External forward primer
MSP-2(4)	ATATGGCAAAAGATAAAACAAGTGTTGCTG	External reverse primer
MSP-2(A1)	CAGAAAGTAAGCCTTCTACTGG	Internal forward primer (IC3D7)
MSP-2(A2)	GATTTGTTTCGGCATTATTATGA	Internal reverse primer (IC3D7)
MSP-2(B1)	CAAATGAAGGTTCTAATACTA	External forward primer (FC27)
MSP-2(B2)	GCTTTGGGTCCTTCTTCAGTTGATTC	Internal reverse primer (FC27)

Maniga J.N., Samuel M., John O., Rael M., Muchiri J.N., Bwogo P., Martin O., Sankarapandian V., Wilberforce M., Albert O., Onkoba S.K., Adebayo I.A., Adeyemo R.O, & Akinola S.A. (2023). Novel Plasmodium falciparum k13 gene polymorphisms from Kisii County, Kenya during an era of artemisinin-based combination therapy deployment. Malaria Journal, 22, 87.

Full text: Click here

Publication 2023

Alleles BLOOD Buffers Cells Electrophoresis, Capillary Genetic Loci Infection Malaria Malaria, Falciparum Membrane Proteins Merozoites Nested Polymerase Chain Reaction Neutrophil Oligonucleotide Primers Parasites Patients Phocidae Phosphates Recrudescence Reinfection Saline Solution Saponin

Top products related to «Nested Polymerase Chain Reaction»

Qiaamp viral rna mini kit by Qiagen

Sourced in Germany, United States, United Kingdom, France, Spain, Japan, China, Netherlands, Italy, Australia, Canada, Switzerland, Belgium

The QIAamp Viral RNA Mini Kit is a laboratory equipment designed for the extraction and purification of viral RNA from various sample types. It utilizes a silica-based membrane technology to efficiently capture and isolate viral RNA, which can then be used for downstream applications such as RT-PCR analysis.

Qiaquick pcr purification kit by Qiagen

Sourced in Germany, United States, United Kingdom, Netherlands, Spain, France, Japan, China, Canada, Italy, Australia, Switzerland, Singapore, Sweden, India, Malaysia

The QIAquick PCR Purification Kit is a lab equipment product designed for the rapid purification of PCR (Polymerase Chain Reaction) amplicons. It utilizes a silica-membrane technology to efficiently capture and purify DNA fragments from PCR reactions, removing unwanted primers, nucleotides, and enzymes.

Qiaquick gel extraction kit by Qiagen

Sourced in Germany, United States, Netherlands, United Kingdom, Japan, Canada, France, Spain, China, Italy, India, Switzerland, Austria, Lithuania, Sweden, Australia

The QIAquick Gel Extraction Kit is a product designed for the purification of DNA fragments from agarose gels. It efficiently extracts and purifies DNA from gel slices after electrophoresis.

Qiaamp dna mini kit by Qiagen

Sourced in Germany, United States, France, United Kingdom, Netherlands, Spain, Japan, China, Italy, Canada, Switzerland, Australia, Sweden, India, Belgium, Brazil, Denmark

The QIAamp DNA Mini Kit is a laboratory equipment product designed for the purification of genomic DNA from a variety of sample types. It utilizes a silica-membrane-based technology to efficiently capture and purify DNA, which can then be used for various downstream applications.

Bigdye terminator v3.1 cycle sequencing kit by Thermo Fisher Scientific

Sourced in United States, Japan, Germany, United Kingdom, China, Canada, France, Poland, Malaysia, Australia, Lithuania, Italy, Switzerland, Denmark, Argentina, Norway, Netherlands, Singapore

The BigDye Terminator v3.1 Cycle Sequencing Kit is a reagent kit used for DNA sequencing. It contains the necessary components, including fluorescently labeled dideoxynucleotides, to perform the Sanger sequencing method.

Pgem t easy vector by Promega

Sourced in United States, China, Germany, United Kingdom, Japan, France, Italy, Australia, Switzerland, Spain, Israel, Canada

The pGEM-T Easy Vector is a high-copy-number plasmid designed for cloning and sequencing of PCR products. It provides a simple, efficient method for the insertion and analysis of PCR amplified DNA fragments.

Superscript 3 reverse transcriptase by Thermo Fisher Scientific

Sourced in United States, Germany, United Kingdom, Japan, France, China, Canada, Australia, Italy, Switzerland, Spain, Netherlands, Belgium, Sweden, Greece, Lithuania

SuperScript III Reverse Transcriptase is a reverse transcriptase enzyme used for the conversion of RNA to complementary DNA (cDNA). It is a genetically engineered version of the Moloney Murine Leukemia Virus (MMLV) reverse transcriptase, designed for higher thermal stability and increased resistance to RNase H activity.

Firstchoice rlm race kit by Thermo Fisher Scientific

Sourced in United States, Lithuania, China, Japan, Canada, Germany, United Kingdom

The FirstChoice RLM-RACE Kit is a laboratory tool used for rapid amplification of cDNA ends. It is designed to capture the complete 5' end of RNA transcripts, enabling researchers to identify the transcription start site of genes.

Qiaamp dna blood mini kit by Qiagen

Sourced in Germany, United States, Spain, United Kingdom, Japan, Netherlands, France, China, Canada, Italy, Australia, Switzerland, India, Brazil, Norway

The QIAamp DNA Blood Mini Kit is a laboratory equipment designed for the extraction and purification of genomic DNA from small volumes of whole blood, buffy coat, plasma, or serum samples. It utilizes a silica-based membrane technology to efficiently capture and wash DNA, while removing contaminants and inhibitors.

Dneasy blood and tissue kit by Qiagen

Sourced in Germany, United States, United Kingdom, Spain, Canada, Netherlands, Japan, China, France, Australia, Denmark, Switzerland, Italy, Sweden, Belgium, Austria, Hungary

The DNeasy Blood and Tissue Kit is a DNA extraction and purification product designed for the isolation of genomic DNA from a variety of sample types, including blood, tissues, and cultured cells. The kit utilizes a silica-based membrane technology to efficiently capture and purify DNA, providing high-quality samples suitable for use in various downstream applications.

What are the common applications of Nested Polymerase Chain Reaction (Nested PCR)?

Nested PCR is widely used in a variety of applications, including genetic analysis, pathogen identification, and gene expression studies. It is particularly useful when the target DNA sequence is present in low abundance or when non-specific amplification is a concern, as the nested approach increases the specificity and sensitivity of the detection. Nested PCR is commonly employed in basic research, diagnostic applications, and forensic investigations to selectively amplify desired DNA fragments from complex biological samples.

How does Nested PCR work and what are the key advantages over traditional PCR?

Nested PCR involves two consecutive PCR reactions, where the product from the first reaction is used as the template for the second reaction with inner primers. This nested approach increases the specificity and sensitivity of target DNA detection. The key advantages of Nested PCR over traditional PCR include improved specificity, enhanced sensitivity for low-abundance targets, and reduced non-specific amplification, making it a valuable tool for researchers and diagnosticians.

What are some common variations or types of Nested PCR?

There are several variations of Nested PCR, including Reverse Transcription Nested PCR (RT-Nested PCR) for the detection of RNA targets, Quantitative Nested PCR (qNested PCR) for precise quantification of target DNA, and Multiplex Nested PCR for the simultaneous amplification of multiple targets. These variations expand the versatility of Nested PCR and allow researchers to adapt the technique to their specific needs.

How can PubCompare.ai help optimize the use of Nested Polymerase Chain Reaction?

PubCompare.ai can greatly enhance the optimization of Nested PCR by helping researchers locate the best protocols from literature, preprints, and patents. The platform's AI-driven comparisons can identify the most reproducible and accurate Nested PCR methods, enabling researchers to choose the optimal protocol for their specific research goals. By leveraging PubCompare.ai, researchers can save time, improve their research accuracy, and ensuere the most effective use of Nested PCR in their studies.

More about "Nested Polymerase Chain Reaction"

Nested PCR, also known as two-step PCR or double-nested PCR, is an advanced molecular technique used to selectively amplify specific DNA sequences.
This method involves two consecutive PCR reactions, where the product from the first reaction serves as the template for the second reaction with inner primers.
This nested approach significantly enhances the specificity and sensitivity of target DNA detection, making it a valuable tool in various applications such as genetic analysis, pathogen identification, and gene expression studies.
Nested PCR is particularly useful when the target sequence is present in low abundance or when non-specific amplification is a concern.
The technique allows for the selective amplification of the desired DNA fragment, even in the presence of complex biological samples or high background DNA.
This makes it a powerful tool for researchers working with samples such as those obtained using the QIAamp Viral RNA Mini Kit, QIAamp DNA Mini Kit, or DNeasy Blood and Tissue Kit.
The nested PCR process typically involves the following steps: 1.
Initial PCR amplification using outer primers 2.
Purification of the first-round PCR product using a kit like the QIAquick PCR Purification Kit 3.
Second-round PCR amplification using inner primers 4.
Visualization and/or further analysis of the nested PCR product, which can be facilitated by tools like the QIAquick Gel Extraction Kit and BigDye Terminator v3.1 Cycle Sequencing Kit.
Nested PCR is widely employed in basic research, diagnostic applications, and forensic investigations, contributing to advancements in molecular biology and biomedical research.
Researchers can utilize platforms like PubCompare.ai to optimize their nested PCR protocols by identifying the most reproducible and accurate methods from the literature, preprints, and patents, further enhancing the accuracy and efficiency of their research.
In addition to nested PCR, researchers may also leverage other molecular techniques such as reverse transcription PCR (using SuperScript III Reverse Transcriptase) and rapid amplification of cDNA ends (RACE) using the FirstChoice RLM-RACE Kit to study gene expression and uncover novel genetic sequences.
By understanding the power of nested PCR and its various applications, scientists can unlock new possibilities in their research, from pathogen detection to genetic profiling and beyond.
The combination of nested PCR and complementary molecular tools, supported by comprehensive data analysis platforms, can drive significant advancements in the field of molecular biology and biomedical research.